CN105368868B - Upland cotton transformation event LF-ICR22 and its specificity identification method - Google Patents
Upland cotton transformation event LF-ICR22 and its specificity identification method Download PDFInfo
- Publication number
- CN105368868B CN105368868B CN201510880447.7A CN201510880447A CN105368868B CN 105368868 B CN105368868 B CN 105368868B CN 201510880447 A CN201510880447 A CN 201510880447A CN 105368868 B CN105368868 B CN 105368868B
- Authority
- CN
- China
- Prior art keywords
- cotton
- icr22
- transgene
- sequence
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses upland cotton transformation event LF-ICR22 and its specificity identification methods.The present invention is overexpressed GhKCS6 gene in upland cotton CCRI24, obtain transgene cotton LF-ICR22, it is the 65694545-65696799 interdigit that exogenous DNA molecule shown in sequence 1 in sequence table is inserted into upland cotton CCRI24 genome A09 chromosome, replaces the cotton that the base sequence of the 65694545-65696799 interdigit 2253bp of A09 chromosome obtains.Proved by test: not only the length of fiber, mic value, specific strength and uniformity are higher than acceptor material to transgene cotton LF-ICR22, and plant height, length of blade, width of blade, petiole length, petiole width, fruit branch number etc. are also above acceptor material, lay the foundation to cultivate the research of the transgene cotton with fine fiber quality.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to upland cotton transformation event LF-ICR22 and its specificity identification side
Method.
Background technique
Transformation event is point being made of foreign gene in the upstream and downstream flanking region and foreign gene of genomic insertion site
Minor structure.In general, the available transformant group of gene transformation plant, this transformant group includes a large amount of independent
Event, wherein each event is unique.The dyeing that expression of the foreign gene in plant is inserted by foreign gene
The influence of body position.This may originate from the influence of transcriptional regulatory element near chromatin Structure or integration site.It is mutually homogenic
Expression in different transformation events has very big difference, is also likely to be present difference on the space of expression or time mode
It is different.And the insertion of foreign gene may also will affect the expression of endogenous gene.Therefore, each separate transformation events plant receptor
The influence of object is all different.Energy effective expression foreign gene is obtained, while the plant for not influencing plant economical character itself turns
Change event has important application value in cultivating genetically modified crops new varieties.
Cotton is the important source material of textile industry as important industrial crops, is the important strategic material of national defense industry,
Effect is played in national economy.Cotton fiber cell is naturally occurring longest cell in nature, is research cell
The optimal material of elongation regulatory mechanism；Upland cotton is the most commonly used cultivar of cultivation, at present 95% source of whole world output of cotton
In upland cotton, along with the raising of labor cost, cotton mechanization picking is that future development obtains inexorable trend.Length with than strong
Degree is all necessary to production is upper in 30 or more good fiber quality cotton, but since China introduces the time of upland cotton less than 100
Year, long fibre upland cotton resource material is relatively deficient, and traditional breeding method is caused to be difficult to generate in a short time in suitable production
The cotton of the fiber quality of the improvement of application.
Forefathers are research shows that the period that cotton fiber development can be divided into four overlappings is respectively as follows: starting phase of Fibre Development (opens
First 1 day is spent to Post flowering 2-3 days), elongate fiber phase (Post flowering 3 days to 25 days), secondary wall thicken the phase (Post flowering 15 days to 45
It) and the maturity period (Post flowering 45 days to 50 days).It is within Post flowering 15 days the rapid elongation phase of fiber, elongate fiber rate most fastly may be used
Reach 2mm/ days.The length of fiber is the important indicator of fiber quality, and the Mechanism Study of Fibre Development is the improvement of fiber quality
It lays a good foundation.
Summary of the invention
It is an object of the present invention to provide a kind of breeding methods of transgene cotton.
The breeding method of transgene cotton of the present invention is that exogenous dna fragment is inserted into purpose cotton gene group the A09th dye
The 65694545-65696799 interdigit of colour solid, replaces the 65694545-65696799 interdigit of A09 chromosome
The base sequence of 2253bp, obtains transgene cotton；
The fiber quality of the transgene cotton is higher than the purpose cotton；
The exogenous dna fragment is the DNA molecular containing GhKCS6 gene.
In the above method,
The nucleotides sequence of the exogenous dna fragment is classified as sequence 1 in sequence table；
The exogenous dna fragment is the purpose cotton gene group the in the upstream flanking fragment of the transgene cotton
The length of A09 chromosome extended from the 65694545th nucleotide to its updrift side be 0 to 5Kb it is any one
A DNA fragmentation；
The exogenous dna fragment is the purpose cotton gene group the in the downstream flanking fragment of the transgene cotton
The length of A09 chromosome extended from the 65696799th nucleotide to direction downstream be 0 to 5Kb it is any one
A DNA fragmentation.
In the above method,
The upstream flanking fragment is nucleotide shown in sequence 2 in sequence table；
The downstream flanking fragment is nucleotide shown in sequence 3 in sequence table；
The fiber quality of the transgene cotton is higher than the purpose cotton and is embodied in following B1)-B13):
B1) length of transgene cotton fiber is higher than the purpose cotton；
B2) specific strength of transgene cotton fiber is higher than the purpose cotton；
B3) uniformity of transgene cotton fiber is higher than the purpose cotton；
B4) seed cotton yield of transgene cotton is higher than the purpose cotton；
B5) plant height of transgene cotton is higher than the purpose cotton；
B6) length of blade of transgene cotton is higher than the purpose cotton；
B7) width of blade of transgene cotton is higher than the purpose cotton；
B8) the petiole length of transgene cotton is higher than the purpose cotton；
B9) the petiole width of transgene cotton is higher than the purpose cotton；
B10) single bell number of transgene cotton is higher than the purpose cotton；
B11) transgene cotton at bell number be higher than the purpose cotton；
B12) the fruit branch number of transgene cotton is higher than the purpose cotton；
B13) ginning outturn of transgene cotton is higher than the purpose cotton；
The exogenous dna fragment imports the purpose cotton by the recombinant vector containing the exogenous dna fragment；
The purpose cotton is upland cotton.
In the above method,
The transgene cotton is transgene cotton LF-ICR22.
It is a further object to provide above-mentioned turn base for detecting or assisting detection plant sample whether to derive from
Because of the method for cotton LF-ICR22 or its offspring.
Provided by the present invention for detecting or assisting whether detection plant sample derives from above-mentioned transgene cotton LF-
The method of ICR22 or its offspring include the following steps:
It detects in the genomic DNA of the plant sample and whether contains DNA fragmentation A,
The DNA fragmentation A by above-mentioned exogenous dna fragment the transgene cotton LF-ICR22 upstream flanking fragment,
The downstream flanking fragment of above-mentioned exogenous dna fragment and above-mentioned exogenous dna fragment in the transgene cotton LF-ICR22 forms；
If the genomic DNA of the plant sample contains the DNA fragmentation A, the plant sample is or candidate is institute
State transgene cotton LF-ICR22 or its offspring；
If the genomic DNA of the plant sample does not contain the DNA fragmentation A, the plant sample is not or candidate
It is not the transgene cotton LF-ICR22 or its offspring.
In the above method,
The method be it is following 1) or 2) or 3):
1) direct Sequencing；
2) PCR amplification is carried out to the genomic DNA of plant sample with primer pair 1 and/or primer pair 2, if purposeful amplification
Product, then the plant sample derives from the transgene cotton LF-ICR22 or its offspring；
The primer pair 1 is that can expand to be held by the exogenous dna fragment 5 ' and close to its upstream flanking sequence
The primer pair of the DNA molecular first of part or all of segment composition；Its corresponding purpose amplified production is the DNA molecular first；
The primer pair 2 is that can expand to hold containing the exogenous dna fragment 3 ' and close to its downstream flank sequence
The primer pair of the DNA molecular second of some or all of column composition；Its corresponding purpose amplified production is the DNA molecular second；
3) with can DNA molecular first or its DNA molecular second described in specific bond probe to the plant sample DNA to be measured into
Row Southern hybridization, obtains hybridized fragment if can hybridize, and the plant sample derives from the transgene cotton LF-
ICR22 or its offspring.
In the above method,
2) in, in the single strand dna as shown in sequence 5 in sequence table of primer pair 1 and sequence table shown in sequence 6
Single strand dna composition；
It is single-stranded shown in sequence 8 in the single strand dna as shown in sequence 7 in sequence table of primer pair 2 and sequence table
DNA molecular composition.
It is a still further object of the present invention to provide whether derive from the transgene cotton LF-ICR22 for test sample
Or the kit of its offspring.
The transgene cotton LF-ICR22 or the examination of its offspring whether are derived from provided by the present invention for test sample
Agent box includes above-mentioned primer pair 1 and/or above-mentioned primer pair 2.
Application of the above-mentioned transgene cotton LF-ICR22 in breeding also belongs to protection scope of the present invention.
It is a still further object of the present invention to provide a kind of methods of cotton that acquisition fiber quality improves.
The method provided by the invention for obtaining the cotton that fiber quality improves includes the following steps:
(1) transgene cotton is obtained according to the method described above；
(2) transgene cotton is selfed or is hybridized, breeding offspring is obtained, after identifying the breeding according to the method described above
In generation, obtains target plant；
The deposit number of the transgene cotton is CCTCC No.P201516.
The last one purpose of the invention is to provide the product of the cultivation for transgene cotton.
Product provided by the present invention for the cultivation of transgene cotton is following a)-c):
A) above-mentioned upstream flanking fragment and above-mentioned downstream flanking fragment；
B) above-mentioned exogenous dna fragment；
C) biomaterial relevant to above-mentioned exogenous dna fragment；
The biomaterial is following A 1) any one of to A11):
A1) contain the expression cassette of above-mentioned exogenous dna fragment；
A2) contain the recombinant vector of above-mentioned exogenous dna fragment；
A3) contain A1) recombinant vector of the expression cassette；
A4) contain the recombinant microorganism of above-mentioned exogenous dna fragment；
A5) contain A1) recombinant microorganism of the expression cassette；
A6) contain A2) recombinant microorganism of the recombinant vector；
A7) contain A3) recombinant microorganism of the recombinant vector；
A8) contain the transgenic plant cells system of above-mentioned exogenous dna fragment；
A9) contain A1) the transgenic plant cells system of the expression cassette；
A10) contain A2) the transgenic plant cells system of the recombinant vector；
A11) contain A3) the transgenic plant cells system of the recombinant vector.
The said goods answering in the length and/or mic value and/or specific strength and/or uniformity of regulation plant fiber
With also belonging to protection scope of the present invention；
The said goods are in regulation plant plant height and/or length of blade and/or width of blade and/or petiole length and/or leaf
Handle width and/or fruit branch number and/or single bell number and/or protection of the invention is also belonged at the application in bell number and/or in ginning outturn
Range.
The present invention in GhKCS6 channel genes upland cotton CCRI24, will make GhKCS6 gene cross table in upland cotton CCRI24
It reaches, obtains transgene cotton LF-ICR22, transgene cotton LF-ICR22 is by exogenous DNA shown in sequence 1 in sequence table point
The 65694545-65696799 interdigit of son insertion upland cotton CCRI24 genome A09 chromosome, replaces No. A09
The base sequence of the 65694545-65696799 interdigit 2253bp of chromosome, obtained cotton.It is proved by test: turning base
Because not only fibre length, mic value, specific strength and uniformity are higher than acceptor material, but also the production of unginned cotton to cotton LF-ICR22
Amount, plant height, length of blade, width of blade, petiole length, petiole width, fruit branch number, single bell number, at bell number and ginning outturn etc.
Also it is above acceptor material, is laid the foundation to cultivate the research of the transgene cotton with fine fiber quality and high yield.
Detailed description of the invention
Fig. 1 is the graphic representation of transformation event LF-ICR22.[A]: 5 ' engaging zones；[B]: 3 ' engaging zones；[C]: right
It should be in the 5 ' ends of the transgenosis DNA of insertion and coupled flanking genomic region；[D]: the transgenosis corresponding to insertion
3 ' the ends of DNA and coupled flanking genomic region；[E]: transgene expression cassette；[F]: upland cotton flanking genomic sequence
The continuous sequence of column and transgene expression cassette.
Fig. 2 is that the fibre length of transgene cotton LF-ICR22 and acceptor material CCR124 compares
Fig. 3 is that the fibre length of transgene cotton LF-ICR22 and acceptor material CCR124 compares.
Fig. 4 is that the breeding offspring of transgene cotton LF-ICR22 and the seed cotton yield of acceptor material CCR124 compare.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Upland cotton CCRI24 in following embodiments is in document " PAG1, a cotton brassinosteroid
It is disclosed in catabolism gene, modulates fiber elongation ", the public can be from Chinese Academy of Agricultural Sciences cotton
Flower research institute obtains.
Agrobacterium LBA4404 in following embodiments is in document " Constitutive expression of the
virulence genes improves the efficiency of plant transformation by
It is disclosed in Agrobacterium ", the public can obtain from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.
Embodiment 1, the acquisition for turning GhKCS6 cotton and Analysis of agronomic characters
One, turn the acquisition of GhKCS6 cotton
1, the building of recombinant vector
By expression cassette A insertion pCambia2300 carrier, (plasmid is purchased from NTCC Type Tissue Collection subordinate's
BioVector plasmid vector bacterium cell gene collection, article No. are as follows: Biovectorpcambia2300) EcoRI and
It between HindIII restriction enzyme site, and keeps the other sequences of pCambia2300 carrier constant, obtains recombinant vector (sequence 4).On
The nucleotide sequence of expression cassette A is stated as shown in 2151-4383 nucleotide in sequence table 1.Expression cassette A is successively wrapped from upstream
Include promoter, GhKCS6 gene and the NOS terminator of the CAMV35S from cauliflower mosaic virus；Wherein, CAMV35S promoter
Nucleotide sequence as shown in 3845-4383 nucleotide in sequence table 1；The nucleotide sequence of GhKCS6 gene such as sequence
Shown in 2421-3824 nucleotide in table 1；The nucleotide sequence such as the 2151-2404 in sequence table 1 of NOS terminator
Shown in the nucleotide of position.
PCambia2300 carrier itself includes expression cassette B, and expression cassette B successively includes cauliflower mosaic virus from upstream
CAMV35S promoter, neomycin phosphotransferase (NPTII) and Ploy A terminator.
2, the acquisition of recombinant bacterium
The recombinant vector that step 1 is obtained imports in Agrobacterium LBA4404, obtains recombinant bacterium.
3, turn the acquisition of GhKCS6 cotton
Using the explant (2000 for the recombinant bacterium conversion upland cotton CCRI24 that the method for mediated by agriculture bacillus obtains step 2
It is a), induced synthesis callus is cultivated on the culture medium containing kanamycin sulfate, selects the callus of conversion, callus
Group is woven on kanamycin sulfate screening and culturing medium and forms embryo callus, and the embryo callus subculture for selecting survival converts to form regeneration
At cotton, finally in 80 T0 generations of acquisition, turn GhKCS6 cotton altogether, and are used for screening.
4, turn the identification of GhKCS6 cotton
(1) GhKCS6 cotton seeds are turned in chamber planting to the T1 generation of harvest, carries out greenhouse efficiency analysis and analysis of molecules.
Extracting T1 generation turns the DNA of GhKCS6 cotton leaf, using primer: CAGTCTCAGAAGACCAAAGGGCA and
GCCACCCGAACGAAACAAACAAT carries out PCR amplification, and testing goal gene whether there is, and the segregation ratio of statistical material, root
According to mendel's law, in the T1 generation that acquisition 21 singly copies, turns GhKCS6 cotton.
(2) in 21 that above-mentioned steps (1) the obtain T1 singly copied generations, are turned using Taqman PCR and Southern blot
GhKCS6 cotton is further verified.Specific step is as follows: turning GhKCS6 cotton to 21 of the acquisition T1 singly copied generations in flowering and boll-setting period
Flower carries out the measurement of GhKCS6 gene expression analysis, respectively in Post flowering 0 day (being denoted as on the day of blooming 0 day), 5 days, 15 days, to 21
In a T1 generation singly copied, turns GhKCS6 cotton and the GhKCS6 expression quantity of acceptor material CCRI24 is analyzed, and shows that 21 are singly copied
The expression quantity that the T1 generation of shellfish turns to have 10 T1 generations to turn GhKCS6 cotton in GhKCS6 cotton is greatly improved compared with acceptor material CCRI24.
(3) turn the fiber quality of GhKCS6 cotton in 10 T1 generation that wadding phase measurement above-mentioned steps (2) obtains: the result shows that
10 T1 generation turn 8 T1 generations in GhKCS6 cotton turn the cotton fiber length of GhKCS6 cotton compared with acceptor material CCRI24 improvement or
Elongation.
(4) in 8 T2 generations of assessment, turn GhKCS6 cotton in the pairs of plot of same position in the field experiment of First Year field
(fiber quality, Single boll weight, ginning outturn, seed refer to colored Agronomic character, plant height, begin section height, fruit branch number, breeding time, wherein fabric
Matter includes length, specific strength, mic value, elongation, uniformity) and transgenosis insertion to Developmental of Cotton, output of cotton
Influence.The result shows that: 8 T2 generation, which turns to share the Agronomic character that 2 T2 generations turn GhKCS6 cotton in GhKCS6 cotton, to be better than
Acceptor material CCRI24.
(5) above-mentioned steps (4) obtain 2 are assessed in the pairs of plot of same position in the field experiment of second year field
A T2 generation turn GhKCS6 cotton Agronomic character (fiber quality, Single boll weight, ginning outturn, seed refer to, plant height, the section height that begins, fruit branch number,
Breeding time, wherein fiber quality includes length, specific strength, mic value, elongation, uniformity) and transgenosis insertion to cotton
Growth and development, the influence of output of cotton.
The result shows that: 2 T2 generation, which turns to share the Agronomic character that 1 T2 generation turns GhKCS6 cotton in GhKCS6 cotton, to be better than
The seed that T2 generation turns GhKCS6 cotton is named as LF-ICR22 by acceptor material CCRI24, and will on November 4th, 2015
In T2 generation, turns GhKCS6 cotton seeds LF-ICR22 and is preserved in China typical culture collection center, and preservation address is Hubei China province
Wuhan University, Wuhan City, classification naming are cotton seeds (Gossypium hirsutum L.), deposit number CCTCC
No.P201516。
In T2 generation, is turned GhKCS6 cotton LF-ICR22 to be selfed, until obtaining T5 generation turns GhKCS6 cotton homozygous lines
LF-ICR22。
Two, turn the Analysis of agronomic characters of GhKCS6 cotton
1, fiber quality and seed cotton yield
In T5 generation, is turned into GhKCS6 cotton homozygous lines LF-ICR22 and acceptor material CCRI24 and carries out field yield test.?
Earthquake of Anyang station in Henan designs plot experiment, is arranged 3 cells, and each cell is 1 repetition, the long 8m of cell row, and every row plants 30 plants, often
A 3 row of material, line space 80cm.Using Students ' test to T5 generation turn GhKCS6 cotton homozygous lines LF-ICR22 with by
Fibre length, mic value, uniformity and the specific strength and seed cotton yield of body material C CRI24 fiber are for statistical analysis.
Statistical result such as table 1: compared with acceptor material CCRI24, in T5 generation, turns GhKCS6 cotton homozygous lines LF-ICR22's
Fibre length, mic value, uniformity, specific strength and seed cotton yield are improved, wherein fibre length and acceptor material
Sex differernce is write in pole salient pole between CCRI24, seed cotton yield is in significant difference.Fig. 2 is transgene cotton LF-ICR22 and receptor material
The mature fibers length of material CCRI24 compares, and Fig. 3 is the cell production of transgene cotton LF-ICR22 and acceptor material CCRI24
Compare.
Table 1, the cotton of transgene cotton LF-ICR22 and acceptor material CCR124 fiber quality data
2, otherwise influence
Since promoter is more than expressed in the fibre, hetero-organization also will receive influence, in order to study in addition to improvement is fine
It ties up outside quality especially fibre length, whether its hetero-organization of GhKCS6 gene pairs has an impact, and it is pure to turn GhKCS6 cotton to T5 generation
Close length of blade, width of blade, petiole length, the petiole width, plant height, fruit branch of strain LF-ICR22 and acceptor material CCRI24
Number is detected at bell number, bell weight and ginning outturn.
As a result as shown in table 2- table 4: as can be seen from the table, in T5 generation, turns the strain of GhKCS6 cotton homozygous lines LF-ICR22
Height, length of blade, width of blade, petiole length, petiole width are above acceptor material CCRI24.Illustrate the table of GhKCS6 gene
A degree of influence is produced up to the plant height on plant, length of blade, width of blade, petiole length, petiole width.In T5 generation, turns
The Single boll weight of GhKCS6 cotton homozygous lines LF-ICR22 is significantly higher than acceptor material CCRI24, fruit branch number, at bell number and clothing
Divide and is also above acceptor material CCRI24.
Table 2, the length of blade of the cotton of transgene cotton LF-ICR22 and acceptor material CCR124 and width, petiole length and
The data of width
The plant height of table 3, the cotton of transgene cotton LF-ICR22 and acceptor material CCR124 compares data
The fruit branch number of table 4, the cotton of transgene cotton LF-ICR22 and acceptor material CCR124 weighs, clothing at bell number, bell
Point
Three, the phenetic analysis of the DNA sequence dna of LF-ICR22
The flank that is connected using the insert of the method analysis LF-ICR22 genome of molecular biology and with insert is connected
The genome sequence connect.Specific step is as follows:
1, the genome of cotton is extracted.Under greenhouse or field condition, the young tender leaf agreement that contracts a film or TV play to an actor or actress 100mg of the cotton of LF-ICR22 is taken
It is placed in the EP pipe of 2.0ml, is managed using liquid nitrogen frozen EP, then ground using freeze grinding instrument, using Qiagen company
The scheme provided in DNeasy Plant Mini Kit (50) (article No. 69104) extracts genomic DNA.This method can be through ability
Field technique personnel improve to extract DNA from any tissue (including but not limited to seed).
2, according to the Universal Genome Walker of Clontech companyTM2.0User Manual kit
(specification in Cat.No.634923 is carried out using 4 kinds of different restriction enzymes (DraI, EcoRV, PvuII, StuI)
The digestion of genome, is digested overnight, and obtains digestion product.Using the NucleoSpin Gel and PCR built in kit
Clean-Up kit box recycles digestion product, then adds kit using T4-DNA ligase at recovery product both ends
Built-in connector, so far the DNA library building of 4 adjunction heads finishes.
3, according to known transgenic insertions sequence, two nested primers (5 ' ends are separately designed at its 5 ' end and 3 ' ends
Two nested primers as shown in sequence 9 and sequence 10,3 ' end two nested primers as shown in sequence 11 and sequence 12), so
It is expanded afterwards using the scheme provided in kit.The amplicon generated using agarose gel electrophoresis separation from reaction, with
It is purified afterwards using QIAGEN gel purification kit (Qiagen, Valencia, CA), according to Dalian treasured biological life science and technology
The scheme provided in pMD-19T-Simple (article No.: D104A) kit of Co., Ltd is by the amplicons cloned of gel-purified
Enter in T cloning vector, and convert in bacillus coli DH 5 alpha, transformant is screened on the plate of ammonia benzyl resistance, and carry out bacterium colony
PCR, positive colony carry out monoclonal sequencing.
Sequencing result shows: transgene cotton LF-ICR22 is to be inserted into exogenous DNA molecule shown in sequence 1 in sequence table
The 65694545-65696799 interdigit of upland cotton CCRI24 genome A09 chromosome, replaces A09 chromosome
65694545-65696799 interdigit 2253bp base sequence, obtained transgene cotton, and from the 65694545th
The nucleotides sequence of trip and the upstream flanking fragment close to the 65694545th nucleotide is classified as sequence 2, under the 65696799th
The nucleotides sequence of trip and the downstream flanking fragment close to the 65696799th nucleotide is classified as sequence 3 (Fig. 1).
Embodiment 2, the acquisition of LF-ICR22 breeding offspring and identification and Analysis of agronomic characters
One, LF-ICR22 breeds the acquisition of offspring
1, hybridize
1 day afternoon removed the pollen of the first cotton by manpower work or artificial action before flowering, and used ceratuba
Colored column cap is entangled, prevents foreign pollen from contacting with column cap, the next morning when the pollen loose powder of the second cotton, passes through manpower
Work collects the pollen of second of cotton, and the pollen is contacted with the style of the first plant or column cap, i.e. completion hybrid process.
Wherein, when the first cotton is the LF-ICR22 in embodiment, the second cotton is other cottons or the second cotton is LF-
ICR22, the first cotton are other cottons.
Term of opening bolls harvest hybridization bell, and cotton is dried naturally, it crimps, and suede, i.e. acquisition cenospecies are dragged using the concentrated sulfuric acid
Son.Plantation, obtains hybrid generation, and as LF-ICR22 breeds offspring.
2, it is selfed
1 day before flowering, the bud of LF-ICR22 was directly clamped using Grafting clip or bud is bundled using filament, is prevented
Foreign pollen contacts with the column cap of LF-ICR22 when blooming；Or entangled entire cotton plants by mesh bag, it can be effective
It prevents from pollinating by insect etc., can be realized the self-pollination of cotton.It can complete to be selfed through the above steps.
Term of opening bolls harvest hybridization bell, and cotton is dried naturally, it crimps, and suede, i.e. acquisition selfed seed are dragged using the concentrated sulfuric acid
Son, plantation obtain self progeny, and as LF-ICR22 breeds offspring.
Two, LF-ICR22 breeds identification and its Analysis of agronomic characters of offspring
(1) LF-ICR22 breeds the identification method of characters of progenies
Using the genomic DNA of LF-ICR22 breeding offspring as template, PCR amplification is carried out using specific primer, if PCR expands
(amplicon refers to one or one section DNA points using PCR amplification synthesis to the amplicon that volume increase object contains LF-ICR22
Son), illustrate that LF-ICR22 breeding offspring has character identical with LF-ICR22, if pcr amplification product is without LF-ICR22's
Amplicon illustrates that LF-ICR22 breeding offspring does not have character identical with LF-ICR22.Specific identification method is as follows:
1, identification method 1
(1) design of primer
The present embodiment is based on upstream flanking sequence and the following identification primer of exogenous DNA molecule design:
GSP1:AGGAAGCGAATCCAGAACACCACT (sequence 5)；
GSP2:TCCAGTACTAAAATCCAGATCCCCC (sequence 6).
(2) using the genomic DNA of LF-ICR22 breeding offspring as template, PCR expansion is carried out using the primer of step (1) design
Increase, obtains pcr amplification product.
PCR amplification system is as follows: 2 × MASTRE PCR MIX, 10 μ l, upstream primer GSP1 (10 μM) 0.5 μ l, downstream are drawn
Object GSP1 (10 μM) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, 8 μ l of ultrapure water, 20 μ l of total volume.
PCR reaction condition is as follows: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations；72℃5min.
(3) pcr amplification product for obtaining step (2) carries out agarose gel electrophoresis, and it is sequenced.If PCR
The size of amplified production is 511bp, then illustrates the amplicon that LF-ICR22 breeding offspring contains LF-ICR22, LF-ICR22 breeding
Offspring has LF-ICR22 character, does not otherwise have LF-ICR22 character.
2, identification method 2
(1) design of primer
The present embodiment is based on downstream flanking sequence and the following identification primer of exogenous DNA molecule design:
GSP3:GTCGTTTTACAACGTCGTGACTGG (sequence 7)；
GSP4:GGGGATACTCTATGCTCTATTCTG (sequence 8).
(2) using the genomic DNA of LF-ICR22 breeding offspring as template, PCR expansion is carried out using the primer of step (1) design
Increase, obtains pcr amplification product.
PCR amplification system is as follows: 2 × MASTRE PCR MIX, 10 μ l, upstream primer GSP3 (10 μM) 0.5 μ l, downstream are drawn
Object GSP4 (10 μM) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, 8 μ l of ultrapure water, 20 μ l of total volume.
PCR reaction condition is as follows: 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations；72℃5min.
(3) pcr amplification product for obtaining step (2) carries out agarose gel electrophoresis, and it is sequenced.If PCR
The size of amplified production is 586bp, then illustrates the amplicon that LF-ICR22 breeding offspring contains LF-ICR22, LF-ICR22 breeding
Offspring has LF-ICR22 character, does not otherwise have LF-ICR22 character.
(2) LF-ICR22 breeds the Analysis of agronomic characters of characters of progenies
There is LF-ICR22 amplification according to what is obtained in method detection above-mentioned steps (one) in the step two in embodiment 1
The fiber quality and seed cotton yield of LF-ICR22 breeding offspring (LF-ICR22) and acceptor material CCRI24 of son.
1, LF-ICR22 breeds the seed cotton yield of characters of progenies
The testing result that LF-ICR22 breeds the seed cotton yield of offspring (LF-ICR22) is as shown in Figure 4: can from figure
Out, compared with the seed cotton yield of acceptor material CCRI24, the seed cotton yield of LF-ICR22 breeding offspring (LF-ICR22) is improved
65.6%, illustrate that LF-ICR22 breeding offspring (LF-ICR22) has high seed cotton yield.
2, LF-ICR22 breeds the fiber quality of characters of progenies
The testing result that LF-ICR22 breeds the seed cotton yield of offspring (LF-ICR22) is as shown in table 5: can from table
Out, compared with acceptor material CCRI24, LF-ICR22 breeds fibre length, the specific strength, mic value of offspring (LF-ICR22)
It increases with uniformity, illustrates that the cotton fiber quality of LF-ICR22 breeding offspring (LF-ICR22) increases.
Table 5, LF-ICR22 breed the testing result of the fiber quality of offspring (LF-ICR22)
Therefore it can detect or assist as follows whether detection plant sample derives from transgene cotton LF-
ICR22 or its offspring:
PCR amplification is carried out to the genomic DNA of plant sample with primer pair 1 or primer pair 2, obtains pcr amplification product, is examined
It surveys in pcr amplification product and whether contains DNA fragmentation A,
If plant sample is or candidate is transgene cotton LF-ICR22 or its offspring containing DNA fragmentation A；
If not containing DNA fragmentation A, plant sample is not or candidate is not transgene cotton LF-ICR22 or its offspring.
Single stranded DNA shown in sequence 6 point in the single strand dna as shown in sequence 5 in sequence table of primer pair 1 and sequence table
Son composition；
Single stranded DNA shown in sequence 8 point in the single strand dna as shown in sequence 7 in sequence table of primer pair 2 and sequence table
Son composition；
DNA fragmentation A is by upstream flanking fragment (sequence 2), exogenous dna fragment (sequence 1) and downstream flanking fragment (sequence 3)
Composition.
Claims (9)
1. a kind of breeding method of transgene cotton, for exogenous dna fragment is inserted into purpose cotton gene group A09 chromosome
65694545-65696799 interdigit, replace 2253 bp of 65694545-65696799 interdigit of A09 chromosome
Base sequence, obtain transgene cotton；
The fiber quality of the transgene cotton is higher than the purpose cotton；
The exogenous dna fragment is the DNA molecular containing GhKCS6 gene；
The nucleotides sequence of the exogenous dna fragment is classified as sequence 1 in sequence table；
The fiber quality of the transgene cotton is higher than the purpose cotton and is embodied in following B1)-B13):
B1) length of transgene cotton fiber is higher than the purpose cotton；
B2) specific strength of transgene cotton fiber is higher than the purpose cotton；
B3) uniformity of transgene cotton fiber is higher than the purpose cotton；
B4) seed cotton yield of transgene cotton is higher than the purpose cotton；
B5) plant height of transgene cotton is higher than the purpose cotton；
B6) length of blade of transgene cotton is higher than the purpose cotton；
B7) width of blade of transgene cotton is higher than the purpose cotton；
B8) the petiole length of transgene cotton is higher than the purpose cotton；
B9) the petiole width of transgene cotton is higher than the purpose cotton；
B10) single bell number of transgene cotton is higher than the purpose cotton；
B11) transgene cotton at bell number be higher than the purpose cotton；
B12) the fruit branch number of transgene cotton is higher than the purpose cotton；
B13) ginning outturn of transgene cotton is higher than the purpose cotton；
The purpose cotton is upland cotton CCRI24.
2. according to the method described in claim 1, it is characterized by:
The exogenous dna fragment is the purpose cotton gene group the A09th in the upstream flanking fragment of the transgene cotton
The length of chromosome extended from the 65694545th nucleotide to its updrift side is any one of 0 to 5 Kb
DNA fragmentation；
The exogenous dna fragment is the purpose cotton gene group the A09th in the downstream flanking fragment of the transgene cotton
The length of chromosome extended from the 65696799th nucleotide to direction downstream is any one of 0 to 5 Kb
DNA fragmentation.
3. method according to claim 2, it is characterised in that:
The upstream flanking fragment is nucleotide shown in sequence 2 in sequence table；
The downstream flanking fragment is nucleotide shown in sequence 3 in sequence table；
The exogenous dna fragment imports the purpose cotton by the recombinant vector containing the exogenous dna fragment.
4. method according to claim 1 to 3, it is characterised in that: the transgene cotton is transgene cotton
LF-ICR22, deposit number are CCTCC No.P201516.
5. for detect or assist detection plant sample whether derive from transgene cotton LF-ICR22 described in claim 4 or
The method of its offspring, includes the following steps:
It detects in the genomic DNA of the plant sample and whether contains DNA fragmentation A,
The DNA fragmentation A is by the exogenous dna fragment in claim 2 in the upstream of the transgene cotton LF-ICR22
The exogenous dna fragment in flanking fragment, claim 2 and the exogenous dna fragment in claim 2 turn base described
Because the downstream flanking fragment of cotton LF-ICR22 forms；
If the genomic DNA of the plant sample contains the DNA fragmentation A, the plant sample is or candidate is described turns
Gene cotton LF-ICR22 or its offspring；
If the genomic DNA of the plant sample does not contain the DNA fragmentation A, the plant sample is not or candidate is not
The transgene cotton LF-ICR22 or its offspring.
6. according to the method described in claim 5, it is characterized by:
The method be it is following 1) or 2) or 3):
1) direct Sequencing；
2) PCR amplification is carried out to the genomic DNA of plant sample with primer pair 1 and/or primer pair 2, if there is purpose amplified production,
Then the plant sample derives from the transgene cotton LF-ICR22 or its offspring；
The primer pair 1 is that can expand to be held by the exogenous dna fragment 5 ' and close to its upstream flanking sequence part
Or the primer pair of the DNA molecular first of whole segment compositions；Its corresponding purpose amplified production is the DNA molecular first；
The primer pair 2 is that can expand to hold containing the exogenous dna fragment 3 ' and close to its downstream flanking sequence
The primer pair of the DNA molecular second partly or entirely formed；Its corresponding purpose amplified production is the DNA molecular second；
The primer pair 1 is specifically single-stranded shown in sequence 6 in the single strand dna as shown in sequence 5 in sequence table and sequence table
DNA molecular composition；
The primer pair 2 is specifically single-stranded shown in sequence 8 in the single strand dna as shown in sequence 7 in sequence table and sequence table
DNA molecular composition；
3) probe of the DNA molecular first described in energy specific bond or its DNA molecular second carries out the plant sample DNA to be measured
Southern hybridization, obtains hybridized fragment if can hybridize, and the plant sample derives from the transgene cotton LF-ICR22
Or its offspring.
7. whether deriving from the transgene cotton LF-ICR22 or the kit of its offspring for test sample comprising: power
Benefit requires the primer pair 1 in 6 and/or the primer pair 2 in claim 6.
8. application of the transgene cotton LF-ICR22 in breeding described in claim 4.
9. a kind of method for obtaining the cotton that fiber quality improves, includes the following steps:
(1) transgene cotton is obtained according to the method any in claim 1-4；
(2) transgene cotton is selfed or is hybridized, obtain breeding offspring, identified according to method described in claim 5 or 6
The breeding offspring, obtains target plant；
The deposit number of the transgene cotton is CCTCC No.P201516.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510880447.7A CN105368868B (en) | 2015-12-03 | 2015-12-03 | Upland cotton transformation event LF-ICR22 and its specificity identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510880447.7A CN105368868B (en) | 2015-12-03 | 2015-12-03 | Upland cotton transformation event LF-ICR22 and its specificity identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105368868A CN105368868A (en) | 2016-03-02 |
| CN105368868B true CN105368868B (en) | 2019-04-30 |
Family
ID=55371496
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510880447.7A Expired - Fee Related CN105368868B (en) | 2015-12-03 | 2015-12-03 | Upland cotton transformation event LF-ICR22 and its specificity identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368868B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355306B (en) * | 2018-11-29 | 2022-01-11 | 中国农业科学院棉花研究所 | Upland cotton transformation event ICR24-397 and specificity identification method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007009181A1 (en) * | 2005-07-20 | 2007-01-25 | Agriculture Victoria Services Pty Ltd | Modification of flavonoid biosynthesis in plants |
| CN101962658A (en) * | 2010-10-21 | 2011-02-02 | 中国农业大学 | High-efficiency transgenic cotton expression vector and application thereof |
-
2015
- 2015-12-03 CN CN201510880447.7A patent/CN105368868B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007009181A1 (en) * | 2005-07-20 | 2007-01-25 | Agriculture Victoria Services Pty Ltd | Modification of flavonoid biosynthesis in plants |
| CN101962658A (en) * | 2010-10-21 | 2011-02-02 | 中国农业大学 | High-efficiency transgenic cotton expression vector and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| How cotton fibers elongate :a tale of linear cell-growth mode;QIN YM ET AL;《curr opin plant biol》;20111231;第14卷(第1期);摘要 * |
| 两个棉花逆境相关锌指蛋白基因的转基因材料创制;郭琪;《中国优秀硕士论文全文数据库》;20140815(第8期);全文 * |
| 棉花纤维发育相关基因GhKcs13的克隆与功能验证;杜雪琼;《中国优秀硕士论文全文数据库》;20150815(第8期);全文 * |
| 超长链脂肪酸合成相关基因的转基因功能验证;钱玉源;《中国优秀硕士学位论文全文数据库》;20140215(第2期);摘要,11页2.2节，25页表10，32页表11 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105368868A (en) | 2016-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191107A (en) | A kind of molecular improvement method reducing rice grain seed holding | |
| ES2961522T3 (en) | Transgenic cotton event MON 88702 and procedures for its detection and uses | |
| WO2020108032A1 (en) | Upland cotton transformation event icr24-397 and specificity identification method therefor | |
| CN105518141A (en) | Use of genic male sterility gene and mutation thereof in hybridization | |
| US11692200B2 (en) | Method for improving rice yield and/or rice blast resistance and protein used thereof | |
| CN105985965A (en) | Gene GW7 for controlling grain shape, exterior quality and yield of rice and applications of gene GW7 | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN101812451B (en) | Rice glume development gene promoter p-TRI1 and application thereof | |
| CN106191104B (en) | Upland cotton transformation event ICR24001 and its specificity identification method | |
| CN107190011A (en) | The gene of the coding myosin of one cotton quality trait associations | |
| BR9711048B1 (en) | construction of recombinant DNA, vector, plasmid, bacterial cells, and processes for obtaining plants with reduced susceptibility to a pathogen and for isolating nucleic acid. | |
| CN105368868B (en) | Upland cotton transformation event LF-ICR22 and its specificity identification method | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN108948169A (en) | It is a kind of promote cotton fiber green pigment synthesis protein, gene and its coded sequence and application | |
| CN105368869B (en) | Upland cotton transformation event ICR201501 and its specificity identification method | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN103348009A (en) | Method for preparing fertility-lowered plant | |
| CN106868038B (en) | Method for creating cytoplasmic male sterile line by cotton transgenosis | |
| CN105316360B (en) | Upland cotton transformation event ICR24110 and its specificity identification method | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN113151258B (en) | Flanking sequence of exogenous insertion fragment of insect-resistant transgenic maize AM63 insertion site and application thereof | |
| CN104651367B (en) | A kind skin and fibr tissue specific expressing promoter SFS and its application | |
| CN104341494A (en) | Protein ZmWAK with high resistance of sporisorium reilianum, as well as coding gene and application of protein ZmWAK | |
| CN111518181B (en) | Method for increasing rice yield and protein used by same | |
| CN105175519B (en) | Applications of the Protein S RL2 in cultivating leaf roll Qushui River rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190430 Termination date: 20211203 |