CN106191104B - Upland cotton transformation event ICR24001 and its specificity identification method - Google Patents
Upland cotton transformation event ICR24001 and its specificity identification method Download PDFInfo
- Publication number
- CN106191104B CN106191104B CN201610564274.2A CN201610564274A CN106191104B CN 106191104 B CN106191104 B CN 106191104B CN 201610564274 A CN201610564274 A CN 201610564274A CN 106191104 B CN106191104 B CN 106191104B
- Authority
- CN
- China
- Prior art keywords
- cotton
- transgene
- dna
- sequence
- transgene cotton
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Abstract
The invention discloses upland cotton transformation event ICR24001 and its specificity identification methods.The present invention is overexpressed GhKCS2 gene in upland cotton CCRI24, obtain transgene cotton ICR24001, it is the 68405357-68405382 interdigit that exogenous dna fragment is inserted into purpose cotton gene group A11 chromosome, the base sequence for replacing the 68405357-68405382 interdigit 24bp of A11 chromosome, obtained cotton.Proved by test: not only fibre length, specific strength, uniformity and seed cotton yield are higher than acceptor material to transgene cotton ICR24001, and plant height, length of blade, width of blade, petiole length, petiole width, fruit branch number, at bell number, Single boll weight and ginning outturn etc. it is also above acceptor material, it lays the foundation to cultivate the research of the transgene cotton with fine fiber quality.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to upland cotton transformation event ICR24001 and its specificity identification side
Method.
Background technique
Transformation event is point being made of foreign gene in the upstream and downstream flanking region and foreign gene of genomic insertion site
Minor structure.In general, the available transformant group of gene transformation plant, this transformant group includes a large amount of independent
Event, wherein each event is unique.The dyeing that expression of the foreign gene in plant is inserted by foreign gene
The influence of body position.This may originate from the influence of transcriptional regulatory element near chromatin Structure or integration site.It is mutually homogenic
Expression in different transformation events has very big difference, is also likely to be present difference on the space of expression or time mode
It is different.And the insertion of foreign gene may also will affect the expression of endogenous gene.Therefore, each separate transformation events plant receptor
The influence of object is all different.Energy effective expression foreign gene is obtained, while the plant for not influencing plant economical character itself turns
Change event has important application value in cultivating genetically modified crops new varieties.
Cotton is the important raw material of textile industry as natural reproducible fibrous raw material, and is produced in auto industry, medical treatment
Industry etc. plays an important role.The fibre length for improving cotton is all the research emphasis in cotton field, a side all the time
Face is provided since cotton fiber is the longest cell having now been found that in nature for research cell elongation regulatory mechanism
Optimal experimental material；Another party due to cotton fiber be it is unicellular convex to form, this for research cell fate decision provide
Convenience.In addition, long fibre is desired by textile industry and required for vast cotton, therefore the fiber for improving cotton is long
Degree has great importance in production.
Traditional breeding method improves the fiber quality of cotton using hybridization, and sea island cotton is high-quality long stapled to represent cotton
One of colored and four big cultivars, but since its yield can not mutually be equal to upland cotton, now in global cultivated area
Less, sea island cotton and upland cotton are all allotetraploids for genomic level, can carry out interspecific hybridization therebetween, but
It is existing research shows that there is serious trait segregation in the two hybrid generation, be difficult to polymerize Yield and Its Components in Upland Cotton and sea island cotton be fine
Tie up character.Cotton fiber development can be divided into four interlaced periods: starting phase of Fibre Development (blooms first 1 day to Post flowering
2-3 days), elongate fiber phase (Post flowering 3 days to 25 days), secondary wall thicken phase (Post flowering 15 days to 45 days) and maturity period and (open
45 days to 50 days after spending).For the fiber in rapid elongation period, elongate fiber rate most can reach 2mm/ days fastly.The length of fiber
Degree is the primary index of the quality of fiber, and the molecule mechanism for studying cotton fiber development is the basis of cotton genetic improvement.
Summary of the invention
It is an object of the present invention to provide a kind of breeding methods of transgene cotton.
The breeding method of transgene cotton provided by the invention is that exogenous dna fragment is inserted into purpose cotton gene group the
The 68405357-68405382 interdigit of A11 chromosome, replaces the 68405357-68405382 of A11 chromosome
The base sequence of interdigit 24bp, obtains transgene cotton；
The fiber quality of the transgene cotton is higher than the purpose cotton.
In the above method,
The exogenous dna fragment is the DNA molecular containing GhKCS2 gene.
In the above method,
The nucleotides sequence of the exogenous dna fragment is classified as sequence 1 in sequence table.
In the above method,
The fiber quality of the transgene cotton is higher than the purpose cotton and is embodied in following B1)-B15):
B1) length of the transgene cotton fiber is higher than the purpose cotton；
B2) mic value of the transgene cotton fiber is lower than the purpose cotton；
B3) uniformity of the transgene cotton fiber is higher than the purpose cotton；
B4) elongation of the transgene cotton fiber is lower than the purpose cotton；
B5) specific strength of the transgene cotton fiber is higher than the purpose cotton；
B6) seed cotton yield of the transgene cotton fiber is higher than the purpose cotton；
B7) plant height of the transgene cotton is higher than the purpose cotton；
B8) length of blade of the transgene cotton is higher than the purpose cotton；
B9) width of blade of the transgene cotton is higher than the purpose cotton；
B10) the petiole length of the transgene cotton is higher than the purpose cotton；
B11) the petiole width of the transgene cotton is higher than the purpose cotton；
B12) the stem branch angle of the transgene cotton is lower than the purpose cotton；
B13) Single boll weight of the transgene cotton is higher than the purpose cotton；
B14) transgene cotton at bell number be higher than the purpose cotton；
B15) ginning outturn of the transgene cotton is higher than the purpose cotton.
In the above method,
The exogenous dna fragment imports the purpose cotton by the recombinant vector containing the exogenous dna fragment.
In the above method,
The purpose cotton is upland cotton.
It is a further object to provide for detect or assist to detect plant sample to be measured whether derive from it is above-mentioned
The method of transgene cotton or its offspring that method obtains.
Detect whether plant sample to be measured derives from turning for above method acquisition provided by the present invention for detecting or assisting
The method of gene cotton or its offspring include the following steps:
It detects in the genomic DNA of the plant sample to be measured and whether contains DNA fragmentation A,
Upstream flanking fragment of the DNA fragmentation A by above-mentioned exogenous dna fragment in the transgene cotton, the external source
DNA fragmentation and the exogenous dna fragment are formed in the downstream flanking fragment of the transgene cotton；
If the genomic DNA of the plant sample to be measured contains the DNA fragmentation A, the plant sample to be measured be or
Candidate is the transgene cotton or its offspring；
If the genomic DNA of the plant sample to be measured does not contain the DNA fragmentation A, the plant sample to be measured is not
For or candidate be not the transgene cotton or its offspring.
In the above method, the method be it is following 1) or 2) or 3):
1) direct Sequencing；
2) PCR amplification is carried out to the genomic DNA of plant sample with primer pair 1 and/or primer pair 2, if purposeful amplification
Product, then the plant sample derives from the transgene cotton or its offspring；
The primer pair 1 is that can expand to be held by the exogenous dna fragment 5 ' and close to its upstream flanking fragment
Some or all of composition DNA molecular first primer pair；Its corresponding purpose amplified production is the DNA molecular first；
The primer pair 2 is that can expand to be held by the exogenous dna fragment 3 ' and close to its downstream flanking fragment
Some or all of composition DNA molecular second primer pair；Its corresponding purpose amplified production is the DNA molecular second；
The nucleotides sequence of the upstream flanking fragment is classified as sequence 2 in sequence table；
The nucleotides sequence of the downstream flanking fragment is classified as sequence 3 in sequence table；
3) probe of the DNA molecular first described in energy specific bond or the DNA molecular second is to the plant sample DNA to be measured
Southern hybridization is carried out, obtains hybridized fragment if can hybridize, the plant sample to be measured derives from the transgene cotton
Or its offspring.
In the above method, 2) in, the primer pair 1 specifically single strand dna as shown in sequence 5 in sequence table and sequence
Single strand dna shown in sequence 6 forms in table；
The primer pair 2 is specifically in the single strand dna as shown in sequence 7 in sequence table and sequence table shown in sequence 8
Single strand dna composition.
It is a still further object of the present invention to provide for detect or assist to detect plant sample to be measured whether derive from it is above-mentioned
The kit of transgene cotton or its offspring that method obtains.
Detect whether plant sample to be measured derives from turning for above method acquisition provided by the present invention for detecting or assisting
The kit of gene cotton or its offspring include above-mentioned primer pair 1 and/or above-mentioned primer pair 2.
Application of the transgene cotton that the above method obtains in breeding also belongs to protection scope of the present invention.
It is a still further object of the present invention to provide a kind of methods of cotton that acquisition fiber quality improves.
The method provided by the invention for obtaining the cotton that fiber quality improves includes the following steps:
(1) transgene cotton is obtained according to the method described above；
(2) transgene cotton is selfed or is hybridized, breeding offspring is obtained, after identifying the breeding according to the method described above
In generation, obtains target plant.
In the above method, the deposit number of the transgene cotton is CCTCC NO:P201606.
Final object of the present invention is to provide the product of the cultivation for transgene cotton.
Any one of product provided by the present invention for the cultivation of transgene cotton is following a)-c):
A) above-mentioned upstream flanking fragment and above-mentioned downstream flanking fragment；
B) above-mentioned exogenous dna fragment；
C) the relevant biomaterial of above-mentioned exogenous dna fragment；
The biomaterial is following A 1) any one of to A11):
A1) contain the expression cassette of the exogenous dna fragment；
A2) contain the recombinant vector of the exogenous dna fragment；
A3) contain A1) recombinant vector of the expression cassette；
A4) contain the recombinant microorganism of the exogenous dna fragment；
A5) contain A1) recombinant microorganism of the expression cassette；
A6) contain A2) recombinant microorganism of the recombinant vector；
A7) contain A3) recombinant microorganism of the recombinant vector；
A8) contain the transgenic plant cells system of the exogenous dna fragment；
A9) contain A1) the transgenic plant cells system of the expression cassette；
A10) contain A2) the transgenic plant cells system of the recombinant vector；
A11) contain A3) the transgenic plant cells system of the recombinant vector.
The said goods are in the length and/or mic value and/or specific strength and/or uniformity/for regulating and controlling plant fiber or stretch
Application in long rate also belongs to protection scope of the present invention.
The said goods are in regulation plant plant height and/or length of blade and/or width of blade and/or petiole length and/or leaf
It handle width and/or stem branch angle and/or fruit branch number and/or single bell number and/or is also belonged at the application in bell number and/or in ginning outturn
Protection scope of the present invention.
The present invention makes GhKCS2 gene mistake in upland cotton CCRI24 in GhKCS2 channel genes upland cotton CCRI24
Expression, obtains transgene cotton ICR24001, and transgene cotton ICR24001 is that exogenous dna fragment is inserted into purpose cotton gene
The 68405357-68405382 interdigit of group A11 chromosome, replaces the 68405357- of A11 chromosome
The base sequence of 68405382 interdigit 24bp, obtained cotton.Passing through test proves: transgene cotton ICR24001 not only fiber
Length, specific strength and uniformity be higher than acceptor material, and plant height, length of blade, width of blade, petiole length, petiole width,
Fruit branch number is also above acceptor material at bell number, Single boll weight, ginning outturn etc., to cultivate the transgenic cotton with fine fiber quality
Colored research lays the foundation.
Detailed description of the invention
Fig. 1 is the graphic representation of transformation event ICR24001；[A]: 5 ' engaging zones；[B] 3 ' engaging zones；[C] is corresponding
In the 5 ' ends and coupled flanking genomic region of the transgenosis DNA of insertion；[D]: the transgenosis DNA corresponding to insertion
3 ' ends and coupled flanking genomic region；[E]: transgene expression cassette；[F]: upland cotton genomic flanking sequence
With the continuous sequence of transgene expression cassette.
Fig. 2 is that the fibre length of transgene cotton ICR24001 and acceptor material CCRI24 compares.
Fig. 3 is that the seed cotton yield of transgene cotton ICR24001 and acceptor material CCRI24 compares.
Fig. 4 is the transgene cotton ICR24001 of Post flowering different number of days compared with the cotton boll of acceptor material CCRI24.
Fig. 5 is that the breeding offspring of transgene cotton ICR24001 and the seed cotton yield of acceptor material CCR124 compare.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Upland cotton CCRI24 in following embodiments is in document " PAG1, a cotton brassinosteroid
It is disclosed in catabolism gene, modulates fiber elongation ", the public can be from Chinese Academy of Agricultural Sciences cotton
Flower research institute obtains.
Agrobacterium LBA4404 in following embodiments is in document " Constitutive expression of the
virulence genes improves the efficiency of plant transformation by
It is disclosed in Agrobacterium ", the public can obtain from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.
Embodiment 1, the acquisition for turning GhKCS2 cotton and Analysis of agronomic characters
One, turn the acquisition of GhKCS2 cotton
1, the building of recombinant vector
By expression cassette A insertion pCambia2300 carrier, (plasmid is purchased from NTCC Type Tissue Collection subordinate's
BioVector plasmid vector bacterium cell gene collection, article No. are as follows: Biovectorpcambia2300) EcoRI and
It between PstI restriction enzyme site, and keeps the other sequences of pCambia2300 carrier constant, obtains recombinant vector (sequence 4).Above-mentioned table
Shown in 234-2974 nucleotide of the nucleotide sequence such as in sequence table 1 up to box A.Expression cassette A successively includes coming from upstream
From the promoter of the CAMV35S of cauliflower mosaic virus, GhKCS2 gene and NOS terminator；Wherein, the core of CAMV35S promoter
Nucleotide sequence is as shown in 234-1109 nucleotide in sequence table 1；In the nucleotide sequence of GhKCS2 gene such as sequence table 1
1110-2699 nucleotide shown in；The nucleotide sequence such as 2700-2974 nucleosides in sequence table 1 of NOS terminator
Shown in acid.
PCambia2300 carrier itself includes expression cassette B, and expression cassette B successively includes cauliflower mosaic virus from upstream
CAMV35S promoter, neomycin phosphotransferase (NPTII) and Ploy A terminator.
2, the acquisition of recombinant bacterium
The recombinant vector that step 1 is obtained imports in Agrobacterium LBA4404, obtains recombinant bacterium.
3, turn the acquisition of GhKCS2 cotton
Using the explant (2000 for the recombinant bacterium conversion upland cotton CCRI24 that the method for mediated by agriculture bacillus obtains step 2
It is a), induced synthesis callus is cultivated on the culture medium containing kanamycin sulfate, selects the callus of conversion, callus
Group is woven on kanamycin sulfate screening and culturing medium and forms embryo callus, and the embryo callus subculture for selecting survival converts to form regeneration
At cotton, finally in 90 T0 generations of acquisition, turn GhKCS2 cotton altogether, and are used for screening.
4, turn the identification of GhKCS2 cotton
(1) GhKCS2 cotton seeds are turned in chamber planting to the T1 generation of harvest, carries out greenhouse efficiency analysis and analysis of molecules.
Extracting T1 generation turns the DNA of GhKCS2 cotton leaf, using primer: CAGTCTCAGAAGACCAAAGGGCA and
CAGAAAGAGATGGTGTAGGATTG carries out PCR amplification, and testing goal gene whether there is, and the segregation ratio of statistical material, root
According to mendel's law, in the T1 generation that acquisition 21 singly copies, turns GhKCS2 cotton；
(2) in 21 that above-mentioned steps (1) the obtain T1 singly copied generations, are turned using Taqman PCR and Southern blot
GhKCS2 cotton is further verified.Specific step is as follows: turning GhKCS2 cotton to 21 of the acquisition T1 singly copied generations in flowering and boll-setting period
Flower carries out the measurement of GhKCS2 gene expression analysis, respectively in Post flowering 0 day (being denoted as on the day of blooming 0 day), 5 days, 15 days, to 21
In a T1 generation singly copied, turns GhKCS2 cotton and the GhKCS2 expression quantity of acceptor material CCRI24 is analyzed, and shows that 21 are singly copied
The expression quantity that the T1 generation of shellfish turns to have 10 T1 generations to turn GhKCS2 cotton in GhKCS2 cotton is greatly improved compared with acceptor material CCRI24；
(3) turn the fiber quality of GhKCS2 cotton: result table in 10 T1 generation that term of opening bolls measurement above-mentioned steps (2) obtains
In bright 10 T1 generation, turns the cotton fiber length that 8 T1 generations turn GhKCS2 cotton in GhKCS2 cotton and improves compared with acceptor material CCRI24
Or elongation.
(4) in 8 T2 generations of assessment, turn GhKCS2 cotton in the pairs of plot of same position in the field experiment of First Year field
(fiber quality, Single boll weight, ginning outturn, seed refer to colored Agronomic character, plant height, begin section height, fruit branch number, breeding time, wherein fabric
Matter includes length, specific strength, mic value, elongation, uniformity) and transgenosis insertion to Developmental of Cotton, output of cotton
Influence.The result shows that: 8 T2 generation, which turns to share the Agronomic character that 2 T2 generations turn GhKCS2 cotton in GhKCS2 cotton, to be better than
Acceptor material CCRI24.
(5) above-mentioned steps (4) obtain 2 are assessed in the pairs of plot of same position in the field experiment of second year field
A T2 generation turn GhKCS2 cotton Agronomic character (fiber quality, Single boll weight, ginning outturn, seed refer to, plant height, the section height that begins, fruit branch number,
Breeding time, wherein fiber quality includes length, specific strength, mic value, elongation, uniformity) and transgenosis insertion to cotton
Growth and development, the influence of output of cotton.The result shows that: in 2 T2 generation, turns to share 1 T2 generation in GhKCS2 cotton and turns GhKCS2 cotton
Agronomic character be better than acceptor material CCRI24, the seed that T2 generation turns GhKCS2 cotton is named as ICR24001, and in
On March 16th, 2016 in T2 generation, is turned into GhKCS2 cotton seeds (Gossypium hirsutum L.) ICR24001 and is preserved in China
Type Tissue Collection (address is Wuhan, China, Wuhan University), classification naming are cotton seeds (Gossypium
Hirsutum L.), deposit number is CCTCC NO:P201606.
In T2 generation, is turned GhKCS2 cotton ICR24001 to be selfed, until obtaining T5 generation turns GhKCS2 cotton homozygous lines
ICR24001。
Two, turn the Analysis of agronomic characters of GhKCS2 cotton
1, fiber quality and seed cotton yield
In T5 generation, is turned into GhKCS2 cotton homozygous lines ICR24001 and acceptor material CCRI24 and carries out field yield test.?
Earthquake of Anyang station in Henan designs plot experiment, and 3 cells are arranged, and 3 cell settings are identical, and the long 8m of cell row, every row plants 30 plants,
Line space 80cm, each material plant 3 rows, cell totally 6 row.It is homozygous that GhKCS2 cotton is turned to T5 generation using Students ' test
The fibre length of strain ICR24001 and acceptor material CCRI24 fiber, mic value, uniformity, elongation and specific strength are distinguished
It is for statistical analysis.
Statistical result such as table 1 and Fig. 3: compared with acceptor material CCRI24, in T5 generation, turns GhKCS2 cotton homozygous lines
Fibre length, uniformity, specific strength and the seed cotton yield of ICR24001 is improved, and elongation, mic value decrease,
Fiber attenuates, and is more suitable for the needs of production, wherein writes between fibre length and elongation and acceptor material CCRI24 in pole salient pole
Sex differernce.Fig. 2 is that the mature fibers length of transgene cotton ICR24001 and acceptor material CCR124 compares.
The fiber quality data of table 1 transgene cotton ICR24001 and acceptor material CCR124
2, otherwise influence
It since promoter is constitutive promoter, not only expresses in the fibre, hetero-organization also will receive a fixing
It rings, in order to study other than improvement fiber quality especially fibre length, whether its hetero-organization of GhKCS2 gene pairs is had an impact,
The length of blade, width of blade, petiole for turning GhKCS2 cotton homozygous lines ICR24001 and acceptor material CCRI24 to T5 generation are long
Degree, stem branch angle, plant height, fruit branch number, is weighed at bell number, bell and is detected with ginning outturn petiole width.
As a result as shown in table 2- table 4: as can be seen from the table, in T5 generation, turns the strain of GhKCS2 cotton homozygous lines ICR24001
High, length of blade and width of blade are significantly higher than acceptor material CCRI24；Petiole length, petiole width are above acceptor material
CCRI24, but it is not significant；Stem branch angle is become smaller but without significant difference.Illustrate strain of the expression to plant of GhKCS2 gene
Height, length of blade, width of blade, petiole length, petiole width and stem branch angle produce a degree of influence.In T5 generation, turns
The Single boll weight and ginning outturn of GhKCS2 cotton homozygous lines ICR24001 is significantly higher than acceptor material CCRI24；At bell number and fruit branch number
Higher than acceptor material CCRI24, but without significant difference.Fig. 4 is to turn GhKCS2 cotton homozygous lines in the T5 generation of Post flowering different number of days
The shape of the bell of ICR24001 and acceptor material CCRI24.
The cotton of 2 transgene cotton ICR24001 of table and length of blade and width, the petiole length of acceptor material CCR124
And width and stem branch angle data
The cotton of 3 transgene cotton ICR24001 of table and the plant height of acceptor material CCR124 compare data
The fruit branch number of the cotton of 4 transgene cotton ICR24001 of table and acceptor material CCR124, at bell number, bell weight, clothing
Point
Three, the phenetic analysis of the DNA sequence dna of ICR24001
The flank that is connected using the insert of the method analysis ICR24001 genome of molecular biology and with insert is connected
The genome sequence connect.Specific step is as follows:
1, the genome of cotton is extracted.Under greenhouse or field condition, the young tender leaf agreement that contracts a film or TV play to an actor or actress 100mg of the cotton of ICR24001 is taken
It is placed in the EP pipe of 2.0ml, is managed using liquid nitrogen frozen EP, then ground using freeze grinding instrument, using Qiagen company
The scheme provided in DNeasy Plant Mini Kit (50) (article No. 69104) extracts genomic DNA.This method can be through ability
Field technique personnel improve to extract DNA from any tissue (including but not limited to seed).
2, according to the Universal Genome Walker of Clontech companyTM2.0User Manual kit
(specification in Cat.No.634923 is carried out using 4 kinds of different restriction enzymes (DraI, EcoRV, PvuII, StuI)
The digestion of genome, is digested overnight, and obtains digestion product.Using the NucleoSpin Gel and PCR built in kit
Clean-Up kit box recycles digestion product, is then added in kit at recovery product both ends using T4DNA ligase
The connector set, so far the DNA library building of 4 adjunction heads finishes.
3, according to known transgenic insertions sequence, two nested primers (5 ' ends are separately designed at its 5 ' end and 3 ' ends
Two nested primers as shown in sequence 9 and sequence 10,3 ' end two nested primers as shown in sequence 11 and sequence 12), so
It is expanded afterwards using the scheme provided in kit.The amplicon generated using agarose gel electrophoresis separation from reaction, with
It is purified afterwards using QIAGEN gel purification kit (Qiagen, Valencia, CA), according to Dalian treasured biological life science and technology
The scheme provided in pMD-19T-Simple (article No.: D104A) kit of Co., Ltd is by the amplicons cloned of gel-purified
Enter in T cloning vector, and convert in bacillus coli DH 5 alpha, transformant is screened on the plate of ammonia benzyl resistance, and carry out bacterium colony
PCR, positive colony carry out monoclonal sequencing.
Sequencing result shows: transgene cotton ICR24001 is to be inserted into exogenous DNA molecule shown in sequence 1 in sequence table
The 68405357-68405382 interdigit of upland cotton CCRI24 genome A11 chromosome, replaces A11 chromosome
68405357-68405382 interdigit 24bp base sequence, obtained transgene cotton, and from the 68405357th upstream
And the nucleotides sequence of the upstream flanking fragment close to the 68405357th nucleotide is classified as sequence 2, from the 68405382nd downstream
And the nucleotides sequence of the downstream flanking fragment close to the 68405382nd nucleotide is classified as sequence 3 (Fig. 1).
Embodiment 2, the acquisition of ICR24001 breeding characters of progenies and identification and its Analysis of agronomic characters
One, ICR24001 breeds the acquisition of characters of progenies
1, hybridize
1 day afternoon removed the pollen of the first cotton by manpower work or artificial action before flowering, and used ceratuba
Colored column cap is entangled, prevents foreign pollen from contacting with column cap, the next morning when the pollen loose powder of the second cotton, passes through manpower
Work collects the pollen of second of cotton, and the pollen is contacted with the style of the first plant or column cap, i.e. completion hybrid process.
Wherein, when the first cotton is the ICR24001 in embodiment, the second cotton is other cottons or the second cotton is
ICR24001, the first cotton are other cottons.
Term of opening bolls harvest hybridization bell, and cotton is dried naturally, it crimps, and suede, i.e. acquisition cenospecies are dragged using the concentrated sulfuric acid
Son.Plantation, obtains hybrid generation, and as ICR24001 breeds offspring.
2, it is selfed
1 day before flowering, the bud of ICR24001 was directly clamped using Grafting clip or bud is bundled using filament, is prevented
Foreign pollen contacts with the column cap of ICR24001 when blooming；Or entangled entire cotton plants by mesh bag, it can be effective
It prevents from pollinating by insect etc., can be realized the self-pollination of cotton.It can complete to be selfed through the above steps.
Term of opening bolls harvest hybridization bell, and cotton is dried naturally, it crimps, and suede, i.e. acquisition selfed seed are dragged using the concentrated sulfuric acid
Son, plantation obtain self progeny, and as ICR24001 breeds offspring.
Two, ICR24001 breeds identification and its Analysis of agronomic characters of characters of progenies
(1) ICR24001 breeds the identification method of characters of progenies
Using the genomic DNA of ICR24001 breeding offspring as template, PCR amplification is carried out using specific primer, if PCR expands
(amplicon refers to one or one section DNA points using PCR amplification synthesis to the amplicon that volume increase object contains ICR24001
Son), illustrate that ICR24001 breeding offspring has character identical with ICR24001, if pcr amplification product is without ICR24001's
Amplicon illustrates that ICR24001 breeding offspring does not have character identical with ICR24001.Specific identification method is as follows:
1, identification method 1
(1) design of primer
The present embodiment is based on upstream flanking sequence and the following identification primer of exogenous DNA molecule design:
GSP1:GCTTGTCATTGATTATCACC (sequence 5)；
GSP2:ACAGTTGCGCAGCCTGAATG (sequence 6).
(2) using the genomic DNA of ICR24001 breeding offspring as template, PCR expansion is carried out using the primer of step (1) design
Increase, obtains pcr amplification product.
PCR amplification system is as follows: 2 × MASTRE PCR MIX, 10 μ l, upstream primer GSP1 (10 μM) 0.5 μ l, downstream are drawn
Object GSP1 (10 μM) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, 8 μ l of ultrapure water, 20 μ l of total volume.
PCR reaction condition is as follows: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations；72℃5min.
(3) pcr amplification product for obtaining step (2) carries out agarose gel electrophoresis, and it is sequenced.If PCR
The size of amplified production is 780bp, then illustrates the amplicon that ICR24001 breeding offspring contains ICR24001, ICR24001 breeding
Offspring has ICR24001 character, does not otherwise have ICR24001 character.
2, identification method 2
(1) design of primer
The present embodiment is based on downstream flanking sequence and the following identification primer of exogenous DNA molecule design:
GSP3:GGGTATCGTTCTTTCATCGA (sequence 7)；
GSP4:CCCGAATTAATTCGGCGTTA (sequence 8).
(2) using the genomic DNA of ICR24001 breeding offspring as template, PCR is carried out using the primer of step (1) design
Amplification, obtains pcr amplification product.
PCR amplification system is as follows: 2 × MASTRE PCR MIX, 10 μ l, upstream primer GSP3 (10 μM) 0.5 μ l, downstream are drawn
Object GSP4 (10 μM) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, 8 μ l of ultrapure water, 20 μ l of total volume.
PCR reaction condition is as follows: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations；72℃5min.
(3) pcr amplification product for obtaining step (2) carries out agarose gel electrophoresis, and it is sequenced.If PCR
The size of amplified production is 930bp, then illustrates the amplicon that ICR24001 breeding offspring contains ICR24001, ICR24001 breeding
Offspring has ICR24001 character, does not otherwise have ICR24001 character.
(2) ICR24001 breeds the Analysis of agronomic characters of characters of progenies
There is ICR24001 amplification according to what is obtained in method detection above-mentioned steps (one) in the step two in embodiment 1
The fiber quality and seed cotton yield of ICR24001 breeding offspring (ICR24001) and acceptor material CCRI24 of son.
1, ICR24001 breeds the seed cotton yield of characters of progenies
The testing result that ICR24001 breeds the seed cotton yield of offspring (ICR24001) is as shown in Figure 5: can from figure
Out, compared with the seed cotton yield of acceptor material CCRI24, the seed cotton yield of ICR24001 breeding offspring (ICR24001) is significantly mentioned
Height illustrates that ICR24001 breeding offspring (ICR24001) has high seed cotton yield.
2, ICR24001 breeds the fiber quality of characters of progenies
The testing result that ICR24001 breeds the seed cotton yield of offspring (ICR24001) is as shown in table 5: can from table
Out, compared with acceptor material CCRI24, the fibre length, specific strength and uniformity that ICR24001 breeds offspring (ICR24001) are equal
It increases, illustrates that the cotton fiber quality of ICR24001 breeding offspring (ICR24001) increases.
Table 5ICR24001 breeds the testing result of the fiber quality of offspring (ICR24001)
Therefore it can detect or assist as follows whether detection plant sample derives from transgene cotton
ICR24001 or its offspring:
PCR amplification is carried out to the genomic DNA of plant sample with primer pair 1 or primer pair 2, obtains pcr amplification product, is examined
It surveys in pcr amplification product and whether contains DNA fragmentation A, if containing DNA fragmentation A, plant sample is or candidate is transgene cotton
ICR24001 or its offspring；If not containing DNA fragmentation A, plant sample is not or candidate is not transgene cotton ICR24001
Or its offspring.
Single stranded DNA shown in sequence 6 point in the single strand dna as shown in sequence 5 in sequence table of primer pair 1 and sequence table
Son composition；
Single stranded DNA shown in sequence 8 point in the single strand dna as shown in sequence 7 in sequence table of primer pair 2 and sequence table
Son composition；
DNA fragmentation A is by upstream flanking fragment (sequence 2), exogenous dna fragment (sequence 1) and downstream flanking fragment (sequence
3) it forms.
Claims (7)
1. a kind of breeding method of transgene cotton, for exogenous dna fragment is inserted into purpose cotton gene group A11 chromosome
68405357-68405382 interdigit, replace the 68405357-68405382 interdigit 24bp's of A11 chromosome
Base sequence obtains transgene cotton；
The fiber quality of the transgene cotton is higher than the purpose cotton；
The exogenous dna fragment is the DNA molecular containing GhKCS2 gene；
The nucleotides sequence of the exogenous dna fragment is classified as sequence 1 in sequence table；
The fiber quality of the transgene cotton is higher than the purpose cotton and is embodied in following B1)-B15):
B1) length of the transgene cotton fiber is higher than the purpose cotton；
B2) mic value of the transgene cotton fiber is lower than the purpose cotton；
B3) uniformity of the transgene cotton fiber is higher than the purpose cotton；
B4) elongation of the transgene cotton fiber is lower than the purpose cotton；
B5) specific strength of the transgene cotton fiber is higher than the purpose cotton；
B6) seed cotton yield of the transgene cotton fiber is higher than the purpose cotton；
B7) plant height of the transgene cotton is higher than the purpose cotton；
B8) length of blade of the transgene cotton is higher than the purpose cotton；
B9) width of blade of the transgene cotton is higher than the purpose cotton；
B10) the petiole length of the transgene cotton is higher than the purpose cotton；
B11) the petiole width of the transgene cotton is higher than the purpose cotton；
B12) the stem branch angle of the transgene cotton is lower than the purpose cotton；
B13) Single boll weight of the transgene cotton is higher than the purpose cotton；
B14) transgene cotton at bell number be higher than the purpose cotton；
B15) ginning outturn of the transgene cotton is higher than the purpose cotton；
The exogenous dna fragment imports the purpose cotton by the recombinant vector containing the exogenous dna fragment；
The purpose cotton is upland cotton CCRI24.
2. for detect or assist to detect plant sample to be measured whether derive from the acquisition of claim 1 method transgene cotton or
The method of its offspring, includes the following steps:
It detects in the genomic DNA of the plant sample to be measured and whether contains DNA fragmentation A,
The DNA fragmentation A by claim 1 exogenous dna fragment the transgene cotton upstream flanking fragment, described outer
Source DNA segment and the exogenous dna fragment are formed in the downstream flanking fragment of the transgene cotton；
If the genomic DNA of the plant sample to be measured contains the DNA fragmentation A, the plant sample to be measured is or candidate
For the transgene cotton or its offspring；
If the genomic DNA of the plant sample to be measured do not contain the DNA fragmentation A, the plant sample to be measured be not or
Candidate is not the transgene cotton or its offspring.
3. according to the method described in claim 2, it is characterized by:
The method be it is following 1) or 2) or 3):
1) direct Sequencing；
2) PCR amplification is carried out to the genomic DNA of plant sample with primer pair 1 and/or primer pair 2, if there is purpose amplified production,
Then the plant sample derives from the transgene cotton or its offspring；
The primer pair 1 is that can expand by the portion at the exogenous dna fragment 5 ' end and the upstream flanking fragment close to it
Point or the primer pair of DNA molecular first that all forms；Its corresponding purpose amplified production is the DNA molecular first；
The primer pair 2 is that can expand by the portion at the exogenous dna fragment 3 ' end and the downstream flanking fragment close to it
Point or the primer pair of DNA molecular second that all forms；Its corresponding purpose amplified production is the DNA molecular second；
The nucleotides sequence of the upstream flanking fragment is classified as sequence 2 in sequence table；
The nucleotides sequence of the downstream flanking fragment is classified as sequence 3 in sequence table；
Single stranded DNA shown in sequence 6 point in the single strand dna as shown in sequence 5 in sequence table of primer pair 1 and sequence table
Son composition；
Single stranded DNA shown in sequence 8 point in the single strand dna as shown in sequence 7 in sequence table of primer pair 2 and sequence table
Son composition；
3) probe of the DNA molecular first described in energy specific bond or the DNA molecular second carries out the plant sample DNA to be measured
Southern hybridization, obtain hybridized fragment if can hybridize, the plant sample to be measured derive from the transgene cotton or its
Offspring.
4. detecting whether plant sample to be measured derives from the transgenic cotton that claim 1 the method obtains for detecting or assisting
Colored or its offspring kit comprising primer pair described in primer pair 1 described in claim 3 and/or claim 3
2。
5. application of the transgene cotton that claim 1 the method obtains in breeding.
6. a kind of method for obtaining the cotton that fiber quality improves, includes the following steps:
(1) transgene cotton is obtained according to claim 1 the method；
(2) transgene cotton is selfed or is hybridized, obtain breeding offspring, identified according to method described in claim 2 or 3
The breeding offspring, obtains target plant.
7. according to the method described in claim 6, it is characterized by: the deposit number of the transgene cotton is CCTCC NO.
P201606。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610564274.2A CN106191104B (en) | 2016-07-18 | 2016-07-18 | Upland cotton transformation event ICR24001 and its specificity identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610564274.2A CN106191104B (en) | 2016-07-18 | 2016-07-18 | Upland cotton transformation event ICR24001 and its specificity identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106191104A CN106191104A (en) | 2016-12-07 |
| CN106191104B true CN106191104B (en) | 2019-09-27 |
Family
ID=57492912
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610564274.2A Active CN106191104B (en) | 2016-07-18 | 2016-07-18 | Upland cotton transformation event ICR24001 and its specificity identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106191104B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106198B (en) * | 2018-11-26 | 2023-03-31 | 中国农业科学院棉花研究所 | Upland cotton transformation event C006-10-13 and specificity identification method thereof |
| CN110229823B (en) * | 2019-04-17 | 2023-02-28 | 中国农业科学院棉花研究所 | Upland cotton transformation event 19C006-59-11 and specificity identification method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450775A (en) * | 2014-12-04 | 2015-03-25 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans as well as preparation method and application thereof |
-
2016
- 2016-07-18 CN CN201610564274.2A patent/CN106191104B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450775A (en) * | 2014-12-04 | 2015-03-25 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 超长链脂肪酸合成相关基因的转基因功能验证;钱玉源;《中国优秀硕士学位论文全文数据库》;20140215(第2期);摘要 * |
| 陆地棉中3-酮脂酰-CoA合酶基因家族的克隆与表达谱分析;陈方圆;《万方智搜》;20101231;摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106191104A (en) | 2016-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191107A (en) | A kind of molecular improvement method reducing rice grain seed holding | |
| CN103993018B (en) | Control Plant Height of Rice, improve lodging tolerance, increase available tillering and the gene of yield and application thereof | |
| WO2020108032A1 (en) | Upland cotton transformation event icr24-397 and specificity identification method therefor | |
| US11692200B2 (en) | Method for improving rice yield and/or rice blast resistance and protein used thereof | |
| CN110066774B (en) | Corn receptor kinase gene ZmRLK7 and application thereof | |
| US20230323382A1 (en) | B3 transcription factor gene for simultaneously improving length, strength and elongation of cotton fibers and use thereof | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN107974457A (en) | The plant of fruit size increase | |
| CN101812451B (en) | Rice glume development gene promoter p-TRI1 and application thereof | |
| CN106191104B (en) | Upland cotton transformation event ICR24001 and its specificity identification method | |
| CN101798342A (en) | Rice glume development related protein TRI1 and encoding gene and application thereof | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN105368869B (en) | Upland cotton transformation event ICR201501 and its specificity identification method | |
| CN103288943A (en) | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof | |
| CN105368868B (en) | Upland cotton transformation event LF-ICR22 and its specificity identification method | |
| CN103396477A (en) | Protein related to plant potassium ion absorption capacity, and coding gent and application thereof | |
| CN106868038B (en) | Method for creating cytoplasmic male sterile line by cotton transgenosis | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN106191073A (en) | HOX3 gene purposes in improvement cotton fiber elongation character | |
| CN105316360B (en) | Upland cotton transformation event ICR24110 and its specificity identification method | |
| CN105175519B (en) | Applications of the Protein S RL2 in cultivating leaf roll Qushui River rice | |
| CN104651367B (en) | A kind skin and fibr tissue specific expressing promoter SFS and its application | |
| CN115369120A (en) | Rice temperature-sensitive dual-purpose sterile line fertility transformation starting point temperature regulation gene and application thereof | |
| CN107573411A (en) | Application of the wheat TaZIM1 7A albumen in crop heading stage is regulated and controled | |
| BR112014022649B1 (en) | METHODS OF PRODUCTION OF A TRANSGENIC PLANT, METHODS OF IDENTIFICATION OF A WEAK ALLELE OF FEA3, METHODS OF PRODUCTION OF A PLANT AND METHOD OF IDENTIFICATION OF A FIRST CORN PLANT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |