CN111518181B

CN111518181B - Method for increasing rice yield and protein used by same

Info

Publication number: CN111518181B
Application number: CN201910107277.7A
Authority: CN
Inventors: 李莉; 李懿星; 张大兵; 邱牡丹; 王天抗; 宋书锋
Original assignee: Hunan Hybrid Rice Research Center
Current assignee: Hunan Hybrid Rice Research Center
Priority date: 2019-02-02
Filing date: 2019-02-02
Publication date: 2022-05-03
Anticipated expiration: 2039-02-02
Also published as: CN111518181A

Abstract

The invention discloses a method for improving rice yield and protein used by the method. The invention provides a method for cultivating target rice, which comprises the following steps: inhibiting the activity of RAY1 protein in the original rice to obtain the target rice; compared with the starting rice, the target rice shows that the yield is increased, the grain is enlarged, the plant height of a plant is increased, and/or the stem internode is lengthened; the RAY1 protein is a protein composed of an amino acid sequence shown by SEQ ID No.1 in a sequence table. The invention utilizes CRISPR/Cas9 technology to edit rice RAY1 gene at fixed point, and knocks out RAY1 gene through frameshift mutation, so that protein RAY1 is inactivated, and a new generation of new rice new germplasm with obviously improved yield is obtained.

Description

Method for increasing rice yield and protein used by same

Technical Field

The invention relates to the field of biotechnology breeding, in particular to a method for improving rice yield and protein used by the method.

Background

Rice (Oryza sativa) is an important food crop and provides staple food for more than half of the world's population. In order to fill the huge grain gap caused by population growth and farmland reduction, scientists put forward the super-high yield breeding theory of rice in the 80 th 20 th century, namely the combination of ideal plant type and heterosis utilization. The plant type plays an important role in rice yield, quality, resistance and light energy utilization efficiency, and comprises plant height, tillering number, tillering angle, spike type and the like, wherein the spike type is one of key factors determining the rice yield. Therefore, the method deeply excavates genes related to development of rice panicle branches, clarifies a rice panicle branching mechanism, and has important significance for shaping rice panicle types and improving rice yield.

Disclosure of Invention

The invention aims to solve the technical problem of how to improve the yield of rice.

In order to solve the above technical problems, the present invention provides a method for breeding target rice.

The method for cultivating the target rice provided by the invention comprises the following steps: inhibiting the activity of RAY1 protein in the original rice to obtain the target rice; compared with the starting rice, the target rice shows that the yield is increased, the grain is enlarged, the plant height of a plant is increased, and/or the stem internode is lengthened; the RAY1 protein is a protein composed of an amino acid sequence shown by SEQ ID No.1 in a sequence table.

In the above method, the inhibition of the activity of the RAY1 protein in the original rice may be inhibition of the whole or part of the activity of the RAY1 protein in the original rice.

In the above method, the increase in yield may be an increase in yield of individual rice; the kernel enlargement may be a kernel length increase.

In the method, the yield increase of the single-plant rice can be reflected by the fact that the ear length of the rice is lengthened, the total grain number of the single ear is increased and/or the number of branches per time is increased.

In the above method, the inhibition of the activity of RAY1 protein in the starting rice may be achieved by the loss of function of the gene encoding the RAY1 protein.

The encoding gene of the RAY1 protein can be 1) or 2) as follows:

1) a DNA molecule shown as SEQ ID No.2 in the sequence table;

2) a DNA molecule shown as SEQ ID No.3 in the sequence table.

In the above method, the loss of function of the gene encoding the RAY1 protein can be achieved by any method known in the art, such as deletion mutation, insertion mutation or base change mutation of the gene, and further the loss of function of the gene.

In the above method, the loss of function of the gene encoding the RAY1 protein may be the loss of function of all or part of the gene encoding the RAY1 protein.

In the above-mentioned methods, the gene encoding the RAY1 protein is disabled by chemical mutagenesis, physical mutagenesis, RNAi, gene site-directed editing, homologous recombination, or the like.

In any case, the entire gene encoding the RAY1 protein may be targeted, or each element regulating the expression of the gene encoding the RAY1 protein may be targeted, as long as the loss of gene function can be achieved. For example, exon 1, exon 2, exon 3 and/or exon 4 of the gene encoding RAY1 may be targeted.

In the above-mentioned genome site-directed editing, Zinc Finger Nuclease (ZFN) technology, Transcription activator effector-like nuclease (TALEN) technology, clustered regularly spaced short palindromic repeats (clustered regularly interspaced short palindromic repeats/CRISPR associated, CRISPR/Cas9system) technology, and other technologies capable of realizing genome site-directed editing can be adopted.

In the specific embodiment of the invention, the CRISPR/Cas9 technology is adopted, wherein the target sequence involved is TCGTCGAGAGCTACGAGAT, and the coding gene of the sgRNA (guide RNA) used is shown as SEQ ID No.4 in the sequence table.

More specifically, the invention uses a recombinant vector pYLCRISPR/Cas9-MT-RAY1 capable of expressing a guide RNA and Cas 9. The recombinant vector pYRCISPR/Cas 9-MT-RAY1 is a recombinant vector obtained by replacing a fragment between two Bsa I enzyme cutting sites of the vector pYRCISPR/Cas 9-MTmono with a DNA fragment containing a specific sgRNA coding gene and a U3 promoter and keeping other nucleotides of the pYRCISPR/Cas 9-MTmono unchanged, and is specifically obtained by replacing a fragment between two Bsa I enzyme cutting sites of the vector pYRCISPR/Cas 9-MTmono with a DNA molecule shown in SEQ ID No.5 in a sequence table. The above method is applicable to any rice, such as: japonica rice (Oryza sativa subsp. japonica) or indica rice (Oryza sativa subsp. indica) as long as it contains the above target sequence. An example of the present invention is rice Nipponbare (Oryza Sativa L.spp.japonica).

In order to solve the above technical problems, the present invention also protects the use of a substance inhibiting the activity of RAY1 protein in any one of the following (1) to (4): (1) the yield of the rice is improved; (2) the plant height of the rice is improved; (3) increase the internode length of the rice; (4) the size of the grains is improved; the RAY1 protein is a protein composed of an amino acid sequence shown by SEQ ID No.1 in a sequence table.

In the above application, the inhibition of the activity of the RAY1 protein may be the inhibition of the whole activity or part activity of the RAY1 protein.

In the application, the rice yield can be increased by increasing the yield of each plant of rice; the improvement of the yield of each plant of the rice can be embodied in the improvement of the ear length of the rice and/or the total grain number of each ear and/or the number of branches per time; the increasing the grain size may be increasing the length of the grain.

In the above application, the substance inhibiting the RAY1 protein may be any one of the following (1) to (3): (1) a specific sgRNA, wherein the target sequence of the specific sgRNA is TCGTCGAGAGCTACGAGAT; (2) a DNA molecule encoding the specific sgRNA of (1); (3) and (2) a vector for expressing the specific sgRNA in (1).

In the application, the coding gene of the specific sgRNA is shown as SEQ ID No.4 in a sequence table.

In the application, the vector for expressing the specific sgRNA is a recombinant vector pYLCRISPR/Cas9-MT-RAY 1. The recombinant vector pYLCRISPR/Cas9-MT-RAY1 is a recombinant vector obtained by replacing a fragment between two Bsa I enzyme cutting sites of the vector pYLCRISPR/Cas9-MTmono with a DNA fragment containing a specific sgRNA coding gene and a U3 promoter and keeping other nucleotides of pYLCRISPR/Cas9-MTmono unchanged; in particular to a DNA molecule shown in SEQ ID No.5 in a sequence table replacing a fragment between two Bsa I enzyme cutting sites of a vector pYLCRISPR/Cas 9-MTmono.

In the above application, the rice is a japonica rice variety (Oryza sativa subsp. japonica) or an indica rice variety (Oryza sativa subsp. indica). The japonica rice variety may be Nipponbare (Oryza Sativa L.spp.japonica).

In order to solve the technical problem, the invention also provides a protein RAY 1.

The protein RAY1 provided by the invention is a protein composed of an amino acid sequence shown by SEQ ID No.1 in a sequence table.

Wherein, the protein shown in SEQ ID No.1 consists of 443 amino acid residues.

In order to solve the technical problems, the invention also provides a gene for coding the protein RAY 1.

The gene for coding the protein RAY1 provided by the invention is 1) or 2):

1) a DNA molecule shown as SEQ ID No.2 in the sequence table;

2) the coding region is a DNA molecule shown as SEQ ID No.3 in the sequence table.

Wherein, SEQ ID No.3 in the sequence table is composed of 1332 nucleotides and encodes the protein shown by SEQ ID No.1 in the sequence table.

The invention utilizes CRISPR/Cas9 technology to edit rice RAY1 gene at fixed point, and knocks out RAY1 gene through frame shift mutation, so that protein RAY1 is inactivated, and new generation new rice germplasm with obviously improved yield and disease resistance is obtained. Compared with a wild type control, the obtained RAY1 fixed-point editing line has the advantages of increased yield, enlarged rice grains, increased rice spike length, increased total single spike number, increased number of branches at one time and enhanced resistance to rice blast. Therefore, the invention has important significance for improving the yield and disease resistance of the rice and provides a new material for developing new high-yield disease-resistant varieties.

Drawings

FIG. 1 is a gel electrophoresis diagram of the full-length sequence of PCR amplified RAY1 cDNA.

FIG. 2 is a map of the intermediate vector pYLgRNA-U3.

FIG. 3 is a diagram showing the alignment of the sequencing sequence of pYLgRNA-U3-RAY1 and the sequence of the intermediate vector pYLgRNA-U3.

FIG. 4 is an amplification electrophoresis detection map of the expression cassette of the intermediate vector pYLgRNA-U3-RAY 1.

FIG. 5 is a map of the genome editing vector pYLCRISPR/Cas9-MTmono vector.

FIG. 6 is an electrophoresis diagram showing the result of PCR detection of a single colony of E.coli transformed with the recombinant vector pYLCRISPR/Cas9-MT-RAY 1.

FIG. 7 shows the mutation pattern of RAY1 and the amino acid pattern encoded by the mutation.

FIG. 8 is a phenotypic comparison of line L-46 rice plants with Nipponbare NIP; wherein A is the plant height and the plant type; b is ear and primary branch; c is ear length and internode length.

FIG. 9 shows the statistical results of the agronomic traits of the L-46 rice plant and Nipponbare.

FIG. 10 shows the comparison and statistics of the characteristics of the L-46 rice plant and Nipponbare rice.

FIG. 11 shows the statistics of the total cell weight and the total individual plant weight of the rice plant of strain L-46 and Nipponbare.

FIG. 12 shows the results of the identification of rice blast inoculation of the line L-46 rice plant and Nip at the seedling stage; wherein ZA18, ZB10, ZB13, ZB20, ZC2, ZC10 and ZG1 are physiological races of rice blast.

FIG. 13 shows the relative expression amounts of the rice blast resistance-related genes OsPR1a, OsPR10 and PBZ1 in the rice plants of lines L-46, L-47 and L-48 and NiP.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The expression vector pYLgRNA-U3 is used for editing a RICE ear development Osal gene at a fixed point in a document of Shijiang Wei, Li yi star, Song Shufeng, Qiu peony, Deng Yao, Li. CRISPR/Cas 9. HYBRID RICE (HYBRID RICE), 2017 and 32 (3): 74-78, the biological material is only used for repeating the experiments related to the present invention and is not used for other purposes.

Expression vector pYLCRISPR/Cas9-MTmono in the literature "Shijiang Wei, Li-yi star, Song front, Qiu peony, Du Yao, Li. CRISPR/Cas9 fixed-point editing RICE tasal gene HYBRID RICE (HYBRID RICE), 2017, 32 (3): 74-78, publicly available from the research center for hybrid rice in Hunan, the biomaterial was used only for repeating the experiments related to the present invention, and was not used for other purposes.

Nipponbare (NIP) of the rice variety "MP, A Robust CRISPR/Cas9System for convention, High-Efficiency Multiplex Genome Editing in Mono cot and Dicot plants. mol plant.2015Aug 3; 8(8):1274-84.doi:10.1016/j. molp.2015.04.007.Epub 2015Apr 24. the biomaterial, which is publicly available from the research center for hybrid rice in Hunan, was used only for the relevant experiments to repeat the present invention and was not used for other purposes.

Physiological races of rice blast fungus (Magnaporthe oryzae) ZA18, ZB10, ZB13, ZB20, ZC2, ZC10 and ZG1 are described in the literature: "Characterization of molecular identification and pathogenesis of edge blast in Hunan protocol of China. plant Disease,2017,101 (4): 557-561 ", publicly available from the research center for hybrid rice in Hunan, the biomaterial was used only for repeating the experiments related to the present invention, and was not used for other purposes.

Example 1 cloning and sequencing of genes encoding RAY1 protein

PCR amplification was carried out using Nipponbare cDNA of rice as a template and RAY1FL-F (ATGGAGATGCACGAGTGCTG) and RAY1FL-R (ATGGAGATGCACGAGTGCTG) as primers. The amplified product is a DNA fragment of about 1300bp in size, and the result is shown in FIG. 1. Through sequence determination, the DNA fragment is 1332bp in length, has a nucleotide sequence shown as SEQ ID No.3 in a sequence table, and is named as RAY 1. It encodes a protein RAY1 composed of 443 amino acids, and the amino acid sequence is shown in SEQ ID No.1 in the sequence list. The genome DNA of RAY1 gene has a full length of 1659bp, contains 4 exons and 3 introns, and its nucleotide sequence is shown in SEQ ID No.2 of the sequence table.

Example 2 selection of Rice RAY1 Gene target site and construction of knockout vector

Design of first, target sequence

Determining a sequence with 20 th base as A at the upstream of NGG (N is any base) in a CDS region of RAY1 gene, taking a sequence consisting of 19 bases at the downstream of the adjacent 'A' as a target site to be selected (since the transcription starting base of the promoter of the intermediate vector pYLgRNA-U3 is A, the base is the same as the 20 th base at the upstream of NGG, the remaining 19 base sequences are considered as target sites to be selected), obtaining the target site sequence: TCGTCGAGAGCTACGAGAT are provided. It is located on the 3 rd exon of the gDNA of the RAY1 gene, and is specifically a DNA molecule shown in 864-882 th sites of SEQ ID No.2 in the sequence table, namely a DNA molecule shown in 653-671 th sites of SEQ ID No.3 in the sequence table.

Second, construction of recombinant plasmid

1. Construction of intermediate vector pYLgRNA-U3-RAY1

(1) Design and synthesis of RAY1 target site adaptor primer

After the target site sequence is determined, GGCA is added before the 5 'of the sense strand of the target sequence, and AAAC is added before the 5' of the antisense strand to obtain the target site joint primer. The target site linker primer sequences are as follows:

RAY1-Cas9-F：GGCATCGTCGAGAGCTACGAGAT

RAY1-Cas9-R：AAACATCTCGTAGCTCTCGACGA

(2) preparation of target site linker of RAY1

RAY1 target site linker primers RAY1-Cas9-F and RAY1-Cas9-R are diluted into mother liquor with the concentration of 10 mu M by ddH2O, 10 mu L to 80 mu L of deionized water are respectively taken to reach the final volume of 100 mu L, the mother liquor is fully mixed evenly, then heat shock is carried out for 30s at 90 ℃, the mixture is moved to room temperature to complete annealing, and RAY1 target site linker is obtained and is marked as RAY1-Cas 9.

(3) Construction of RAY1 intermediate vector

mu.L of pYLgRNA-U3 vector plasmid (shown in FIG. 2), 1. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu.L of target site linker RAY1-Cas9, 1. mu.L of Bsa I restriction enzyme and 0.5. mu.L of 10 XT 4 DNA Ligase were mixed uniformly and reacted with a PCR instrument under the following reaction conditions: 5min at 37 ℃ and 5min at 20 ℃ for 5 cycles to obtain RAY1 intermediate vector. Sequencing confirmation is carried out on the RAY1 intermediate vector, and the result shows that: the RAY1 intermediate vector has 19 bases more than the pYLgRNA-U3 vector plasmid, and the 19 bases are the RAY1 target site sequence (shown in the box of FIG. 3). This indicates that the RAY1 target site sequence has been successfully constructed into pYLgRNA-U3 vector plasmid, and the intermediate vector was named pYLgRNA-U3-RAY 1.

2. Construction of recombinant vector pYLCRISPR/Cas9-MT-RAY1

(1) Amplification of RAY1 intermediate vector expression cassette

Taking an intermediate vector pYLgRNA-U3-RAY1 as a template, and Uctcg-B1 (TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG)

) And gRCggt-BL (AGCGTGGGTCTCGACCGGGTCCATCCATCCACCAAGCTC) is used as a primer to carry out PCR amplification to obtain an amplification product. The amplification product was detected by gel electrophoresis and determined to be a DNA molecule of about 550bp in size (as shown in FIG. 4), and the amplification result was consistent with the expectation. The amplification product was recovered and purified and designated as RAY1 intermediate vector expression cassette. The expression cassette comprises a sgRNA coding gene and a U3 promoter, wherein the sgRNA target sequence is TCGTCGAGAGCTACGAGAT, sgRNA coding gene and is shown as SEQ ID No.4 in a sequence table.

(2) Construction and transformation of RAY1 site-directed editing terminal vector

The gene editing vector pYLCRISPR/Cas9-MTmono (shown in figure 5) and RAY1 intermediate vector expression cassette are cut and connected by BsAI restriction endonuclease and T4 DNA Ligase to obtain RAY1 gene site-directed editing final vector. Coli was transformed, plated on a plate containing kanamycin, and cultured overnight at 37 ℃.

(3) Detection of recombinant vector pYLCRISPR/Cas9-MT-RAY1

4 single colonies cultured overnight in the step (2) were randomly picked and named RAY1-Cas9-1, RAY1-Cas9-2, RAY1-Cas9-3 and RAY1-Cas9-4, respectively, and PCR detection was performed on the 4 single colonies using pYLCRISPR/Cas9-MT vector detection primers SP1(CCCGACATAGATGCAATAACTTC) and SP2 (GCGCGGTGTCATCTATGTTACT). The PCR amplification products were subjected to gel electrophoresis, and the results of gel electrophoresis (shown in FIG. 6) showed that a band of 550bp was amplified from a single colony of RAY1-cas9-2, which was consistent with the expectation.

Plasmid DNA of a single clone of RAY1-cas9-2 was extracted for sequencing. The sequencing result shows that: the DNA fragment shown as SEQ ID No.5 in the sequence table successfully replaces the DNA fragment between two Bsa I enzyme cutting sites on a gene editing vector pYLCRISPR/Cas 9-Mtmono. This shows that the expression cassette containing the U3 promoter and sgRNA encoding gene is successfully constructed on the gene editing vector pYLRISPR/Cas 9-MTmono, i.e. the genome site-directed editing vector of RAY1 is successfully constructed to obtain the recombinant vector pYLRISPR/Cas 9-MT-RAY 1.

Example 3 cultivation of target Rice Using recombinant plasmid

First, recombinant vector pYLCRISPR/Cas9-MT-RAY1 transformed rice Nipponbare

A method for transforming rice callus by agrobacterium-mediated transformation is utilized, a RAY1 gene is edited at a fixed point by a recombinant vector pYLCRISPR/Cas9-MT-RAY1 to transform the rice Nipponbare callus, and a positive mutant is obtained by screening and identifying.

Second, detection of fixed point editing

The positive mutants were detected by PCR and 3 mutant type homozygous mutants were obtained by sequencing, named RAY1-46, RAY1-47 and RAY1-48, respectively. Sequencing results show (as shown in figure 7), that the mutant RAY1-46 lacks 11 bases on 660 th-670 th positions of CDS of RAY1 gene, frame shift appears on 220 th position of amino acid sequence of RAY1 protein, and translation is terminated on 430 th position; the mutant RAY1-47 has 1 base T inserted between 668 th and 669 th positions of CDS of RAY1 gene, frame shift at 223 rd position of amino acid sequence of RAY1 protein, and translation termination at 434 nd position; the mutant RAY1-48 lacks 2 bases between 668 th and 671 th positions of CDS of RAY1 gene, has frame shift at 223 th position of amino acid sequence of RAY1 protein, and terminates translation at 433 th position.

Third, phenotypic identification

Normally culturing mutant RAY1-46, mutant RAY1-47 and mutant RAY1-48, and respectively harvesting T of mutant RAY1-46, mutant RAY1-47 and mutant RAY1-48₁Seed generation and planting of T₁Seed generation, and selecting T without exogenous vector and with stable heredity in seedling stage₁Generation rice strain. The T of the screened mutant RAY1-46, mutant RAY1-47 and mutant RAY1-48₁The lines of the generation rice are respectively marked as L-46, L-47 and L-48. The rice lines L-46, L-47 and L-48 and the wild type rice Nipponbare (control) are planted in the subdistricts, 32 rice plants are planted in each subdistrict, and the area of each subdistrict is 1.7 square meters.

Comparative mutant T₁Phenotype of the progeny plants and wild type plants. The results are shown in Table 1 and FIGS. 8-10, for mutant T compared to wild type plants₁The stem node elongation of the generation plant is more obvious; mature mutant T₁Plant height, ear length and primary branch of plant generationThe number of stalks and the total number of single spike grains are increased in different degrees; mutant T₁The length of the seeds of the generation plants is also obviously improved.

TABLE 1 mutant T₁Phenotypic comparison of generative plants with wild-type plants

Note: p <0.05 indicates a significant difference from the japanese clear ratio of rice, and p <0.01 indicates a very significant difference from the japanese clear ratio of rice.

Comparative mutant T₁Yield of the generative plants and wild type Nipponbare rice plants. As a result, as shown in Table 2 and FIG. 11, the yield per plant and the yield per cell of lines L-46, L-47 and L-48 were increased to various degrees compared to the control, as compared with the wild-type plants.

TABLE 2 comparison of yield of mutant T1 generation plants with wild type plants

Fourth, identification of resistance of the mutant to rice blast

1. Preliminary test for resistance to Rice blast

Rice blast resistance profiling was performed by inoculating rice mutant lines L-46, L-47 and L-48 with physiological races of rice blast ZA18, ZB10, ZB13, ZB20, ZC2, ZC10 and ZG1, respectively. Meanwhile, wild type rice Nipponbare and rice blast susceptible variety co39 was set as a control. The specific method comprises the following steps: preparing different physiological seeds into 5 × 10 with 5 ‰ gelatin solution⁴A spore/ml suspension of spores,spraying the spore suspension on the leaf surface of rice seedling with two leaves and one heart or three leaves, culturing the inoculated rice seedling in dark for 24 hr, and culturing in light and dark alternate environment (12 hr light and 12 hr dark), wherein the culture temperature is 27 deg.C and relative humidity is 90%. 10 rice plants were inoculated per mutant line and control and the experiment was repeated three times. The onset was investigated after one week (criteria are shown in Table 3). And calculating disease indexes of the mutant and wild rice plants according to the disease conditions.

The disease index formula of the rice seedling stage leaves is as follows: the disease index ∑ (number of diseased plants at each stage × number of relevant stages)/(total number of investigated plants × 9) × 100.

TABLE 3 evaluation criteria for disease incidence of rice plants

As a result, as shown in tables 4, 5 and FIG. 12, the disease indices of the lines L-46, L-47 and L-48 were much lower than that of the wild type rice Nipponbare and co39, the wild type rice Nipponbare and co39 were not resistant to all of the races of Pyricularia oryzae detected, whereas the rice plants of the lines L-46, L-47 and L-48 were resistant to all of the races of Pyricularia oryzae detected.

Table 4 investigation results of disease conditions of mutant T1 generation rice plants and wild type rice plants

TABLE 5 statistical table of disease indexes of mutant T1 generation rice plants and wild type rice plants

2. Analysis of expression characteristics of blast disease resistance-related genes OsPR1a, OsPR10 and PBZ1 in strains L-46, L-47 and L-48

Respectively collecting the leaf sheath and leaf of rice plants of rice varieties Nipponbare, strains L-46, L-47 and L-48 to extract total RNA, removing residual DNA by DNAseDNase I treatment, and reversely transcribing the residual DNA into cDNA by oligdT. With the cDNA as a template, qRT-PCR amplification is carried out by using primers PR1a-QF/QR (PR1 a-QF: CGTCTTCATCACCTGCAACT and PR1 a-QR: TGTCCATACATGCATAAACACG) and PR10-QF/QR (PR 10-QF: CTCATCCTCGACGGCTACTT and PR 10-QR: ATCAGGAAGCAGCAATACGG) and PBZ1-QF/QR (PBZ 1-QF: GGGTGTGGGAAGCACATACA and PBZ 1-QR: CCTCGAGCACATCCGACTTT) respectively, and the expression amounts of rice blast resistance related genes OsPR1a, OsPR10 and PBZ1 in Nipponbare, L-46, L-47 and L-48 are detected. And ACTIN is used as the detection reference, and the primers are ACTIN-QF (ACTIN-QF: TGCTATGTACGTCGCCATCCAG) and ACTIN-QR (ACTIN-QR: AATGAGTAACCACGCTCCGTCA).

As shown in FIG. 13, the expression levels of the rice blast resistance-related genes OsPR1a, OsPR10 and PBZ1 in the plants of lines L-46, L-47 and L-48 were all up-regulated relative to the wild type variety Nipponbare of rice. Specifically, OsPR1a, OsPR10, PBZ1 were up-regulated in rice mutant line L46 by 8.2-fold, 10.6-fold and 2.6-fold, respectively, relative to oryza sativa nipponica; up-regulating in rice mutant line L47 by 7.9 times, 11.5 times and 2.5 times respectively; up-regulated in rice mutant line L48 by 8.9 times, 10.8 times and 3.0 times respectively. The result shows that RAY1 gene negatively regulates the expression of rice blast resistance related genes OsPR1a, OsPR10 and PBZ1, thereby regulating the disease resistance of rice plants to rice blast.

Claims

1. A method for breeding target rice, comprising the steps of: inhibiting the activity of RAY1 protein in the original rice to obtain the target rice;

compared with the starting rice, the target rice shows that the yield is increased, the grain is enlarged, the plant height of a plant is increased, and/or the stem internode is lengthened; the kernel becomes larger and the length of the kernel is increased;

the RAY1 protein is a protein composed of an amino acid sequence shown by SEQ ID No.1 in a sequence table.

2. The method of claim 1, wherein: the yield increase is the increase of the yield of the single-plant rice.

3. The method according to claim 1 or 2, characterized in that: the inhibition of the activity of RAY1 protein in the starting rice is achieved by loss of function of the gene encoding the RAY1 protein.

4. The method of claim 3, wherein: the encoding gene of the RAY1 protein is 1) or 2) as follows:

1) a DNA molecule shown as SEQ ID No.2 in the sequence table;

2) a DNA molecule shown as SEQ ID No.3 in the sequence table.

5. The method of claim 3, wherein: the method for losing the function of the encoding gene of the RAY1 protein is a CRISPR/Cas9 method.

6. The method of claim 5, wherein: the CRISPR/Cas9 method comprises the step of introducing an sgRNA expression vector into the starting rice, wherein the target sequence of the sgRNA is TCGTCGAGAGCTACGAGAT.

7. Use of a substance inhibiting the activity of RAY1 protein in any one of the following (1) to (4):

(1) the yield of the rice is improved;

(2) the plant height of the rice is improved;

(3) increase the internode length of the rice;

(4) the length of the seeds is improved;

8. The use according to claim 7: the method is characterized in that: the rice yield is increased by increasing the yield of a single plant of rice.

9. Use according to claim 7 or 8, characterized in that: the substance inhibiting RAY1 protein is any one of the following (1) to (3):

(1) a specific sgRNA, wherein the target sequence of the specific sgRNA is TCGTCGAGAGCTACGAGAT;

(2) a DNA molecule encoding the specific sgRNA of (1);

(3) and (2) a vector for expressing the specific sgRNA in (1).