CN109355306B - Upland cotton transformation event ICR24-397 and specificity identification method thereof - Google Patents

Abstract

The invention discloses a gossypium hirsutum transformation event ICR24-397 and a specificity identification method thereof. The invention overexpresses csRRM2 gene in upland cotton CCRI24 to obtain transgenic cotton ICR24-397, which is cotton obtained by inserting exogenous DNA fragment into 7000726-7000849 site of A09 chromosome of target cotton genome and replacing 122bp base sequence between 7000726-7000849 site of A09 chromosome. The test proves that: the transgenic cotton ICR24-397 has fiber length, specific strength, uniformity and seed cotton yield higher than those of the acceptor material, and has plant height, leaf length, leaf width, boll forming number, single boll weight and other higher than those of the acceptor material, so that the transgenic cotton ICR24-397 lays a foundation for the research of cultivating transgenic cotton with excellent fiber quality.

Description

Upland cotton transformation event ICR24-397 and specificity identification method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a gossypium hirsutum transformation event ICR24-397 and a specificity identification method thereof.

Background

The transformation event is a molecular structure consisting of the foreign gene and the foreign gene in the upstream and downstream flanking regions of the genomic insertion site. Generally, transformation of a plant with a foreign gene results in a population of transformants that contains a number of independent events, each of which is unique. Expression of a foreign gene in a plant is affected by the chromosomal location into which the foreign gene is inserted. This may result from the influence of chromatin structure or transcriptional regulatory elements near the integration site. The expression levels of the same gene in different transformation events vary greatly and may also differ in the spatial or temporal pattern of expression. Moreover, the insertion of foreign genes may also affect the expression of endogenous genes. Thus, the effect of each independent transformation event on the recipient plant is different. The obtained plant transformation event which can effectively express the exogenous gene and does not influence the agronomic characters of the plant has important application value in cultivating new varieties of transgenic crops.

Cotton is an important economic crop in China, and the main planting purpose is to harvest cotton fibers as raw materials in the textile industry. In addition, cottonseed oil and cottonseed protein are important vegetable oil and protein resources, which account for 10% and 6% of the total supply of edible vegetable oil and protein in the world, respectively, and cotton linters, cottonseed hulls, cotton stalks, gossypol and the like are all used industrially.

On one hand, because cotton fibers are the longest cells found in nature at present, the cotton fibers provide the best experimental materials for researching a cell elongation regulation mechanism; on the other hand, cotton fibers are formed by single cell bulges, which provides convenience for researching cell fate decisions. In addition, long fibers and high yield are desired by the textile industry and are also needed by cotton, so that the improvement of the fiber quality and yield of cotton is of great significance in production.

Disclosure of Invention

The invention aims to provide a method for cultivating transgenic cotton.

The method for cultivating the transgenic cotton comprises the following steps: replacing a fragment with the size of 122bp between the 7000726-7000849 sites of the chromosome A09 of a target cotton genome with an exogenous DNA fragment to obtain transgenic cotton;

the exogenous DNA fragment is a DNA molecule containing csRRM2 gene;

the fiber quality of the transgenic cotton is higher than that of the target cotton.

Further, the exogenous DNA fragment comprises a csRRM2 gene expression cassette and a glyphosate-resistant gene Epsps expression cassette.

The csRRM2 gene has the total length of 198bp, encodes FCA protein, and has the functions of improving the quality of cotton fibers and the yield of ginned cotton, promoting the enlargement of cotton bolls and seeds and the like. The csRRM2 gene expression box sequentially comprises a CAMV35S promoter, a csRRM2 gene and an NOS terminator from cauliflower mosaic virus. Wherein the nucleotide sequence of the CAMV35S promoter is shown as the 3451-3796 nucleotide sequence of SEQ ID NO. 1; the nucleotide sequence of the csRRM2 gene is shown as 3225-position 3422 nucleotide of SEQ ID NO. 1; the nucleotide sequence of the NOS terminator is shown as the 2949-3201 nucleotide of SEQ ID NO. 1. The nucleotide sequence of the csRRM2 gene expression cassette is shown as 2927-4198 th nucleotide of SEQ ID NO. 1.

The glyphosate-resistant gene Epsps has a total length of 1551bp, encodes 5-enolpyruvylshikimate-3-phosphate synthase, and can make plants obtain resistance to herbicides by over-expression of EPSPS. The glyphosate-resistant gene Epsps expression cassette sequentially comprises a CaMV35S enhanced promoter, a glyphosate-resistant gene Epsps and a Ploy A terminator from cauliflower mosaic virus. Wherein the nucleotide sequence of the CAMV35S enhanced promoter is shown as the 1935-2612 site of SEQ ID NO. 1; the nucleotide sequence of the glyphosate-resistant gene Epsps is shown in the position 317-1867 of SEQ ID NO. 1; the nucleotide sequence of the Ploy A terminator is shown in the 103-277 position of SEQ ID NO. 1. The nucleotide sequence of the glyphosate resistant gene Epsps expression cassette is shown as the 103-th and 2612-th nucleotides in SEQ ID NO. 1.

Furthermore, the nucleotide sequence of the exogenous DNA fragment is specifically shown as SEQ ID NO. 1.

In a specific embodiment of the invention, the cotton transformation event ICR24-397 is obtained by the method, which is transgenic cotton obtained by inserting the exogenous DNA fragment shown in SEQ ID NO.1 into the position 7000726-7000849 of the chromosome A09 of a target cotton genome and replacing the fragment 122bp in the position 7000726-7000849 of the chromosome A09. And the nucleotide sequence of the upstream flanking fragment upstream from position 7000726 and immediately adjacent to nucleotide 7000726 (left flanking sequence) is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream flanking fragment downstream from position 7000849 and immediately adjacent to nucleotide 7000849 (right flanking sequence) is shown as SEQ ID NO. 3.

The cotton transformation event ICR24-397 is characterized in that a target gene csRRM2 and a glyphosate-resistant gene Epsps are constructed on a pCambia1300 vector by an agrobacterium-mediated method, the target gene csRRM2 and the glyphosate-resistant gene Epsps are introduced into an explant of receptor cotton by the agrobacterium-mediated method, and the transformation event with the best performance is obtained by screening by methods of molecular biology and biological assay.

In the method, the fiber quality of the transgenic cotton is higher than that of the target cotton, which is embodied in any one of the following B1) -B8):

B1) the length of the transgenic cotton fiber is higher than that of the target cotton;

B2) the micronaire value of the transgenic cotton fiber is lower than that of the target cotton;

B3) the uniformity of the transgenic cotton fiber is higher than that of the target cotton;

B4) the elongation rate of the transgenic cotton fiber is higher than that of the target cotton;

B5) the specific strength of the transgenic cotton fiber is higher than that of the target cotton;

B6) the seeds of the transgenic cotton are higher than the target cotton;

B7) the single-boll weight of the transgenic cotton is higher than that of the target cotton;

B8) the number of bolls of each plant of the transgenic cotton is higher than that of the target cotton.

In the above method, the cotton of interest may be upland cotton CCRI 24.

The transformation event ICR24-397 obtained by the invention is preserved in the China Center for Type Culture Collection (CCTCC) in 2018, 10 months and 16 days, is classified and named as cotton seeds (Gossypium hirsutum L.), and has the preservation number of CCTCC NO: p201821.

Another object of the present invention is to provide a method for detecting or detecting in an auxiliary manner whether a plant sample to be tested is transgenic cotton or its progeny obtained by the above method.

The method for detecting or detecting in an auxiliary manner whether the plant sample to be detected is the transgenic cotton or the progeny thereof obtained by the method comprises the following steps: detecting whether the genome DNA of the plant sample to be detected contains a DNA fragment A or not,

the DNA fragment A sequentially consists of a left flank sequence, the exogenous DNA fragment and a right flank sequence;

if the genomic DNA of the plant sample to be detected contains the DNA fragment A, the plant sample to be detected is or is selected as the transgenic cotton or the descendant thereof;

if the genomic DNA of the plant sample to be tested does not contain the DNA fragment A, the plant sample to be tested is not or is not candidate to be the transgenic cotton or the descendant thereof;

the left flanking sequence is shown in SEQ ID NO. 2;

the right flanking sequence is shown in SEQ ID NO. 3.

The method for detecting or assisting in detecting whether the plant sample to be detected is the transgenic cotton or the progeny thereof obtained by the method is 1) or 2) as follows:

1) direct sequencing;

2) carrying out PCR amplification on the genome DNA of the plant sample to be detected by using a primer pair A and/or a primer pair B, detecting the size of an amplification product, and if a strip with the size of 950bp is obtained by amplifying the primer pair A or a strip with the size of 800bp is obtained by amplifying the primer pair B, determining that the plant sample to be detected is or is a candidate of the transgenic cotton or a descendant thereof; otherwise, the plant sample to be tested is not or is not a candidate for the transgenic cotton or progeny thereof;

the primer pair A consists of a single-stranded DNA molecule shown in SEQ ID NO.5 and a single-stranded DNA molecule shown in SEQ ID NO. 6;

the primer pair B consists of a single-stranded DNA molecule shown in SEQ ID NO.7 and a single-stranded DNA molecule shown in SEQ ID NO. 8.

The invention also aims to provide a new application of the transgenic cotton obtained by the method.

The invention provides application of the transgenic cotton obtained by the method in breeding cotton with improved fiber quality.

The invention also provides application of the transgenic cotton obtained by the method in cotton breeding.

It is a final object of the present invention to provide a method of growing cotton with improved fiber quality.

The method for cultivating the cotton with improved fiber quality provided by the invention comprises the following steps:

(1) obtaining transgenic cotton according to the breeding method;

(2) selfing or hybridizing the transgenic cotton to obtain breeding progeny, and identifying the breeding progeny according to the method to obtain a target plant.

The biological materials described in any of the following a) to c) also belong to the scope of the present invention:

a) the left flank sequence and the right flank sequence;

b) the above foreign DNA fragment;

c) biological material related to the above exogenous DNA fragment;

the biomaterial is any one of the following A1) to A11):

A1) an expression cassette containing the exogenous DNA fragment;

A2) a recombinant vector containing the exogenous DNA fragment;

A3) a recombinant vector comprising the expression cassette of a 1);

A4) a recombinant microorganism containing the exogenous DNA fragment;

A5) a recombinant microorganism comprising the expression cassette of a 1);

A6) a recombinant microorganism comprising a2) said recombinant vector;

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a transgenic plant cell line containing the exogenous DNA segment;

A9) a transgenic plant cell line comprising the expression cassette of a 1);

A10) a transgenic plant cell line comprising the recombinant vector of a 2);

A11) a transgenic plant cell line comprising the recombinant vector of a 3).

The application of the biological material in regulating and controlling cotton fiber quality and/or fiber length and/or fiber micronaire value and/or fiber uniformity and/or fiber elongation and/or fiber specific strength and/or seed finger and/or single boll weight and/or boll forming number and/or clothes and/or plant height and/or leaf area also belongs to the protection scope of the invention.

In the biological material, the recombinant vector is a recombinant vector containing a csRRM2 gene expression cassette and a glyphosate-resistant gene Epsps expression cassette. In one embodiment of the invention, the nucleotide sequence of the recombinant vector is shown as SEQ ID NO. 4.

The recombinant cell is a recombinant agrobacterium cell containing the recombinant vector. In an experimental embodiment of the present invention, the recombinant cell is a recombinant agrobacterium LBA4404 cell containing the recombinant vector.

The invention introduces csRRM2 gene into upland cotton CCRI24, so that csRRM2 gene is over-expressed in upland cotton CCRI24 to obtain transgenic cotton ICR24-397, wherein the transgenic cotton ICR24-397 is cotton obtained by inserting exogenous DNA fragment into the position 7000726-7000849 of chromosome A09 of a target cotton genome and replacing the base sequence with the size of 122bp between the position 7000726-7000849 of chromosome A09. The test proves that: the transgenic cotton ICR24-397 has fiber length, specific strength and uniformity higher than those of receptor material, and boll forming number, single boll weight, seed finger and other parameters higher than those of receptor material, so that it lays the foundation for the research of culturing transgenic cotton with excellent fiber quality.

Drawings

FIG. 1 is a graphical representation of transformation events ICR 24-397.

FIG. 2 is a comparison of cotton boll, fiber and seed phenotypes of transgenic cotton ICR24-397 and the receptor material CCR 124. RRM2/T4 represents the fourth generation of selfing of transgenic lines.

FIG. 3 is a phenotypic comparison of boll formation and plant type of transgenic cotton ICR24-397 and the receptor material CCR 124. RRM2/T4 and transgene/RRM 2 both represent the fourth generation of selfing of transgenic lines.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The cotton CCRI24 of the following examples is disclosed in "PAG 1, a cotton brassinosteroid gene, models fiber electrophoresis", publicly available from the Cotton research institute of the Chinese academy of agricultural sciences ".

Agrobacterium LBA4404 in the following examples is disclosed in the literature "structural expression of the viral genes improvements of plant transformation by Agrobacterium", publicly available from the Cotton research institute of the national academy of agricultural sciences.

Example 1 transformation of csRRM2 Cotton harvesting and agronomic traits analysis

First, transfer csRRM2 cotton acquisition and preservation

1. Construction of recombinant vectors

The csRRM2 gene expression cassette was inserted into the EcoRI and HindIII cleavage sites of the pCambia1300 vector (which was purchased from Biovector plasmid vector bacterial cell Gene Collection under the NTCC type culture Collection, having the accession number Biovector Cambia1300) while keeping the other sequences of the pCambia1300 vector unchanged, to obtain a recombinant vector (the nucleotide sequence of which is SEQ ID NO. 4).

The nucleotide sequence of the csRRM2 gene expression cassette is shown as 2927-4198 th nucleotide of SEQ ID NO. 1. The csRRM2 gene expression box sequentially comprises a CAMV35S promoter, a csRRM2 gene and an NOS terminator from cauliflower mosaic virus; wherein the nucleotide sequence of the CAMV35S promoter is shown as the 3451-3796 nucleotide sequence of SEQ ID NO. 1; the nucleotide sequence of the csRRM2 gene is shown as 3225-position 3422 nucleotide of SEQ ID NO. 1; the nucleotide sequence of the NOS terminator is shown as the 2949-3201 nucleotide of SEQ ID NO. 1.

The pCambia1300 vector comprises an anti-glyphosate gene Epsps expression cassette, and the nucleotide sequence of the anti-glyphosate gene Epsps expression cassette is shown as the 103 rd and 2612 th nucleotides in the sequence 1. The glyphosate-resistant gene Epsps expression cassette sequentially comprises a cauliflower mosaic virus CAMV35S enhanced promoter, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and a Ploy A terminator. Wherein the nucleotide sequence of the CAMV35S enhanced promoter is shown as the 1935-2612 site of SEQ ID NO. 1; the nucleotide sequence of the glyphosate-resistant gene Epsps is shown in the position 317-1867 of SEQ ID NO. 1; the nucleotide sequence of the Ploy A terminator is shown in the 103-277 position of SEQ ID NO. 1. Over-expression of EPSPS allows plants to acquire resistance to herbicides while using glyphosate in tissue culture for positive shoot selection.

2. Obtaining of recombinant bacteria

And (3) introducing the recombinant vector obtained in the step (1) into agrobacterium LBA4404 to obtain a recombinant bacterium.

3. Obtaining of csRRM2 Cotton

Transforming the recombinant bacteria obtained in the step 2 into explants (1500) of upland cotton CCRI24 by adopting an agrobacterium-mediated method, culturing and inducing the explants on a culture medium containing glyphosate to form callus, selecting the transformed callus, forming embryogenic callus on the glyphosate screening culture medium by the callus, selecting the surviving embryogenic callus to transform to form regeneration cotton, and finally obtaining 60T 0 generations of csRRM2 cotton in total and using the cotton for screening.

4. Identification of csRRM2 cotton

(1) And planting the harvested cotton seeds of the CSRRM2 generation T1 in the greenhouse to obtain the cotton of the CSRRM2 generation T1. Extracting genome DNA of a cotton leaf blade transformed from CSRRM2 in T1 generation, performing PCR amplification by using primers 5'-GGATCCATGGGTGCGGTAGAGTT-3' and 5'-AGATCTTGTGCCACTTCCCTTG-3', detecting whether a target gene exists, counting the segregation ratio of materials, and obtaining 17 single-copy cotton transformed from CSRRM2 in T1 generation according to Mendel's law of heredity.

(2) Further validation of the 17 single copies of cotton obtained in step (1) above, which was transformed from csRRM2 at T1 generation, was performed by Taqman PCR and Southern blot. And performing csRRM2 gene expression analysis determination on 17 single-copy T1 generation csRRM2 cotton in the boll stage. The method comprises the following specific steps: the expression level of csRRM2 of 17 single copies of the cotton transformed with csRRM2 in the T1 generation and the receptor material CCRI24 was analyzed at 0 days (day of flowering) and 5 days and 15 days after flowering, respectively. The results show that: the expression quantity of 9 cotton with T1 to csRRM2 in 17 single-copy cotton with T1 to csRRM2 is greatly improved compared with that of receptor material CCRI 24.

(3) And (3) measuring the fiber quality of 9T 1-generation csRRM2 cotton obtained in the step (2) in the boll opening period. The results show that: the cotton fiber length of 9T 1-generation csRRM2 cotton and 6T 1-generation csRRM2 cotton is improved or elongated compared with that of receptor material CCRI 24.

(4) The 6T 2 generations csRRM2 cotton obtained in step (3) above were evaluated in the first year field test in paired plots at the same location for agronomic traits (fiber quality, single boll weight, coat, seed finger, plant height, initial node height, fruit branch number, growth period, where fiber quality includes length, specific strength, micronaire value, elongation, uniformity) and the effect of transgene insertion on cotton growth and development, cotton yield. The results show that: the agronomic characters of the 6 cotton with T2 generation csRRM2 and 2 cotton with T2 generation csRRM2 generation are better than that of receptor material CCRI 24.

(5) And (3) evaluating the agronomic characters (fiber quality, single bell weight, clothes, seed fingers, plant height, initial node height, fruit branch number and growth period, wherein the fiber quality comprises length, specific strength, micronaire value, elongation and uniformity) of the 2T 2 generation csRRM2 cotton obtained in the step (4) in paired plots at the same position in a field test in the next year, and the influence of transgene insertion on the growth and development of cotton and the yield of cotton. The results show that: the agronomic characters of 1 cotton which is transformed from T2 to csRRM2 in 2 cotton which is transformed from T2 to csRRM2 are better than that of receptor material CCRI24, and the seeds of the cotton which is transformed from T2 to csRRM2 are named as ICR 24-397.

5. Preservation of cotton seeds transformed from csRRM2 in T4 generation

Selfing the T2-generation csRRM2 cotton ICR24-397 until obtaining a T4-generation csRRM2 cotton homozygous strain ICR 24-397. And the ICR24-397 of the CsRRM2 cotton seeds (Gossypium hirsutum L.) transferred from the T4 generation in 2018, 10 months and 16 days is preserved in the China center for type culture collection, which is named as cotton seeds (Gossypium hirsutum L.) with the collection number of CCTCC NO: p201821.

Second, transforming the agronomic character analysis of csRRM2 cotton

1. Fiber quality and seed cotton yield

The T4-generation csRRM2 cotton homozygous strain ICR24-397 and receptor material CCRI24 are subjected to field yield tests. A plot experiment is designed in Anyang of Henan, 3 plots are set, the 3 plots are completely the same, the plot line length is 8m, 30 plants are planted in each line, the line spacing is 80cm, 3 lines are planted in each material, and the total number of plots is 6. Statistical analysis was performed on the fiber length, micronaire value, uniformity, elongation, specific strength, single boll weight, boll number, seed finger and coat score of the T4 generation csRRM2 cotton homozygous strain ICR24-397 and receptor material CCRI24 fibers using students' test.

The statistical results of fiber length, regularity, specific strength, elongation and micronaire value are shown in table 1: compared with a receptor material CCRI24, the T4 generation csRRM2 cotton homozygous strain ICR24-397 has improved fiber length, uniformity, specific strength and elongation, the micronaire value is reduced, and the production requirement is better met, wherein the fiber length, the elongation, the specific strength and the receptor material CCRI24 are very obviously different.

The statistics of the single bell weight, the number of finished bells, the seed finger and the clothing score are shown in table 2: compared with a receptor material CCRI24, the single-boll weight, the boll forming number (single-plant boll forming number) and the seed finger of a T4 generation csRRM2 cotton homozygous strain ICR24-397 are all improved, the clothes content is reduced, mainly because the cotton boll volume of the transgenic material is increased, the seed volume is increased, and the high-yield requirement is more suitable.

TABLE 1 fiber quality data for transgenic cotton ICR24-397 and the receptor material CCR124

TABLE 2 Single boll weight, boll number, seed finger, coat score for transgenic cotton ICR24-397 and receptor material CCR124

2. Influence of other aspects

The promoter is a constitutive promoter, so that the promoter is expressed in seeds and fibers, other tissues are also influenced to a certain extent, and in order to research whether the csRRM2 gene influences other tissues besides improving the fiber quality, particularly the fiber length, the plant height, the leaf area, the boll size and the seed size of a T4 generation csRRM2 cotton homozygous strain ICR24-397 and a receptor material CCRI24 are observed and detected.

Phenotypic observations of bolls, fibers, seeds and plants transformed with csRRM2 cotton and receptor material CCRI24 are shown in fig. 2 and 3. As can be seen from the figure, the plant height, leaf area, cotton boll size and seed size of the T4 generation csRRM2 cotton homozygous line ICR24-397 are significantly higher than those of the receptor material CCRI 24. The expression of the csRRM2 gene is shown to have a certain influence on the plant height, leaf size, boll size and seed size of the plant.

Characterization analysis of the DNA sequence of ICR24-397

The insert of the ICR24-397 genome and the genomic sequences flanking the insert were analyzed by molecular biology methods. The method comprises the following specific steps:

1. and (3) extracting cotton genome DNA. About 100mg of young leaves of csRRM 2-transferred cotton ICR24-397 were placed in a 2.0mL EP tube, the EP tube was frozen with liquid nitrogen, and then ground with a cryo-grinder, and genomic DNA was extracted with the Qiagen DNeasy Plant Mini Kit (50) (Cat 69104).

2. And (5) constructing a DNA library. Universal Genome Walker according to Clontech^TM2.0 instructions in User Manual kit (Cat. No.634923) genomic DNA was digested with 4 different restriction enzymes (DraI, EcoRV, PvuII, StuI) overnight to obtain digests. And (3) recovering the digestion product by adopting a NucleoSpin Gel and PCR Clean-Up kit box arranged in the kit, and adding joints arranged in the kit to two ends of the recovered product by adopting T4 DNA ligase until 4 joint-added DNA libraries are constructed.

3. And (5) sequencing. According to the known sequence of the transgene insert, two nested primers are designed at the 5 'end and the 3' end respectively, and then a kit (Universal Genome Walker of Clontech company) is adopted^TM2.0 User Manual kit). The amplicons generated from the reactions were separated by agarose gel electrophoresis, subsequently purified using the QIAGEN gel purification kit (QIAGEN, Valencia, CA), cloned into a T-cloning vector according to the protocol provided in the pMD-19T-Simple (cat # D104A) kit from gangbao bio life technology limited, and transformed into e.coli DH5 α, transformants were selected on ampicillin resistant plates and colony PCR was performed, and the positive clones were subjected to monoclonal sequencing.

The sequencing result shows that: the CSRRM2 cotton ICR24-397 is transgenic cotton obtained by inserting an exogenous DNA fragment shown in SEQ ID NO.1 in a sequence table between positions 7000726 and 7000849 of the A09 chromosome of the CCRI24 genome of upland cotton and replacing a base sequence with the size of 122bp between positions 0727006 and 7000849 of the A09 chromosome, wherein the nucleotide sequence of an upstream flanking fragment from the upstream of position 7000726 and adjacent to position 7000726 is shown as SEQ ID NO.2, and the nucleotide sequence of a downstream flanking fragment from the downstream of position 7000849 and adjacent to position 7000849 is shown as SEQ ID NO. 3.

Example 2, obtaining and identification of traits of offspring bred by ICR24-397 and agronomic trait analysis thereof

First, obtaining of ICR24-397 breeding offspring character

1. Hybridization of

Removing pollen of the first cotton by manual or artificial action 1 afternoon before flowering, covering the stigma of the flower with a wax tube to prevent the contact of foreign pollen with the stigma, and collecting pollen of the second cotton by manual operation when pollen of the second cotton is scattered in the morning next day, and contacting the pollen with the stigma or stigma of the first plant to complete the hybridization process. Wherein, when the first cotton is ICR24-397 of example 1, the second cotton is other cotton (upland cotton CCRI24), or when the second cotton is ICR24-397 of example 1, the first cotton is other cotton (upland cotton CCRI 24).

And harvesting the hybrid bolls in the boll opening period, naturally drying the cotton, ginning, and using concentrated sulfuric acid to drag down to obtain the hybrid seeds. Planting to obtain hybrid progeny, namely ICR24-397 breeding progeny.

2. Selfing

Directly clamping the buds of ICR24-397 by using a grafting clip or binding the buds by using a thin line 1 day before flowering, and preventing external pollen from contacting with the stigma of ICR24-397 during flowering; or the whole cotton plant is sleeved by the mesh bag, so that pollination through insects and the like can be effectively prevented, and self-pollination of cotton can be realized. The selfing can be completed through the steps.

Harvesting hybrid bolls in a boll opening period, naturally drying cotton in the sun, ginning, and using concentrated sulfuric acid to drag down cotton to obtain selfed seeds, and planting to obtain selfed progeny, namely ICR24-397 breeding progeny.

Secondly, the identification of the character of the offspring bred by ICR24-397 and the analysis of the agronomic character thereof

1. Method for identifying traits of offspring bred by ICR24-397

The genomic DNA of the offspring bred by ICR24-397 is used as a template, a specific primer is used for PCR amplification, if the PCR amplification product contains an amplicon (the amplicon refers to one or one section of DNA molecule synthesized by the PCR amplification technology) of ICR24-397, the offspring bred by ICR24-397 has the same character as ICR24-397, and if the PCR amplification product does not contain the amplicon of ICR24-397, the offspring bred by ICR24-397 does not have the same character as ICR 24-397. The specific identification method is as follows:

(1) design of primers

The following identification primers were designed based on the upstream flanking sequence and the foreign DNA molecule:

GSP1：CGCACACACATTTCAGGTC(SEQ ID NO.5)；

GSP2：GCCGATTCTCTCTCCGTTA(SEQ ID NO.6)。

the following identification primers were designed based on the downstream flanking sequence and the foreign DNA molecule:

GSP3：GTTTCCCGCCTTCAGTTT(SEQ ID NO.7)；

GSP4：CAACCACAACACTACACCTCAT(SEQ ID NO.8)。

(2) PCR amplification

And (2) taking the genomic DNA of the offspring bred by ICR24-397 as a template, and respectively adopting the primer GSP1/GSP2 and the primer GSP3/GSP4 designed in the step (1) to carry out PCR amplification to obtain a PCR amplification product.

The PCR amplification system is as follows: 2X MASTRE PCR MIX 10. mu.L, forward primer (10. mu.M) 0.5. mu.L, reverse primer (10. mu.M) 0.5. mu.L, template DNA (50 ng/. mu.L) 1. mu.L, and ultrapure water 8. mu.L, in a total volume of 20. mu.L.

The PCR reaction conditions were as follows: 5min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 45s at 72 ℃ and 32 cycles; 5min at 72 ℃.

(3) The PCR amplification products were subjected to agarose gel electrophoresis and sequenced.

If the size of the amplification product of the primers GSP1/GSP2 is 950bp or the size of the amplification product of the primers GSP3/GSP4 is 800bp, the ICR24-397 breeding offspring contains ICR24-397 amplicon, and the ICR24-397 breeding offspring has ICR24-397 property, otherwise, the ICR24-397 property is not possessed.

2. Agronomic character analysis of ICR24-397 breeding offspring character

The fiber qualities of the ICR24-397 breeding progeny (ICR24-397) having the ICR24-397 amplicon obtained in the above step 1 and the recipient material CCRI24 were examined as in step two of example 1.

The statistical results of fiber length, specific strength, elongation and micronaire values are shown in table 3: as can be seen from the table, compared with the receptor material CCRI24, the fiber length, specific strength and elongation of the generations (ICR24-397) bred with ICR24-397 are all improved, which shows that the quality of the cotton fibers of the generations (ICR24-397) bred with ICR24-397 is improved.

Table 3, results of fiber quality measurement of generations (ICR24-397) of ICR24-397

Therefore, whether the plant sample is derived from the transgenic cotton ICR24-397 or the progeny thereof can be detected or assisted by the following method:

carrying out PCR amplification on the genome DNA of the plant sample by using the primer pair 1 and/or the primer pair 2 to obtain a PCR amplification product, and detecting the PCR amplification product;

if the size of the amplification product of the primer pair 1 is 950bp or the size of the amplification product of the primer pair 2 is 800bp, the plant sample is or is selected as the transgenic cotton ICR24-397 or the progeny thereof; otherwise the plant sample is not, or is not candidate for being, transgenic cotton ICR24-397 or progeny thereof.

The primer pair 1 consists of a single-stranded DNA molecule shown in SEQ ID NO.5 and a single-stranded DNA molecule shown in SEQ ID NO. 6;

the primer pair 2 consists of a single-stranded DNA molecule shown in SEQ ID NO.7 and a single-stranded DNA molecule shown in SEQ ID NO. 8.

Sequence listing

<110> Cotton research institute of Chinese academy of agricultural sciences

<120> upland cotton transformation event ICR24-397 and method for identifying specificity thereof

<160>8

<170>PatentIn version 3.5

<210>1

<211>4445

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240

cttatctggg aactactcac acattattat ggagaaactc gagcttgtcg atcgacagat 300

ccggtcggca tctactttag gcggtagcct cagcgtattc gaatctagca ccaagagctt 360

caaggtgagc gaagaactga gggtaggact ttctgatgtg gtgtgcaccg gtgattctaa 420

gtggagcatc tgctctgaga ccaagaaggg tgagaagcat gatcattctg tggtcaccgt 480

gaccatcagc ggtgatacca ccagcaaggt gagcagaacc agtaacggag agagaatcgg 540

cggtctctct tgctctaaga ccaagtcttt caagctcagc tctggtgtca gagattctat 600

cgcattcctt gagtctaaga gtagcaacgt tttcccaggt ggtatcaccc tcagcgaagg 660

cagcagcagc ggtaagagct tgcacggcgt cggtgaagga atcaccatct ctagtaacag 720

cgtggagagg tctaccacct ctcacggtaa gggtatcacc ttctctaacg atatcagcac 780

ccatctctct aagaacgttc acagcttcct tctcaccctg gaggtcgtgt tctctaaggt 840

tagaaagtct aacctcacct gggagaagag cagcggcggt aaggatagca gcggaaccag 900

ggtaatcacc aggaacgagc actctacctg gtctgtactt ctgaccacca gggatggaga 960

ttcttctaag gtcatcggag gcagtagctc taacaccgaa atcagagagg gtgtcaagtg 1020

tctgtctaag aggagcgtgg gacttgatat caccggtgag tctaagttcg agtccgtcag 1080

gaagaagagg accgaggaac ataagggcgg aagcgtactg ggaggatctt tcggcggaaa 1140

cctccactgt accacctcta actggaccgg aaacggagat agggagtcta ccatcgttgg 1200

aggacaccca agcaccaagt ctttcgaggg cttcaagaag gtcaccctga ggtctcttac 1260

caagggaatc agggtaatcg gtaacgaaag ttgtaccaga ggtgagagca gcaacaccca 1320

taaggaatct ggccactgca ccagcgttac ctgggttaag ggtaacacca gcctgtggtc 1380

tagcaccgaa acctctgatc acggcgtcat caccaacaag ctcaacacca gcaccccaat 1440

ctctgaggca tctgagcata gcttcggcat cctcagaggt agccacacca acaactctgg 1500

tttcaccctc agcgagagca gcggcgagga ggtatctagt ggtgtagttc ttggatggct 1560

gtgctctaag ttcacctctg agttctctag ctggatgcac gataacgtcg aaggtagctg 1620

gaagagcgtc ggatcccttc tccgccgtgg aaacagaaga catgacctta agaggacgaa 1680

gctcagagcc aattaaagtc atcccactct tcttcaatcc ccacgatgaa gaaattggat 1740

aagctcgtgg atgctgctga gtcttcagag aaaccgataa gggagatttc ctttgactgg 1800

atttagagag attggagata agagatgggt tctgcacacc attgcagatt ctgctaactt 1860

gagccatatc tcattgcccc ccgggatctg cgaaagctcg agagagatag atttgtagag 1920

agagactggt gatttcagcg tgtcctctcc aaatgaaatg aacttcctta tatagaggaa 1980

ggtcttgcga aggatagtgg gattgtgcgt catcccttac gtcagtggag atatcacatc 2040

aatccacttg ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg 2100

gtgggggtcc atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt 2160

tatcgcaatg atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt 2220

gacagatagc tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag 2280

tctcaatagc cctttggtct tctgagactg tatctttgat attcttggag tagacgagag 2340

tgtcgtgctc caccatgtta tcacatcaat ccacttgctt tgaagacgtg gttggaacgt 2400

cttctttttc cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag 2460

aggcatcttg aacgatagcc tttcctttat cgcaatgatg gcatttgtag gtgccacctt 2520

ccttttctac tgtccttttg atgaagtgac agatagctgg gcaatggaat ccgaggaggt 2580

ttcccgatat taccctttgt tgaaaagtct caatagccct ttggtcttct gagactgtat 2640

ctttgatatt cttggagtag acgagagtgt cgtgctccac catgttggca agctgctcta 2700

gccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga 2760

caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac 2820

tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt 2880

gagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat tctgatagtt 2940

taattcccga tctagtaaca tagatgacac cgcgcgcgat aatttatcct agtttgcgcg 3000

ctatattttg ttttctatcg cgtattaaat gtataattgc gggactctaa tcataaaaac 3060

ccatctcata aataacgtca tgcattacat gttaattatt acatgcttaa cgtaattcaa 3120

cagaaattat atgataatca tcgcaagacc ggcaacagga ttcaatctta agaaacttta 3180

ttgccaaatg tttgaacgat cggggaaatt cgagctggtc accctctcat ggtataagtt 3240

ccattgagac catcgatagc tgccatggcc gtctctttgc ttgaatattt aacaaacccg 3300

catccacgac tctgtctata ttcatcacgc atgagataga catcctccac gcgaccaaat 3360

tgcaaaaaga gctcctcaac ctcgttttca gtggcttgct tgtttaagga accaacaaaa 3420

agcagatcta ccatggtcaa gagtcccccg tgttctctcc aaatgaaatg aacttcctta 3480

tatagaggaa gggtcttgcg aaggatagtg ggattgtgcg tcatccctta cgtcagtgga 3540

gatatcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat 3600

gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttcaacgat 3660

ggcctttcct ttatcgcaat gatggcattt gtaggagcca ccttcctttt ccactatctt 3720

cacaataaag tgacagatag ctgggcaatg gaatccgagg aggtttccgg atattaccct 3780

ttgttgaaaa gtctcaattg ccctttggtc ttctgagact gtatctttga tatttttgga 3840

gtagacaagt gtgtcgtgct ccaccatgtt gacgaagatt ttcttcttgt cattgagtcg 3900

taagagactc tgtatgaact gttcgccagt ctttacggcg agttctgtta ggtcctctat 3960

ttgaatcttt gactccatga agctaaactg aaggcgggaa acgacaatct gatccaagct 4020

caagctgctc tagcattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 4080

ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 4140

ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg ccaagcttgg 4200

cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 4260

gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 4320

gcccttccca acagttgcgc agcctgaatg gcgaatgcta gagcagcttg agcttggatc 4380

agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt tgacaggata tattggcggg 4440

taaac 4445

<210>2

<211>2001

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ttccatcaga atactcaaaa atataaggaa cagttggaac agtggaaatg acatgagctt 60

catgctccta cgtccataat acaaactgtt atgacatgca aatagagaaa gaatattttt 120

ctaaaggaaa aaatggggaa aattacctgt tcaagtcttt gatgaaaaac atccatgtga 180

agtaagccta aaaacccaca cctgcaggag gaatacagga gacgcactac aaattattcc 240

attataacaa tgcaagtctc cataattaaa tagtagaaga aaactgtttg actattggta 300

cttagagata agtcacaaaa tataagacag cacacctaaa acccagtcca agtgctgtgc 360

tactctcctt agtaatagag acgctggcat cattgcatgt tagtctctct atagcatggt 420

taagtgcatc aaaatcagat ccatctgcag gatagagacc agaaaacacc atatgttttg 480

cgggtttgaa acctgcgatt tagaagcata gcaaatataa aaaaagggtg tctattttga 540

ataaaaaagg aaataggaag tacagtgtat caaaaaataa caaaagatga agcctgatga 600

tataccggga aggggctcta cagtagcccg agtgtgatat agcgtgtccc caatacgcgc 660

ctcttttgtg gaacgcatgc cagtcaccac atatccaact tgaccactta gaaggactcc 720

agtgggagta agttctggat gcatgatccc aatatccaac acttcataag tttgaccagt 780

tgcagcagac gaaatcttat cacctttacg taatgcacca tcaacagcgg caacatggca 840

aattacacct ttgtattcat cataatagga atccaacaga agcatacgta aaggtgaact 900

gctgcttcca ggagggggag gaatcctctc tatgactgct ggaaggacat gctcaagccc 960

ctgccctgtt ttagcagatg ttaaaagggc atcactaggg tcaagatcaa acattgattt 1020

taactgagct ttgacacgat cagggtcagc agtaggctgg tcaatcttgt ttatgacagg 1080

gattatagtc aggttagatt caaaagcgag ataaaaattt gcaacagttt gcgcttgaac 1140

accttgggct gcatcaacaa ccaaaagagc accttggcaa gctgccagag atctagacac 1200

ctcataactg aagtccacat gtcccggtgt gtcgatcaga tttagcagaa acgttgatgg 1260

ttcatcaata ttaccatcat tgcatccatg gagcttgtat ttgtggaaca tagtcgccgt 1320

ttgagcttta actgttattc ccctttctct ctctacctaa taacatcaga aaaattatca 1380

tcaagtttac acctttaaac caaagctaaa ctcaatcctt tcgttttctt ttttacaatg 1440

taaaccaaat taacgttcat atgaaaaaat aacaaaaacc cgattctagt ttctctttaa 1500

acaataattg caatgtcaat agctggcctt ttcatcaact tctcaaaact aagaaccatt 1560

tcaaaagcaa taaaaaatct ttaaaaaacc acgcacacac atttcaggtc ttaatccaaa 1620

taaagaagtt ttaatctaaa caataaaatt tacctgtaac ttgtcaagat actgaggctg 1680

accgtggcct ctcttaatgg tcccagtaag ctctaacagt ctatcagcta aagtagactt 1740

tccatgatca acatgggcta taattgaaaa gttcctaatt ttttcaattg ggtatcgact 1800

caaatctatt ggagcagatt ctttgctgtt ttgacgagaa tgagagcaaa atctttgact 1860

taatccaaaa gcatcaaatg ggttgttgat tgaataaaag ggagataagt attttcgagg 1920

tttaagggtt tttgaagctc tgaataagga acccatttga gggttttaga gagctttgcg 1980

ggagagagag agagaacgat g 2001

<210>3

<211>2001

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

actttgaaaa tttgaggcta aattcttatt tggtcaccca attttttgga aaattttata 60

tcagtcactt caaatgaaac ccttacaatt tggtcactta acttttaggt cgctttcatt 120

tttagtcact caagcgttaa atctctaact tcagttagtc gtacacacta aatcatgttt 180

atactttcat tttggtcacc taatttttag gttgttttca ttttggtcac tcaaaaaaaa 240

aattttaagt attgattgga gtaaaaaaaa tcaaaaatta aagtgaaaaa aggtagaaat 300

taaaataaaa tacaaaaaat tgtcaaattg tacttgttta tcctattttc aggtctaaat 360

ttttttaaat taaaatatta aatttcaaaa cattaaaata aattgaataa atttttgaaa 420

ttttgtattc attactgaat cgatttgtta ttataatatt aaaattaatt agtttattct 480

cattttaaat tttaaaatta tattttatat ttcgagatta tccttaataa aatcaactca 540

ctgacctcat atttaataat tgtttacgaa acttaaaatt ttgttgatta cataatcttg 600

aatctttcat gctaagctaa aagtaaagga aaatatactt gtaattaatt aaattaattg 660

tttgttcttt gtttgggtaa agaagtgatg aaaaattatg agttttgttt gggtaaaaat 720

catgaggtgt agtgttgtgg ttgctctccg catctcttaa ccatgatgtt ggaggttcga 780

tcttcatcta tgggaatgga gcacatttca tacctcttca gagagcacct gcaacaaagt 840

agtcattact actggcgatg gacaccttag tttcgaccaa aaagaaaagg aagtgatgaa 900

aaaaattatg agtttttcac tttaattctt tgttatttag tttctaccat tttttcactt 960

taatctttga tttttttttt actccactca atacttaaaa aaatatattt taggtgacca 1020

aaatgaaagt gtaaatatga tgtgatgtgt acagttgacc gttgttaaag atttaacgtt 1080

tagtgattaa aatgaaagca ccctaaaaat taggtgatca aattacaaga atctcatttt 1140

ggatgaccaa aataaaagca ccgagtaact agctaaacaa attactttaa attgaaatat 1200

gaaaatataa aatattttta ataataaaac acctactaaa ttagcctaaa atatgatttt 1260

caaaacattg gtgtgcattt ggaaaattct agaaaaatct attcatgagt tgaagaaaat 1320

ttttacattg agttgagaat caacaataca acatatattt agaaagcata aaaatcataa 1380

atttgttaga ttcatacaac aatccatcta attaagtttg aatccaaatt gaaaatttac 1440

atcaatcttt aataaatatt aaaattaacc tttaattaaa taatagcgtc cgaacacttg 1500

ttcctttttt gaaatatatc ttaaaaccat agcagcaagg agcatcctgc attcatcaat 1560

aagccgagat aaaatagaat tacataactt cacattagga taatagttat ggcatctatt 1620

ccagggttcc caaatgaaga cccgtcggta ttgaatttga aacaaccaag agctggagga 1680

acccaatgga aatttaatag aagatgccaa agcaaaaaac tcaccagcac ctttagttgc 1740

tcttttaatc aaaccctcaa tttgtcttta gccaccgaaa ataaaagcat tgcattgtag 1800

ctagattttg cagagaatga ctcaaaattt atttttactt gtgtgtttga tttgtggtta 1860

ttcgaattca tatttagatc gattcatagt atgagaataa cagagaagat cgttcgattg 1920

aaagctagaa ttattgctat aaatatcaca aatcatttga tctttaaatt tttaattttc 1980

acaaaaaaaa ttattttaaa t 2001

<210>4

<211>10698

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240

cttatctggg aactactcac acattattat ggagaaactc gagcttgtcg atcgacagat 300

ccggtcggca tctactttag gcggtagcct cagcgtattc gaatctagca ccaagagctt 360

caaggtgagc gaagaactga gggtaggact ttctgatgtg gtgtgcaccg gtgattctaa 420

gtggagcatc tgctctgaga ccaagaaggg tgagaagcat gatcattctg tggtcaccgt 480

gaccatcagc ggtgatacca ccagcaaggt gagcagaacc agtaacggag agagaatcgg 540

cggtctctct tgctctaaga ccaagtcttt caagctcagc tctggtgtca gagattctat 600

cgcattcctt gagtctaaga gtagcaacgt tttcccaggt ggtatcaccc tcagcgaagg 660

cagcagcagc ggtaagagct tgcacggcgt cggtgaagga atcaccatct ctagtaacag 720

cgtggagagg tctaccacct ctcacggtaa gggtatcacc ttctctaacg atatcagcac 780

ccatctctct aagaacgttc acagcttcct tctcaccctg gaggtcgtgt tctctaaggt 840

tagaaagtct aacctcacct gggagaagag cagcggcggt aaggatagca gcggaaccag 900

ggtaatcacc aggaacgagc actctacctg gtctgtactt ctgaccacca gggatggaga 960

ttcttctaag gtcatcggag gcagtagctc taacaccgaa atcagagagg gtgtcaagtg 1020

tctgtctaag aggagcgtgg gacttgatat caccggtgag tctaagttcg agtccgtcag 1080

gaagaagagg accgaggaac ataagggcgg aagcgtactg ggaggatctt tcggcggaaa 1140

cctccactgt accacctcta actggaccgg aaacggagat agggagtcta ccatcgttgg 1200

aggacaccca agcaccaagt ctttcgaggg cttcaagaag gtcaccctga ggtctcttac 1260

caagggaatc agggtaatcg gtaacgaaag ttgtaccaga ggtgagagca gcaacaccca 1320

taaggaatct ggccactgca ccagcgttac ctgggttaag ggtaacacca gcctgtggtc 1380

tagcaccgaa acctctgatc acggcgtcat caccaacaag ctcaacacca gcaccccaat 1440

ctctgaggca tctgagcata gcttcggcat cctcagaggt agccacacca acaactctgg 1500

tttcaccctc agcgagagca gcggcgagga ggtatctagt ggtgtagttc ttggatggct 1560

gtgctctaag ttcacctctg agttctctag ctggatgcac gataacgtcg aaggtagctg 1620

gaagagcgtc ggatcccttc tccgccgtgg aaacagaaga catgacctta agaggacgaa 1680

gctcagagcc aattaaagtc atcccactct tcttcaatcc ccacgatgaa gaaattggat 1740

aagctcgtgg atgctgctga gtcttcagag aaaccgataa gggagatttc ctttgactgg 1800

atttagagag attggagata agagatgggt tctgcacacc attgcagatt ctgctaactt 1860

gagccatatc tcattgcccc ccgggatctg cgaaagctcg agagagatag atttgtagag 1920

agagactggt gatttcagcg tgtcctctcc aaatgaaatg aacttcctta tatagaggaa 1980

ggtcttgcga aggatagtgg gattgtgcgt catcccttac gtcagtggag atatcacatc 2040

aatccacttg ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg 2100

gtgggggtcc atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt 2160

tatcgcaatg atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt 2220

gacagatagc tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag 2280

tctcaatagc cctttggtct tctgagactg tatctttgat attcttggag tagacgagag 2340

tgtcgtgctc caccatgtta tcacatcaat ccacttgctt tgaagacgtg gttggaacgt 2400

cttctttttc cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag 2460

aggcatcttg aacgatagcc tttcctttat cgcaatgatg gcatttgtag gtgccacctt 2520

ccttttctac tgtccttttg atgaagtgac agatagctgg gcaatggaat ccgaggaggt 2580

ttcccgatat taccctttgt tgaaaagtct caatagccct ttggtcttct gagactgtat 2640

ctttgatatt cttggagtag acgagagtgt cgtgctccac catgttggca agctgctcta 2700

gccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga 2760

caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac 2820

tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt 2880

gagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat tctgatagtt 2940

taattcccga tctagtaaca tagatgacac cgcgcgcgat aatttatcct agtttgcgcg 3000

ctatattttg ttttctatcg cgtattaaat gtataattgc gggactctaa tcataaaaac 3060

ccatctcata aataacgtca tgcattacat gttaattatt acatgcttaa cgtaattcaa 3120

cagaaattat atgataatca tcgcaagacc ggcaacagga ttcaatctta agaaacttta 3180

ttgccaaatg tttgaacgat cggggaaatt cgagctggtc accctctcat ggtataagtt 3240

ccattgagac catcgatagc tgccatggcc gtctctttgc ttgaatattt aacaaacccg 3300

catccacgac tctgtctata ttcatcacgc atgagataga catcctccac gcgaccaaat 3360

tgcaaaaaga gctcctcaac ctcgttttca gtggcttgct tgtttaagga accaacaaaa 3420

agcagatcta ccatggtcaa gagtcccccg tgttctctcc aaatgaaatg aacttcctta 3480

tatagaggaa gggtcttgcg aaggatagtg ggattgtgcg tcatccctta cgtcagtgga 3540

gatatcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat 3600

gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttcaacgat 3660

ggcctttcct ttatcgcaat gatggcattt gtaggagcca ccttcctttt ccactatctt 3720

cacaataaag tgacagatag ctgggcaatg gaatccgagg aggtttccgg atattaccct 3780

ttgttgaaaa gtctcaattg ccctttggtc ttctgagact gtatctttga tatttttgga 3840

gtagacaagt gtgtcgtgct ccaccatgtt gacgaagatt ttcttcttgt cattgagtcg 3900

taagagactc tgtatgaact gttcgccagt ctttacggcg agttctgtta ggtcctctat 3960

ttgaatcttt gactccatga agctaaactg aaggcgggaa acgacaatct gatccaagct 4020

caagctgctc tagcattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 4080

ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 4140

ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg ccaagcttgg 4200

cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 4260

gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 4320

gcccttccca acagttgcgc agcctgaatg gcgaatgcta gagcagcttg agcttggatc 4380

agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt tgacaggata tattggcggg 4440

taaacctaag agaaaagagc gtttattaga ataacggata tttaaaaggg cgtgaaaagg 4500

tttatccgtt cgtccatttg tatgtgcatg ccaaccacag ggttcccctc gggatcaaag 4560

tactttgatc caacccctcc gctgctatag tgcagtcggc ttctgacgtt cagtgcagcc 4620

gtcttctgaa aacgacatgt cgcacaagtc ctaagttacg cgacaggctg ccgccctgcc 4680

cttttcctgg cgttttcttg tcgcgtgttt tagtcgcata aagtagaata cttgcgacta 4740

gaaccggaga cattacgcca tgaacaagag cgccgccgct ggcctgctgg gctatgcccg 4800

cgtcagcacc gacgaccagg acttgaccaa ccaacgggcc gaactgcacg cggccggctg 4860

caccaagctg ttttccgaga agatcaccgg caccaggcgc gaccgcccgg agctggccag 4920

gatgcttgac cacctacgcc ctggcgacgt tgtgacagtg accaggctag accgcctggc 4980

ccgcagcacc cgcgacctac tggacattgc cgagcgcatc caggaggccg gcgcgggcct 5040

gcgtagcctg gcagagccgt gggccgacac caccacgccg gccggccgca tggtgttgac 5100

cgtgttcgcc ggcattgccg agttcgagcg ttccctaatc atcgaccgca cccggagcgg 5160

gcgcgaggcc gccaaggccc gaggcgtgaa gtttggcccc cgccctaccc tcaccccggc 5220

acagatcgcg cacgcccgcg agctgatcga ccaggaaggc cgcaccgtga aagaggcggc 5280

tgcactgctt ggcgtgcatc gctcgaccct gtaccgcgca cttgagcgca gcgaggaagt 5340

gacgcccacc gaggccaggc ggcgcggtgc cttccgtgag gacgcattga ccgaggccga 5400

cgccctggcg gccgccgaga atgaacgcca agaggaacaa gcatgaaacc gcaccaggac 5460

ggccaggacg aaccgttttt cattaccgaa gagatcgagg cggagatgat cgcggccggg 5520

tacgtgttcg agccgcccgc gcacgtctca accgtgcggc tgcatgaaat cctggccggt 5580

ttgtctgatg ccaagctggc ggcctggccg gccagcttgg ccgctgaaga aaccgagcgc 5640

cgccgtctaa aaaggtgatg tgtatttgag taaaacagct tgcgtcatgc ggtcgctgcg 5700

tatatgatgc gatgagtaaa taaacaaata cgcaagggga acgcatgaag gttatcgctg 5760

tacttaacca gaaaggcggg tcaggcaaga cgaccatcgc aacccatcta gcccgcgccc 5820

tgcaactcgc cggggccgat gttctgttag tcgattccga tccccagggc agtgcccgcg 5880

attgggcggc cgtgcgggaa gatcaaccgc taaccgttgt cggcatcgac cgcccgacga 5940

ttgaccgcga cgtgaaggcc atcggccggc gcgacttcgt agtgatcgac ggagcgcccc 6000

aggcggcgga cttggctgtg tccgcgatca aggcagccga cttcgtgctg attccggtgc 6060

agccaagccc ttacgacata tgggccaccg ccgacctggt ggagctggtt aagcagcgca 6120

ttgaggtcac ggatggaagg ctacaagcgg cctttgtcgt gtcgcgggcg atcaaaggca 6180

cgcgcatcgg cggtgaggtt gccgaggcgc tggccgggta cgagctgccc attcttgagt 6240

cccgtatcac gcagcgcgtg agctacccag gcactgccgc cgccggcaca accgttcttg 6300

aatcagaacc cgagggcgac gctgcccgcg aggtccaggc gctggccgct gaaattaaat 6360

caaaactcat ttgagttaat gaggtaaaga gaaaatgagc aaaagcacaa acacgctaag 6420

tgccggccgt ccgagcgcac gcagcagcaa ggctgcaacg ttggccagcc tggcagacac 6480

gccagccatg aagcgggtca actttcagtt gccggcggag gatcacacca agctgaagat 6540

gtacgcggta cgccaaggca agaccattac cgagctgcta tctgaataca tcgcgcagct 6600

accagagtaa atgagcaaat gaataaatga gtagatgaat tttagcggct aaaggaggcg 6660

gcatggaaaa tcaagaacaa ccaggcaccg acgccgtgga atgccccatg tgtggaggaa 6720

cgggcggttg gccaggcgta agcggctggg ttgtctgccg gccctgcaat ggcactggaa 6780

cccccaagcc cgaggaatcg gcgtgacggt cgcaaaccat ccggcccggt acaaatcggc 6840

gcggcgctgg gtgatgacct ggtggagaag ttgaaggccg cgcaggccgc ccagcggcaa 6900

cgcatcgagg cagaagcacg ccccggtgaa tcgtggcaag cggccgctga tcgaatccgc 6960

aaagaatccc ggcaaccgcc ggcagccggt gcgccgtcga ttaggaagcc gcccaagggc 7020

gacgagcaac cagatttttt cgttccgatg ctctatgacg tgggcacccg cgatagtcgc 7080

agcatcatgg acgtggccgt tttccgtctg tcgaagcgtg accgacgagc tggcgaggtg 7140

atccgctacg agcttccaga cgggcacgta gaggtttccg cagggccggc cggcatggcc 7200

agtgtgtggg attacgacct ggtactgatg gcggtttccc atctaaccga atccatgaac 7260

cgataccggg aagggaaggg agacaagccc ggccgcgtgt tccgtccaca cgttgcggac 7320

gtactcaagt tctgccggcg agccgatggc ggaaagcaga aagacgacct ggtagaaacc 7380

tgcattcggt taaacaccac gcacgttgcc atgcagcgta cgaagaaggc caagaacggc 7440

cgcctggtga cggtatccga gggtgaagcc ttgattagcc gctacaagat cgtaaagagc 7500

gaaaccgggc ggccggagta catcgagatc gagctagctg attggatgta ccgcgagatc 7560

acagaaggca agaacccgga cgtgctgacg gttcaccccg attacttttt gatcgatccc 7620

ggcatcggcc gttttctcta ccgcctggca cgccgcgccg caggcaaggc agaagccaga 7680

tggttgttca agacgatcta cgaacgcagt ggcagcgccg gagagttcaa gaagttctgt 7740

ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg agtacgattt gaaggaggag 7800

gcggggcagg ctggcccgat cctagtcatg cgctaccgca acctgatcga gggcgaagca 7860

tccgccggtt cctaatgtac ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa 7920

ggtcgaaaag gtctctttcc tgtggatagc acgtacattg ggaacccaaa gccgtacatt 7980

gggaaccgga acccgtacat tgggaaccca aagccgtaca ttgggaaccg gtcacacatg 8040

taagtgactg atataaaaga gaaaaaaggc gatttttccg cctaaaactc tttaaaactt 8100

attaaaactc ttaaaacccg cctggcctgt gcataactgt ctggccagcg cacagccgaa 8160

gagctgcaaa aagcgcctac ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt 8220

cggcctatcg cggccgctgg ccgctcaaaa atggctggcc tacggccagg caatctacca 8280

gggcgcggac aagccgcgcc gtcgccactc gaccgccggc gcccacatca aggcaccctg 8340

cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt 8400

cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg 8460

tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac 8520

tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa 8580

ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc 8640

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 8700

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 8760

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 8820

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 8880

ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 8940

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 9000

agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 9060

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 9120

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 9180

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 9240

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 9300

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 9360

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 9420

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgca ttctaggtac 9480

taaaacaatt catccagtaa aatataatat tttattttct cccaatcagg cttgatcccc 9540

agtaagtcaa aaaatagctc gacatactgt tcttccccga tatcctccct gatcgaccgg 9600

acgcagaagg caatgtcata ccacttgtcc gccctgccgc ttctcccaag atcaataaag 9660

ccacttactt tgccatcttt cacaaagatg ttgctgtctc ccaggtcgcc gtgggaaaag 9720

acaagttcct cttcgggctt ttccgtcttt aaaaaatcat acagctcgcg cggatcttta 9780

aatggagtgt cttcttccca gttttcgcaa tccacatcgg ccagatcgtt attcagtaag 9840

taatccaatt cggctaagcg gctgtctaag ctattcgtat agggacaatc cgatatgtcg 9900

atggagtgaa agagcctgat gcactccgca tacagctcga taatcttttc agggctttgt 9960

tcatcttcat actcttccga gcaaaggacg ccatcggcct cactcatgag cagattgctc 10020

cagccatcat gccgttcaaa gtgcaggacc tttggaacag gcagctttcc ttccagccat 10080

agcatcatgt ccttttcccg ttccacatca taggtggtcc ctttataccg gctgtccgtc 10140

atttttaaat ataggttttc attttctccc accagcttat ataccttagc aggagacatt 10200

ccttccgtat cttttacgca gcggtatttt tcgatcagtt ttttcaattc cggtgatatt 10260

ctcattttag ccatttatta tttccttcct cttttctaca gtatttaaag ataccccaag 10320

aagctaatta taacaagacg aactccaatt cactgttcct tgcattctaa aaccttaaat 10380

accagaaaac agctttttca aagttgtttt caaagttggc gtataacata gtatcgacgg 10440

agccgatttt gaaaccgcgg tgatcacagg cagcaacgct ctgtcatcgt tacaatcaac 10500

atgctaccct ccgcgagatc atccgtgttt caaacccggc agcttagttg ccgttcttcc 10560

gaatagcatc ggtaacatga gcaaagtctg ccgccttaca acggctctcc cgctgacgcc 10620

gtcccggact gatgggctgc ctgtatcgag tggtgatttt gtgccgagct gccggtcggg 10680

gagctgttgg ctggctgg 10698

<210>5

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

cgcacacaca tttcaggtc 19

<210>6

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gccgattctc tctccgtta 19

<210>7

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gtttcccgcc ttcagttt 18

<210>8

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

caaccacaac actacacctc at 22

Claims (3)

1. The method for detecting or assisting in detecting whether a plant sample to be detected is transgenic cotton or progeny thereof comprises the following steps: detecting whether the genome DNA of the plant sample to be detected contains a DNA fragment A or not,

the DNA fragment A sequentially consists of a left flank sequence, an exogenous DNA fragment and a right flank sequence;

if the genomic DNA of the plant sample to be detected contains the DNA fragment A, the plant sample to be detected is or is selected as the transgenic cotton or the descendant thereof;

if the genomic DNA of the plant sample to be tested does not contain the DNA fragment A, the plant sample to be tested is not or is not candidate to be the transgenic cotton or the descendant thereof;

the transgenic cotton is obtained by cultivating the following steps:

replacing a fragment with the size of 122bp between the 7000726-7000849 sites of the chromosome A09 of a target cotton genome with an exogenous DNA fragment to obtain transgenic cotton;

the exogenous DNA fragment is a DNA molecule containing csRRM2 gene;

the fiber quality of the transgenic cotton is higher than that of the target cotton;

the nucleotide sequence of the exogenous DNA fragment is shown as SEQ ID NO. 1;

the left flanking sequence is shown in SEQ ID NO. 2;

the right flanking sequence is shown in SEQ ID NO. 3.

2. The method of claim 1, further comprising: the target cotton is upland cotton CCRI 24.

3. The method according to claim 1 or 2, characterized in that: the method is 1) or 2) as follows:

1) direct sequencing;

2) carrying out PCR amplification on the genome DNA of the plant sample to be detected by using a primer pair A and/or a primer pair B, detecting the size of an amplification product, and if a strip with the size of 950bp is obtained by amplifying the primer pair A or a strip with the size of 800bp is obtained by amplifying the primer pair B, determining that the plant sample to be detected is or is a candidate of the transgenic cotton or a descendant thereof; otherwise, the plant sample to be tested is not or is not a candidate for the transgenic cotton or progeny thereof;

the primer pair A consists of a single-stranded DNA molecule shown in SEQ ID NO.5 and a single-stranded DNA molecule shown in SEQ ID NO. 6;

the primer pair B consists of a single-stranded DNA molecule shown in SEQ ID NO.7 and a single-stranded DNA molecule shown in SEQ ID NO. 8.

Images