CN109265562B - Nicking enzyme and application thereof in genome base replacement - Google Patents

Nicking enzyme and application thereof in genome base replacement Download PDF

Info

Publication number
CN109265562B
CN109265562B CN201811122909.9A CN201811122909A CN109265562B CN 109265562 B CN109265562 B CN 109265562B CN 201811122909 A CN201811122909 A CN 201811122909A CN 109265562 B CN109265562 B CN 109265562B
Authority
CN
China
Prior art keywords
lys
leu
glu
asp
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811122909.9A
Other languages
Chinese (zh)
Other versions
CN109265562A (en
Inventor
杨进孝
杨永星
吕欣欣
赵思
冯峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Academy of Agriculture and Forestry Sciences
Original Assignee
Beijing Academy of Agriculture and Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Academy of Agriculture and Forestry Sciences filed Critical Beijing Academy of Agriculture and Forestry Sciences
Priority to CN201811122909.9A priority Critical patent/CN109265562B/en
Publication of CN109265562A publication Critical patent/CN109265562A/en
Application granted granted Critical
Publication of CN109265562B publication Critical patent/CN109265562B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04001—Cytosine deaminase (3.5.4.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a nicking enzyme and application thereof in genome base replacement. According to the invention, nicking enzyme HypaCas9n and PmCDA1 and UGI are fused for the first time to construct a base editing system, and the finding shows that the detrargeting efficiency can be reduced under the condition that the C.T base replacement efficiency is not influenced basically compared with HypACas9n & PmCDA1& UGI and SpCas9n & PmCDA1& UGI.

Description

Nicking enzyme and application thereof in genome base replacement
Technical Field
The invention relates to a nicking enzyme and application thereof in genome base replacement.
Background
The emergence and development of the CRISPR-Cas9(the clustered differentiated short palindromic repeats-CRISPR-associated protein 9) technology has become a powerful genome editing means, and is widely applied to many tissues and cells. The CRISPR/Cas9 protein-RNA complex is localized on the target by a guide RNA (guide RNA), cleaved to generate a DNA Double Strand Break (DSB), and the organism will then instigate a DNA repair mechanism to repair the DSB. There are generally two repair mechanisms, one is non-homologous end joining (NHEJ) and one is homologous recombination (HDR), and NHEJ repair usually accounts for the majority, so repair produces random indels (insertions or deletions) much higher than precise repair. For base exact substitution, the application of using HDR to achieve base exact substitution is greatly limited because of the low efficiency of HDR and the need for a DNA template.
In 2016, two laboratories such as David Liu and Akihiko Kondo independently report two different types of Cytosine Base Editors (CBE) respectively, and the principle is that a single C (Cytosine) base is directly edited by using cytidine deaminase, and the base editing efficiency of C to T (Thymine) is greatly improved by generating DSB and initiating HDR repair. PmcDA1(activation-induced cytidine deaminase (AID) orthogonal from sea layout) is one type of cytidine deaminase used therein. In the tested PmCDA1 editor, the average mutation rate of the SpCas9n (D10A) & PmCDA1& UGI (Uracil DNA glucoamylase inhibitor) base editing system was higher, firstly because UGI can inhibit UDG (Uracil DNA glucoamylase) from catalyzing and eliminating U (Uracil) in DNA, and secondly because SpCas9n (D10A) nicks on the non-editing strand, inducing eukaryotic mismatch repair mechanism or long-patch BER (base-evolution repair) repair mechanism, promoting more preferential repair of U: G mismatch to U: a. SpCas9n (D10A) is positioned to a target point through sgRNA together with PmCDA1, PmCDA1 catalyzes C on unpaired single-stranded DNA to generate cytosine deamination reaction to become U, U is paired with A (Adenine and Adenine) through DNA repair, and finally T is paired with A through DNA replication, so that conversion from C to T is realized.
The gene group editing using SpCas9 in plants has a certain off-target effect, and the fusion of SpCas9n (D10A) and PmCDA1 is used for base editing, namely, the potential off-target risk can exist when the SpCas9n (D10A) & PmCDA1& UGI base editing system is used. Although plants differ from animals in that off-target sites can be removed by genetic segregation in later generations, it is difficult to purposefully remove them in later generations, since some potential off-target sites may not be known. Therefore, reducing off-target effects is also a long-standing technical direction in plants.
Disclosure of Invention
The invention aims to provide a nicking enzyme and application thereof in genome base replacement.
The invention provides a fusion protein which comprises nickase, cytosine nucleoside deaminase PmCDA1 and uracil DNA glucoamylase inhibitor UGI; the nicking enzyme is shown as amino acids from 1 st to 1423 rd positions of the N end of a sequence 13 in a sequence table.
The cytosine nucleoside deaminase PmCDA1 is shown as amino acid from 1521-1728 th site of the N end of the sequence 13 in the sequence table.
The uracil DNA glucoamylase inhibitor UGI is shown as the amino acid at the 1736-1833 th site from the N end of the sequence 13 in the sequence table.
The invention also protects the coding gene of the fusion protein.
The encoding gene of the fusion protein can be specifically shown as 1721-7222 th from the 5' end of sequence 2 in the sequence table (wherein, the 1721-5989 th is the encoding gene of nicking enzyme, the 6281-6904 th is the encoding gene of cytosine nucleoside deaminase PmCDA1, and the 6926-7222 th is the encoding gene of uracil DNA glucoamylase inhibitor UGI).
The invention also provides a base editing system comprising the fusion protein.
The system also includes a sgRNA.
The nucleotide sequence of the sgRNA is shown in sequence 1 of the sequence table from 571-646 of the 5' end.
The invention also protects a recombinant expression vector, an expression cassette, a recombinant cell or a recombinant bacterium for expressing the base editing system. The expression cassette for expressing the fusion protein may specifically be expression cassette a. The expression cassette for expressing the sgRNA may specifically be expression cassette b.
The invention also discloses a recombinant expression vector for genome base replacement, which comprises an expression cassette A and an expression cassette B; the expression cassette A expresses the fusion protein; the expression cassette B comprises n elements B; the element b comprises sgRNA and a target sequence; the recombinant expression vector can target n different target sequences for base substitution.
The nucleotide sequence of the sgRNA is shown in sequence 1 of the sequence table from 571-646 of the 5' end.
The element B also includes a pre-tRNA. The nucleotide sequence of the pre-tRNA is shown as the 474-550 th position from the 5' end of the sequence 1 in the sequence table. The element B is provided with a pre-tRNA, a target sequence and a nucleotide sequence of sgRNA from the 5' end in sequence.
The expression cassette A is expressed by a promoter A to start a coding gene of nickase, a coding gene of cytosine nucleoside deaminase PmCDA1 and a coding gene of uracil DNA glucoamylase inhibitor UGI. The expression cassette A sequentially comprises a promoter A, a coding gene of nicking enzyme, a coding gene of cytosine nucleoside deaminase PmCDA1, a coding gene of uracil DNA glucoamylase inhibitor UGI and a terminator A from the 5' end. The promoter A can be an OsUbq3 promoter. The nucleotide sequence of the OsUbq3 promoter is shown as 1-1714 th from 5' end of a sequence 2 in a sequence table. The terminator A can be a CaMV35S terminator. The nucleotide sequence of the CaMV35S terminator is shown as the 5' -end 7229-7423 site in the sequence 2 of the sequence table. The coding gene of the nicking enzyme is shown as the 1721-5989 th site from the 5' end of the sequence 2 of the sequence table. The coding gene of the cytosine nucleoside deaminase PmCDA1 is shown as the 6281-6904 th site from the 5' end of the sequence 2 in the sequence table. The UGI encoding gene of the uracil DNA glucoamylase inhibitor is shown as the 6926-7222 th site from the 5' end of the sequence 2 in the sequence table. The expression cassette A can be specifically shown as a sequence 2 in a sequence table.
And any one of the expression cassettes B is expressed by a promoter B promoter element B. The expression cassette B is provided with a promoter B, an element B and a terminator B in sequence from the 5' end. The promoter B can be specifically OsU3 promoter. The nucleotide sequence of the OsU3 promoter is shown as the 131-467 th site from the 5' end of the sequence 1 in the sequence table. The terminator B can be specifically an OsU3 terminator. The nucleotide sequence of the OsU3 terminator is shown as the 993-position and 1283-position from the 5' end of the sequence 1 in the sequence table. When the target sequence is shown in Table 1, the expression cassette B can be specifically shown as 131 th to 1283 rd positions from 5' end of the sequence 1 in the sequence table.
When the target sequences are shown in Table 1, any one of the above recombinant expression vectors can be specifically a circular plasmid obtained by replacing the sequence 1 from the 5' end of the sequence table with the sequence 2 of the sequence table from 1290-8712.
The invention also provides a method for replacing the base of the plant genome, which comprises the following steps: the base substitution of the plant genome is accomplished using any of the base editing systems described above.
The invention also provides a method for replacing the base of the plant genome, which comprises the following steps: the recombinant expression vector described above is introduced into a target plant to achieve base substitution of a plant genome.
The invention also protects the nicking enzyme, which is shown as amino acids from 1 st to 1423 rd of the N end of the sequence 13 in the sequence table.
The invention also provides the fusion protein, or the base editing system, or any one of the recombinant expression vector, the expression cassette, the recombinant cell or the recombinant bacterium, or the application of the nicking enzyme in base replacement of plant genomes.
Any of the base substitutions described above is a substitution of base C to T.
Any of the plants described above may specifically be rice, more specifically may be japonica rice.
According to the invention, nicking enzyme HypaCas9n and PmCDA1 and UGI are fused for the first time to construct a base editing system, and the finding shows that the detrargeting efficiency can be reduced under the condition that the C.T base replacement efficiency is not influenced basically compared with HypACas9n & PmCDA1& UGI and SpCas9n & PmCDA1& UGI.
Drawings
FIG. 1 shows the C.T base substitution efficiency of SpCas9n & PmCDA1& UGI and HypaCas9n & PmCDA1& UGI.
FIG. 2 shows the off-target efficiency of SpCas9n & PmCDA1& UGI and HypaCas9n & PmCDA1& UGI.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
Japanese fine rice: reference documents: the effects of sodium nitroprusside and its photolysis products on the growth of Nippon rice seedlings and the expression of 5 hormone marker genes [ J ]. proceedings of university of Master Henan (Nature edition), 2017(2): 48-52.; the public is available from the agroforestry academy of sciences of Beijing.
The target genes, target names and sequences in the examples below are shown in Table 1.
TABLE 1
Target gene Name of target point Target sequence
OsALS CS650 cgcgtccatggagatccacc
OsCDC48 CS651 gaccagccagcgtctggcgc
OsNRT1.1B CS652 cggcgacggcgagcaagtgg
Example 1, Hypacas9n & PmCDA1& UGI System C.T base substitution efficiency
First, construction of genome editing vector
1. SpCas9n & PmCDA1& UGI vector: artificially synthesizing a circular plasmid shown in a sequence 1 in a sequence table.
Sequence 1 of the sequence table comprises the following three expression cassettes:
the 131 rd to 1283 rd positions from the 5' end of the sequence 1 are an expression cassette I, wherein the 131 st and 467 th positions are OsU3 th nucleotide sequence of promoter, the 474 st and 550 th positions are pre-tRNA nucleotide sequence, the 551 and 570 th positions are CS650 target nucleotide sequence, the 571 st and 646 th positions are sgRNA nucleotide sequence, the 647 nd and 723 th positions are pre-tRNA nucleotide sequence, the 724 nd and 743 th positions are CS651 target nucleotide sequence, the 744 and 819 th positions are sgRNA nucleotide sequence, the 820 th and 896 th positions are pre-tRNA nucleotide sequence, the 897 th and 916 th positions are CS652 target nucleotide sequence, the 917 and 992 th positions are sgRNA nucleotide sequence, and the 993 rd and 1283 th positions are OsU3 terminator nucleotide sequence.
The 1290-8712 position of the sequence 1 from the 5' end is an expression cassette II, wherein the 1290-3003 position is the nucleotide sequence of the OsUbq3 promoter, the 3010-7278 position is the nucleotide sequence of SpCas9n (without a stop codon), the 7570-8193 position is the nucleotide sequence of PmCDA1, the 8215-8511 position is the nucleotide sequence of UGI, and the 8518-8712 position is the nucleotide sequence of the CaMV35S terminator.
The 8787-12064 of the 5' end of the sequence 1 is the expression cassette III, wherein the 8787-10779 is the nucleotide sequence of ZmUbi1 promoter, the 10786-11811 is the nucleotide sequence of hygromycin, and the 11812-12064 is the nucleotide sequence of Nos terminator.
2. HypaCas9n & PmCDA1& UGI vector: the circular plasmid is obtained by replacing the 1290-8712 (expression cassette II) of the sequence 1 in the sequence table from the 5' end with the sequence 2 in the sequence table. The HypaCas9n & PmCDA1& UGI vector differs from the SpCas9n & PmCDA1& UGI vector only in that the nucleotide sequence of SpCas9n (which does not contain a stop codon) is replaced with the nucleotide sequence of HypaCas9n (which does not contain a stop codon).
In the sequence 2 of the sequence table, the nucleotide sequence of the OsUbq3 promoter is from the 1 st to 1714 th position of the 5' end, the nucleotide sequence of the HypaCas9n is from the 1721 st-5989 th position (not containing a stop codon), the nucleotide sequence of the PmCDA1 is from the 6281 st-6904 th position, the nucleotide sequence of the UGI is from the 6926 st-7222 th position, and the nucleotide sequence of the CaMV35S terminator is from the 7229 st-7423 th position.
Secondly, gene editing is carried out in the rice callus
The SpCas9n & PmCDA1& UGI vector and the HypaCas9n & PmCDA1& UGI vector constructed in the step one are respectively operated according to the following steps 1-5:
1. introducing the vector into Agrobacterium LBA4404 (Diego, Shanghai, CAT #: AC1030) to obtain recombinant bacteria, and culturing the recombinant bacteria with YEP culture medium to obtain bacterial liquid OD600nmThe staining solution was 0.2.
2. Selecting seeds of the Japanese fine rice, peeling off the seeds, sterilizing and washing, uniformly dropping the seeds into an N6 culture medium, and culturing at 28 ℃ in the dark for 4-6 weeks to induce the generation of callus.
3. Soaking the rice callus obtained in the step 2 in the infection solution obtained in the step 1 for 10min, taking the callus to inoculate on a culture dish containing two layers of filter paper, culturing for 3 days at 25 ℃ in the dark (the culture medium is N6 culture medium containing 100mg/L timentin), then screening and culturing the callus in a screening culture medium (N6 culture medium containing 50mg/L hygromycin, pH5.7) at 28 ℃ in the dark for 2 weeks, and transferring the callus into a newly configured screening culture medium to perform screening and culturing for 2 weeks again to obtain resistant callus.
4. Extracting the genome DNA of the resistant callus obtained in the step 3, and performing PCR amplification by adopting a primer pair consisting of a primer F (5'-attatgtagcttgtgcgtttcg-3') and a primer R (5'-gatgaagagcttatcgacgt-3'); the obtained amplification product is subjected to agarose gel electrophoresis, and a band with the size of 1150bp is shown in an electrophoretogram, so that the corresponding callus is a positive resistant callus.
5. The positive resistant callus DNA obtained in step 4 (15 selected per vector) was PCR amplified using CS650 target primers (CS650-F and CS650-R), CS651 target primers (CS651-F and CS651-R) and CS652 target primers (CS652-F and CS652-R), respectively, and the amplified products were then sequenced.
CS650-F:5’-taagaaccaccagcgacacc-3’；
CS650-R:5’-ggtaattgtgcttggtgatggag-3’；
CS651-F:5’-acatcgagatggagaagcgg-3’；
CS651-R:5’-ccatgctccaatcgatgaatac-3’；
CS652-F:5’-ttacgaactttataactttgtcgg-3’；
CS652-R:5’-atggaggcgatgaggaagac-3’。
For the CS650 target, the sites at which C.T base substitutions occur correspond to: cgTgtccatggagatccacc, respectively;
for the CS651 target, the sites at which c.t base substitutions occur correspond to: gaTTagccagcgtctggcgc, respectively;
for the CS652 target, the sites at which the c.t base substitutions occur correspond to: cggTgacggcgagcaagtgg are provided.
The three targets respectively count the number of the positive resistant calli which are subjected to C.T base substitution, and the base substitution efficiency is the proportion of the positive resistant calli which are subjected to C.T base substitution in 15 positive resistant calli.
The results are shown in FIG. 1. The experimental result shows that the C.T base replacement efficiency of HypaCas9n & PmCDA1& UGI is not greatly different or slightly reduced from that of SpCas9n & PmCDA1& UGI.
Example 2 HypaCas9n & PmCDA1& UGI off-target Effect
First, construction of genome editing vector
SpCas9n & PmCDA1& UGI-T1: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 3 in the sequence table.
SpCas9n & PmCDA1& UGI-T2: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 4 in the sequence table.
SpCas9n & PmCDA1& UGI-T3: the circular plasmid is obtained by replacing the 551-th and 916-th sites of the sequence 1 in the sequence table from the 5' end with the sequence 5 in the sequence table.
SpCas9n & PmCDA1& UGI-T4: the circular plasmid is obtained by replacing the 551-th and 916-th sites of the sequence 1 in the sequence table from the 5' end with the sequence 6 in the sequence table.
SpCas9n & PmCDA1& UGI-T5: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 7 in the sequence table.
SpCas9n & PmCDA1& UGI-T6: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 8 in the sequence table.
SpCas9n & PmCDA1& UGI-T7: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 9 in the sequence table.
SpCas9n & PmCDA1& UGI-T8: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 10 in the sequence table.
SpCas9n & PmCDA1& UGI-T9: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 11 in the sequence table.
SpCas9n & PmCDA1& UGI-T10: the circular plasmid is obtained by replacing the 551-916 th site of the sequence 1 in the sequence table from the 5' end with the sequence 12 in the sequence table.
Hypacas9n & PmCDA1& UGI-T1: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 3 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T2: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 4 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T3: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 5 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T4: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 6 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-5: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 7 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T6: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 8 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T7: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 9 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T8: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 10 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T9: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 11 of the sequence table from the 551-916 position of the 5' end.
Hypacas9n & PmCDA1& UGI-T10: the HypaCas9n & PmCDA1& UGI vector is replaced by a circular plasmid obtained by the sequence 12 of the sequence table from the 551-916 position of the 5' end.
Secondly, gene editing is carried out in the rice callus
1. The vector obtained in the first step is operated according to 1-4 of the second step in the example 1 respectively to obtain the positive resistant callus.
2. Randomly selecting 8 blocks from the positive resistant callus obtained in the step 1 by each vector, mixing DNA of the 8 blocks, respectively adopting CS652 target primers (CS652-F and CS652-R) to carry out first round of PCR amplification, taking a first round of PCR product as a template, adding forward and reverse barcodes into the tail ends of the PCR product to construct a library, sequencing by using an IlluminaHiSeq2500 high-throughput sequencing platform, wherein the sequencing depth is 10000X (Shijiazhuang Boryddi Biotechnology Co., Ltd.), a target region detects C.T base substitution and indels, any C.T base substitution and indels in the target region are all subjected to off-target mutation, and the off-target efficiency is the proportion of the detected mutant reads number to the total reads number.
The results are shown in FIG. 2. The experimental result shows that when the 2bp at the 5' end is different, off-target effect can occur; the off-target efficiency of HypaCas9n & PmCDA1& UGI occurred about 4-fold lower compared to SpCas9n & PmCDA1& UGI.
The above results indicate that the D10A mutation was introduced into HypaCas9, and changed into a nicking enzyme (HypaCas9n), and fused with PmCDA1 and UGI to construct a base editing system. HypaCas9n & PmCDA1& UGI can decrease off-target efficiency without substantially affecting c.t base substitution efficiency, compared to SpCas9n & PmCDA1& UGI.
Sequence listing
<110> agriculture and forestry academy of sciences of Beijing City
<120> a nicking enzyme and its use in genome base substitution
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18476
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggtggcagga tatattgtgg tgtaaacatg gcactagcct caccgtcttc gcagacgagg 60
ccgctaagtc gcagctacgc tctcaacggc actgactagg tagtttaaac gtgcacttaa 120
ttaaggtacc gaagcaactt aaagttatca ggcatgcatg gatcttggag gaatcagatg 180
tgcagtcagg gaccatagca caagacaggc gtcttctact ggtgctacca gcaaatgctg 240
gaagccggga acactgggta cgttggaaac cacgtgatgt gaagaagtaa gataaactgt 300
aggagaaaag catttcgtag tgggccatga agcctttcag gacatgtatt gcagtatggg 360
ccggcccatt acgcaattgg acgacaacaa agactagtat tagtaccacc tcggctatcc 420
acatagatca aagctgattt aaaagagttg tgcagatgat ccgtggcgga tccaacaaag 480
caccagtggt ctagtggtag aatagtaccc tgccacggta cagacccggg ttcgattccc 540
ggctggtgca cgcgtccatg gagatccacc gttttagagc tagaaatagc aagttaaaat 600
aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgcaaca aagcaccagt 660
ggtctagtgg tagaatagta ccctgccacg gtacagaccc gggttcgatt cccggctggt 720
gcagaccagc cagcgtctgg cgcgttttag agctagaaat agcaagttaa aataaggcta 780
gtccgttatc aacttgaaaa agtggcaccg agtcggtgca acaaagcacc agtggtctag 840
tggtagaata gtaccctgcc acggtacaga cccgggttcg attcccggct ggtgcacggc 900
gacggcgagc aagtgggttt tagagctaga aatagcaagt taaaataagg ctagtccgtt 960
atcaacttga aaaagtggca ccgagtcggt gctttttttt ttcgttttgc attgagtttt 1020
ctccgtcgca tgtttgcagt tttattttcc gttttgcatt gaaatttctc cgtctcatgt 1080
ttgcagcgtg ttcaaaaagt acgcagctgt atttcactta tttacggcgc cacattttca 1140
tgccgtttgt gccaactatc ccgagctagt gaatacagct tggcttcaca caacactggt 1200
gacccgctga cctgctcgta cctcgtaccg tcgtacggca cagcatttgg aattaaaggg 1260
tgtgatcgat actgcttgct gctaagctta caaattcggg tcaaggcgga agccagcgcg 1320
ccaccccacg tcagcaaata cggaggcgcg gggttgacgg cgtcacccgg tcctaacggc 1380
gaccaacaaa ccagccagaa gaaattacag taaaaaaaaa gtaaattgca ctttgatcca 1440
ccttttatta cctaagtctc aatttggatc acccttaaac ctatcttttc aatttgggcc 1500
gggttgtggt ttggactacc atgaacaact tttcgtcatg tctaacttcc ctttcagcaa 1560
acatatgaac catatataga ggagatcggc cgtatactag agctgatgtg tttaaggtcg 1620
ttgattgcac gagaaaaaaa aatccaaatc gcaacaatag caaatttatc tggttcaaag 1680
tgaaaagata tgtttaaagg tagtccaaag taaaacttat agataataaa atgtggtcca 1740
aagcgtaatt cactcaaaaa aaatcaacga gacgtgtacc aaacggagac aaacggcatc 1800
ttctcgaaat ttcccaaccg ctcgctcgcc cgcctcgtct tcccggaaac cgcggtggtt 1860
tcagcgtggc ggattctcca agcagacgga gacgtcacgg cacgggactc ctcccaccac 1920
ccaaccgcca taaataccag ccccctcatc tcctctcctc gcatcagctc cacccccgaa 1980
aaatttctcc ccaatctcgc gaggctctcg tcgtcgaatc gaatcctctc gcgtcctcaa 2040
ggtacgctgc ttctcctctc ctcgcttcgt ttcgattcga tttcggacgg gtgaggttgt 2100
tttgttgcta gatccgattg gtggttaggg ttgtcgatgt gattatcgtg agatgtttag 2160
gggttgtaga tctgatggtt gtgatttggg cacggttggt tcgataggtg gaatcgtggt 2220
taggttttgg gattggatgt tggttctgat gattgggggg aatttttacg gttagatgaa 2280
ttgttggatg attcgattgg ggaaatcggt gtagatctgt tggggaattg tggaactagt 2340
catgcctgag tgattggtgc gatttgtagc gtgttccatc ttgtaggcct tgttgcgagc 2400
atgttcagat ctactgttcc gctcttgatt gagttattgg tgccatgggt tggtgcaaac 2460
acaggcttta atatgttata tctgttttgt gtttgatgta gatctgtagg gtagttcttc 2520
ttagacatgg ttcaattatg tagcttgtgc gtttcgattt gatttcatat gttcacagat 2580
tagataatga tgaactcttt taattaattg tcaatggtaa ataggaagtc ttgtcgctat 2640
atctgtcata atgatctcat gttactatct gccagtaatt tatgctaaga actatattag 2700
aatatcatgt tacaatctgt agtaatatca tgttacaatc tgtagttcat ctatataatc 2760
tattgtggta atttcttttt actatctgtg tgaagattat tgccactagt tcattctact 2820
tatttctgaa gttcaggata cgtgtgctgt tactacctat ctgaatacat gtgtgatgtg 2880
cctgttacta tctttttgaa tacatgtatg ttctgttgga atatgtttgc tgtttgatcc 2940
gttgttgtgt ccttaatctt gtgctagttc ttaccctatc tgtttggtga ttatttcttg 3000
cagtacgtaa tggactacaa ggaccacgac ggggattaca aagaccacga catagactac 3060
aaggatgacg atgacaaaat ggcaccgaag aaaaaaagga aggtcggaat ccatggcgtt 3120
ccagctgccg ataagaaata ttccatcgga ctcgccattg gcacgaatag cgtcggatgg 3180
gctgttatta ctgatgagta caaagttccg tctaagaagt tcaaggtgct gggcaacaca 3240
gaccgccaca gcataaagaa aaatctcatc ggtgcactcc ttttcgatag tggggagact 3300
gcagaagcga caagattgaa aaggactgcg agaaggcgct atacacggcg taagaataga 3360
atctgctacc ttcaggagat tttctctaac gaaatggcta aggtcgatga cagtttcttt 3420
catagacttg aggaatcgtt cttggttgag gaggataaga aacatgagag gcacccgata 3480
tttggaaaca tcgtggatga ggtcgcatat catgaaaagt accccacaat ctaccacctg 3540
agaaagaaac tcgttgattc caccgacaaa gcggatttga gactcatcta cctcgctctt 3600
gcccatatga taaagttccg cggacacttt ctgatcgagg gcgacctcaa ccctgataat 3660
agcgacgtcg ataagctctt catccagttg gttcaaacct acaatcagct ctttgaggaa 3720
aacccaatta atgctagtgg agtggatgca aaagcgatac tgtcggccag actctccaag 3780
agcagaaggt tggagaacct gatcgctcaa cttcctggag aaaagaaaaa cggtcttttt 3840
gggaatttga ttgccttgtc tctgggcctc acaccaaact tcaagtcaaa ttttgacctc 3900
gctgaggatg ccaaacttca gttgtctaag gatacctatg atgacgatct tgacaatttg 3960
ctggcacaaa ttggcgacca gtacgcggat ctgttcctcg cagcgaagaa tctgagtgat 4020
gctattctcc tttcggacat actcagggtt aacactgaga tcacaaaagc acctttgagt 4080
gcgtcgatga ttaagcgcta tgatgaacat caccaagacc tcactttgct gaaggccctt 4140
gtgcggcagc aattgccaga gaagtacaaa gaaatcttct ttgaccaatc taagaacgga 4200
tacgctggct atattgatgg aggagcttct caggaggaat tctataagtt tatcaaacct 4260
atacttgaga agatggatgg tacagaggaa ctccttgtta aattgaacag agaagatttg 4320
ctgcgcaagc aacggacctt tgacaacgga tcaattccgc atcagataca cctcggcgag 4380
cttcatgcca tccttcgccg gcaggaagat ttctacccct ttttgaagga caaccgcgag 4440
aagatagaaa aaatccttac gttccggatt ccttactatg tgggtccatt ggcaaggggg 4500
aattcccgct ttgcgtggat gactcggaaa agcgaggaaa ctatcacacc gtggaacttc 4560
gaggaagttg tggacaaggg agcttctgcc caatcattca ttgagaggat gactaacttc 4620
gataagaacc tgccgaacga gaaagttctc cccaagcact ccctccttta cgagtatttc 4680
accgtgtata acgaacttac gaaggttaaa tacgtgactg agggtatgag gaagccagca 4740
ttcttgagcg gggaacaaaa gaaagcgatt gttgatttgc tgtttaaaac taatcgcaag 4800
gtgacagtca agcagctcaa agaggattat ttcaagaaaa ttgaatgttt cgactctgtg 4860
gagatatcag gagtcgaaga taggtttaac gcttcccttg gcacatacca tgacctcctt 4920
aagatcatta aggacaaaga tttcctggat aacgaggaaa atgaggacat cctcgaagat 4980
attgttctta ccttgacgct gtttgaggat cgcgaaatga tcgaggaacg gcttaagacg 5040
tatgctcact tgttcgacga taaggttatg aagcagctca agcgtagaag gtacactgga 5100
tggggccgtc tgtctagaaa gctcatcaac ggaatacgtg ataaacaaag tggcaagaca 5160
attttggatt ttctgaagtc ggacggattc gccaacagaa attttatgca gctgattcat 5220
gacgatagtc tcaccttcaa agaggacata cagaaggctc aagtgagtgg tcaaggggat 5280
tcgctgcatg aacacatcgc aaacctcgcg ggttcaccgg ccataaagaa aggaatcctt 5340
caaactgtta aggtcgttga tgagttggtt aaagtgatgg gtaggcacaa gcccgaaaac 5400
atagtgatcg agatggctcg cgaaaatcag actacacaaa aagggcagaa gaactctcgc 5460
gagcggatga aaaggattga ggaaggaatc aaggaactgg gctcacagat tctcaaagag 5520
catccagtcg aaaacacaca gctgcaaaat gagaagctct atctttacta tctccaaaat 5580
ggccgggaca tgtatgttga tcaggagctt gacatcaacc gtttgtccga ctatgatgtg 5640
gaccacattg tcccgcaatc tttccttaag gacgattcaa tcgataataa ggtgttgacc 5700
cggagcgata aaaaccgtgg aaagtctgac aatgtccctt cagaggaagt ggttaagaag 5760
atgaagaact actggagaca attgctgaat gcaaaactga tcacacagag aaagttcgac 5820
aacctcacca aagcagagag aggtgggctc agtgaacttg ataaagcggg cttcattaag 5880
cgtcagctcg ttgagactag acagatcacg aagcatgtcg cgcagatttt ggattcgcgg 5940
atgaacacga agtacgacga gaatgataaa ctgatacgtg aagtcaaggt tatcactctt 6000
aagtccaaat tggtgagcga tttcagaaag gacttccaat tctataaggt cagggagatc 6060
aacaattatc atcacgctca cgatgcctac cttaatgctg ttgtggggac cgcccttatt 6120
aagaaatacc ctaaattgga gtctgaattc gtttacgggg attataaggt ctacgacgtt 6180
aggaaaatga tagctaagag tgagcaggag atcggtaaag caactgcgaa gtatttcttt 6240
tactcgaaca tcatgaattt ctttaagacc gagataacgc tggcaaatgg cgaaattaga 6300
aagaggcctc tcatagagac taacggtgag acaggggaaa tcgtctggga taagggtagg 6360
gactttgcga cagtgcgcaa ggtcctctct atgccgcaag ttaatattgt gaagaaaacc 6420
gaggtgcaga cgggaggctt ctccaaggaa agcatacttc ccaaacggaa ctctgataag 6480
ttgatcgctc gtaagaaaga ttgggaccct aagaaatatg gtgggttcga ttccccaact 6540
gttgcttaca gcgtgctggt cgttgccaag gtcgagaagg gtaaatccaa gaaactcaaa 6600
agcgttaagg aactccttgg gattactatc atggagagat cttcattcga aaagaatcct 6660
atcgactttc ttgaggccaa aggatataag gaagttaaga aagatctgat aatcaaactc 6720
ccaaagtact cattgtttga gctggaaaac ggcaggaagc gcatgcttgc ttccgccgga 6780
gagttgcaga aagggaacga gttggctctg ccttctaagt atgttaactt cctctatctt 6840
gcctctcatt acgagaagct caaaggctca ccagaggaca acgaacagaa acaacttttt 6900
gtcgagcaac ataagcacta tttggatgag attatagaac agatcagtga attctcgaaa 6960
agggttatcc ttgcagatgc gaatcttgac aaggtgttgt ctgcatacaa caaacataga 7020
gataagccga tcagggagca agcggaaaat atcattcacc tcttcactct tacaaacttg 7080
ggtgctcccg ctgccttcaa gtattttgat accacgattg accggaaacg ttacacctca 7140
acgaaggagg tgctggatgc caccctcatc caccaatcta ttaccggact ctacgagact 7200
agaatcgatc tctcacagct cggcggggat aaaagaccag cagcgacgaa aaaggcagga 7260
caggctaaga agaagaaaga gctcggagga ggaggcacgg gaggaggagg ctccgccgag 7320
tatgtgcgcg cgctcttcga cttcaacggc aatgacgagg aggatctccc tttcaagaag 7380
ggcgacatcc tccgcatccg cgataagccg gaggagcagt ggtggaacgc agaggactcc 7440
gagggcaagc ggggcatgat cctggtgcca tacgtcgaga agtacagcgg cgattacaag 7500
gaccacgatg gcgactacaa ggatcatgac atcgattaca aggacgatga cgataagtcc 7560
ggcgtcgaca tgacggacgc ggagtatgtg cgcatccacg agaagctcga tatctacacc 7620
ttcaagaagc agttcttcaa caataagaag tcggtgtccc atcggtgcta cgtcctcttc 7680
gagctgaagc gcaggggaga gcgccgcgcc tgcttctggg gctacgcggt gaataagccg 7740
cagtcaggca cagagcgcgg catccacgcc gagatcttct cgatccggaa ggtcgaggag 7800
tacctccgcg acaacccagg ccagttcacg atcaattggt actccagctg gtccccttgc 7860
gcagattgcg cagagaagat cctcgagtgg tacaaccagg agctgagggg caatggccat 7920
accctcaaga tctgggcctg caagctgtac tacgagaaga acgcgaggaa tcagatcggc 7980
ctctggaacc tgcgggataa tggcgtgggc ctcaacgtga tggtgtccga gcactaccag 8040
tgctgccgca agatcttcat ccagtcctcc cacaatcagc tgaacgagaa taggtggctc 8100
gaaaagaccc tgaagcgcgc cgagaagtgg aggagcgagc tgtctatcat gatccaggtc 8160
aagatcctgc acaccacaaa gtcaccggcg gtgggcggcg gcggcagcga attctccggc 8220
ggcagcacga acctcagcga catcatcgag aaggagacag gcaagcagct cgtgatccag 8280
gagtctatcc tcatgctgcc tgaggaggtg gaggaggtca tcggcaacaa gccggagtcc 8340
gatatcctcg tgcacaccgc ctacgacgag tcgacagatg agaatgtcat gctcctgacc 8400
tccgacgcac cagagtacaa gccatgggcg ctcgtgatcc aggattccaa cggcgagaat 8460
aagatcaaga tgctgtctgg cggctccccg aagaagaagc gcaaggtcta gactagtctg 8520
aaatcaccag tctctctcta caaatctatc tctctctata ataatgtgtg agtagttccc 8580
agataaggga attagggttc ttatagggtt tcgctcatgt gttgagcata taagaaaccc 8640
ttagtatgta tttgtatttg taaaatactt ctatcaataa aatttctaat tcctaaaacc 8700
aaaatccagt ggggcgcccg acctgtactc gcgaaggtta acttacagag agtgtccggg 8760
cgcgcctggt ggatcgtccg cctaggctgc agtgcagcgt gacccggtcg tgcccctctc 8820
tagagataat gagcattgca tgtctaagtt ataaaaaatt accacatatt ttttttgtca 8880
cacttgtttg aagtgcagtt tatctatctt tatacatata tttaaacttt actctacgaa 8940
taatataatc tatagtacta caataatatc agtgttttag agaatcatat aaatgaacag 9000
ttagacatgg tctaaaggac aattgagtat tttgacaaca ggactctaca gttttatctt 9060
tttagtgtgc atgtgttctc cttttttttt gcaaatagct tcacctatat aatacttcat 9120
ccattttatt agtacatcca tttagggttt agggttaatg gtttttatag actaattttt 9180
ttagtacatc tattttattc tattttagcc tctaaattaa gaaaactaaa actctatttt 9240
agttttttta tttaataatt tagatataaa atagaataaa ataaagtgac taaaaattaa 9300
acaaataccc tttaagaaat taaaaaaact aaggaaacat ttttcttgtt tcgagtagat 9360
aatgccagcc tgttaaacgc cgtcgacgag tctaacggac accaaccagc gaaccagcag 9420
cgtcgcgtcg ggccaagcga agcagacggc acggcatctc tgtcgctgcc tctggacccc 9480
tctcgagagt tccgctccac cgttggactt gctccgctgt cggcatccag aaattgcgtg 9540
gcggagcggc agacgtgagc cggcacggca ggcggcctcc tcctcctctc acggcaccgg 9600
cagctacggg ggattccttt cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat 9660
aaatagacac cccctccaca ccctctttcc ccaacctcgt gttgttcgga gcgcacacac 9720
acacaaccag atctccccca aatccacccg tcggcacctc cgcttcaagg tacgccgctc 9780
gtcctccccc cccccccctc tctaccttct ctagatcggc gttccggtcc atggttaggg 9840
cccggtagtt ctacttctgt tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc 9900
tgctagcgtt cgtacacgga tgcgacctgt acgtcagaca cgttctgatt gctaacttgc 9960
cagtgtttct ctttggggaa tcctgggatg gctctagccg ttccgcagac gggatcgatt 10020
tcatgatttt ttttgtttcg ttgcataggg tttggtttgc ccttttcctt tatttcaata 10080
tatgccgtgc acttgtttgt cgggtcatct tttcatgctt ttttttgtct tggttgtgat 10140
gatgtggtct ggttgggcgg tcgttctaga tcggagtaga attctgtttc aaactacctg 10200
gtggatttat taattttgga tctgtatgtg tgtgccatac atattcatag ttacgaattg 10260
aagatgatgg atggaaatat cgatctagga taggtataca tgttgatgcg ggttttactg 10320
atgcatatac agagatgctt tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg 10380
tcgttcattc gttctagatc ggagtagaat actgtttcaa actacctggt gtatttatta 10440
attttggaac tgtatgtgtg tgtcatacat cttcatagtt acgagtttaa gatggatgga 10500
aatatcgatc taggataggt atacatgttg atgtgggttt tactgatgca tatacatgat 10560
ggcatatgca gcatctattc atatgctcta accttgagta cctatctatt ataataaaca 10620
agtatgtttt ataattattt tgatcttgat atacttggat gatggcatat gcagcagcta 10680
tatgtggatt tttttagccc tgccttcata cgctatttat ttgcttggta ctgtttcttt 10740
tgtcgatgct caccctgttg tttggtgtta cttctgcagg agctcatgaa aaagcctgaa 10800
ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt tcgacagcgt ctccgacctg 10860
atgcagctct cggagggcga agaatctcgt gctttcagct tcgatgtagg agggcgtgga 10920
tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca aagatcgtta tgtttatcgg 10980
cactttgcat cggccgcgct cccgattccg gaagtgcttg acattgggga gtttagcgag 11040
agcctgacct attgcatctc ccgccgttca cagggtgtca cgttgcaaga cctgcctgaa 11100
accgaactgc ccgctgttct acaaccggtc gcggaggcta tggatgcgat cgctgcggcc 11160
gatcttagcc agacgagcgg gttcggccca ttcggaccgc aaggaatcgg tcaatacact 11220
acatggcgtg atttcatatg cgcgattgct gatccccatg tgtatcactg gcaaactgtg 11280
atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg atgagctgat gctttgggcc 11340
gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt tcggctccaa caatgtcctg 11400
acggacaatg gccgcataac agcggtcatt gactggagcg aggcgatgtt cggggattcc 11460
caatacgagg tcgccaacat cttcttctgg aggccgtggt tggcttgtat ggagcagcag 11520
acgcgctact tcgagcggag gcatccggag cttgcaggat cgccacgact ccgggcgtat 11580
atgctccgca ttggtcttga ccaactctat cagagcttgg ttgacggcaa tttcgatgat 11640
gcagcttggg cgcagggtcg atgcgacgca atcgtccgat ccggagccgg gactgtcggg 11700
cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg atggctgtgt agaagtactc 11760
gccgatagtg gaaaccgacg ccccagcact cgtccgaggg caaagaaata ggatcgttca 11820
aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc 11880
atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta 11940
tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa 12000
aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta 12060
gatctgtagc cctgcaggac gcgtttaatt aagtgcacgc ggccgcctac ttagtcaaga 12120
gcctcgcacg cgactgtcac gcggccagga tcgcctcgtg agcctcgcaa tctgtaccta 12180
gtgtttaaac tatcagtgtt tgacaggata tattggcggg taaacctaag agaaaagagc 12240
gtttattaga ataacggata tttaaaaggg cgtgaaaagg tttatccgtt cgtccatttg 12300
tatgtgcatg ccaaccacag ggttcccctc gggatcaaag tactttgatc caacccctcc 12360
gctgctatag tgcagtcggc ttctgacgtt cagtgcagcc gtcttctgaa aacgacatgt 12420
cgcacaagtc ctaagttacg cgacaggctg ccgccctgcc cttttcctgg cgttttcttg 12480
tcgcgtgttt tagtcgcata aagtagaata cttgcgacta gaaccggaga cattacgcca 12540
tgaacaagag cgccgccgct ggcctgctgg gctatgcccg cgtcagcacc gacgaccagg 12600
acttgaccaa ccaacgggcc gaactgcacg cggccggctg caccaagctg ttttccgaga 12660
agatcaccgg caccaggcgc gaccgcccgg agctggccag gatgcttgac cacctacgcc 12720
ctggcgacgt tgtgacagtg accaggctag accgcctggc ccgcagcacc cgcgacctac 12780
tggacattgc cgagcgcatc caggaggccg gcgcgggcct gcgtagcctg gcagagccgt 12840
gggccgacac caccacgccg gccggccgca tggtgttgac cgtgttcgcc ggcattgccg 12900
agttcgagcg ttccctaatc atcgaccgca cccggagcgg gcgcgaggcc gccaaggccc 12960
gaggcgtgaa gtttggcccc cgccctaccc tcaccccggc acagatcgcg cacgcccgcg 13020
agctgatcga ccaggaaggc cgcaccgtga aagaggcggc tgcactgctt ggcgtgcatc 13080
gctcgaccct gtaccgcgca cttgagcgca gcgaggaagt gacgcccacc gaggccaggc 13140
ggcgcggtgc cttccgtgag gacgcattga ccgaggccga cgccctggcg gccgccgaga 13200
atgaacgcca agaggaacaa gcatgaaacc gcaccaggac ggccaggacg aaccgttttt 13260
cattaccgaa gagatcgagg cggagatgat cgcggccggg tacgtgttcg agccgcccgc 13320
gcacgtctca accgtgcggc tgcatgaaat cctggccggt ttgtctgatg ccaagctggc 13380
ggcctggccg gccagcttgg ccgctgaaga aaccgagcgc cgccgtctaa aaaggtgatg 13440
tgtatttgag taaaacagct tgcgtcatgc ggtcgctgcg tatatgatgc gatgagtaaa 13500
taaacaaata cgcaagggga acgcatgaag gttatcgctg tacttaacca gaaaggcggg 13560
tcaggcaaga cgaccatcgc aacccatcta gcccgcgccc tgcaactcgc cggggccgat 13620
gttctgttag tcgattccga tccccagggc agtgcccgcg attgggcggc cgtgcgggaa 13680
gatcaaccgc taaccgttgt cggcatcgac cgcccgacga ttgaccgcga cgtgaaggcc 13740
atcggccggc gcgacttcgt agtgatcgac ggagcgcccc aggcggcgga cttggctgtg 13800
tccgcgatca aggcagccga cttcgtgctg attccggtgc agccaagccc ttacgacata 13860
tgggccaccg ccgacctggt ggagctggtt aagcagcgca ttgaggtcac ggatggaagg 13920
ctacaagcgg cctttgtcgt gtcgcgggcg atcaaaggca cgcgcatcgg cggtgaggtt 13980
gccgaggcgc tggccgggta cgagctgccc attcttgagt cccgtatcac gcagcgcgtg 14040
agctacccag gcactgccgc cgccggcaca accgttcttg aatcagaacc cgagggcgac 14100
gctgcccgcg aggtccaggc gctggccgct gaaattaaat caaaactcat ttgagttaat 14160
gaggtaaaga gaaaatgagc aaaagcacaa acacgctaag tgccggccgt ccgagcgcac 14220
gcagcagcaa ggctgcaacg ttggccagcc tggcagacac gccagccatg aagcgggtca 14280
actttcagtt gccggcggag gatcacacca agctgaagat gtacgcggta cgccaaggca 14340
agaccattac cgagctgcta tctgaataca tcgcgcagct accagagtaa atgagcaaat 14400
gaataaatga gtagatgaat tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa 14460
ccaggcaccg acgccgtgga atgccccatg tgtggaggaa cgggcggttg gccaggcgta 14520
agcggctggg ttgtctgccg gccctgcaat ggcactggaa cccccaagcc cgaggaatcg 14580
gcgtgacggt cgcaaaccat ccggcccggt acaaatcggc gcggcgctgg gtgatgacct 14640
ggtggagaag ttgaaggccg cgcaggccgc ccagcggcaa cgcatcgagg cagaagcacg 14700
ccccggtgaa tcgtggcaag cggccgctga tcgaatccgc aaagaatccc ggcaaccgcc 14760
ggcagccggt gcgccgtcga ttaggaagcc gcccaagggc gacgagcaac cagatttttt 14820
cgttccgatg ctctatgacg tgggcacccg cgatagtcgc agcatcatgg acgtggccgt 14880
tttccgtctg tcgaagcgtg accgacgagc tggcgaggtg atccgctacg agcttccaga 14940
cgggcacgta gaggtttccg cagggccggc cggcatggcc agtgtgtggg attacgacct 15000
ggtactgatg gcggtttccc atctaaccga atccatgaac cgataccggg aagggaaggg 15060
agacaagccc ggccgcgtgt tccgtccaca cgttgcggac gtactcaagt tctgccggcg 15120
agccgatggc ggaaagcaga aagacgacct ggtagaaacc tgcattcggt taaacaccac 15180
gcacgttgcc atgcagcgta cgaagaaggc caagaacggc cgcctggtga cggtatccga 15240
gggtgaagcc ttgattagcc gctacaagat cgtaaagagc gaaaccgggc ggccggagta 15300
catcgagatc gagctagctg attggatgta ccgcgagatc acagaaggca agaacccgga 15360
cgtgctgacg gttcaccccg attacttttt gatcgatccc ggcatcggcc gttttctcta 15420
ccgcctggca cgccgcgccg caggcaaggc agaagccaga tggttgttca agacgatcta 15480
cgaacgcagt ggcagcgccg gagagttcaa gaagttctgt ttcaccgtgc gcaagctgat 15540
cgggtcaaat gacctgccgg agtacgattt gaaggaggag gcggggcagg ctggcccgat 15600
cctagtcatg cgctaccgca acctgatcga gggcgaagca tccgccggtt cctaatgtac 15660
ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa ggtcgaaaag gtctctttcc 15720
tgtggatagc acgtacattg ggaacccaaa gccgtacatt gggaaccgga acccgtacat 15780
tgggaaccca aagccgtaca ttgggaaccg gtcacacatg taagtgactg atataaaaga 15840
gaaaaaaggc gatttttccg cctaaaactc tttaaaactt attaaaactc ttaaaacccg 15900
cctggcctgt gcataactgt ctggccagcg cacagccgaa gagctgcaaa aagcgcctac 15960
ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt cggcctatcg cggccgctgg 16020
ccgctcaaaa atggctggcc tacggccagg caatctacca gggcgcggac aagccgcgcc 16080
gtcgccactc gaccgccggc gcccacatca aggcaccctg cctcgcgcgt ttcggtgatg 16140
acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 16200
atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 16260
cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact atgcggcatc 16320
agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag 16380
gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 16440
cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 16500
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 16560
taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 16620
aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 16680
tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 16740
gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 16800
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 16860
cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 16920
atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 16980
tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 17040
ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 17100
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 17160
aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 17220
aaactcacgt taagggattt tggtcatgca ttctaggtac taaaacaatt catccagtaa 17280
aatataatat tttattttct cccaatcagg cttgatcccc agtaagtcaa aaaatagctc 17340
gacatactgt tcttccccga tatcctccct gatcgaccgg acgcagaagg caatgtcata 17400
ccacttgtcc gccctgccgc ttctcccaag atcaataaag ccacttactt tgccatcttt 17460
cacaaagatg ttgctgtctc ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt 17520
ttccgtcttt aaaaaatcat acagctcgcg cggatcttta aatggagtgt cttcttccca 17580
gttttcgcaa tccacatcgg ccagatcgtt attcagtaag taatccaatt cggctaagcg 17640
gctgtctaag ctattcgtat agggacaatc cgatatgtcg atggagtgaa agagcctgat 17700
gcactccgca tacagctcga taatcttttc agggctttgt tcatcttcat actcttccga 17760
gcaaaggacg ccatcggcct cactcatgag cagattgctc cagccatcat gccgttcaaa 17820
gtgcaggacc tttggaacag gcagctttcc ttccagccat agcatcatgt ccttttcccg 17880
ttccacatca taggtggtcc ctttataccg gctgtccgtc atttttaaat ataggttttc 17940
attttctccc accagcttat ataccttagc aggagacatt ccttccgtat cttttacgca 18000
gcggtatttt tcgatcagtt ttttcaattc cggtgatatt ctcattttag ccatttatta 18060
tttccttcct cttttctaca gtatttaaag ataccccaag aagctaatta taacaagacg 18120
aactccaatt cactgttcct tgcattctaa aaccttaaat accagaaaac agctttttca 18180
aagttgtttt caaagttggc gtataacata gtatcgacgg agccgatttt gaaaccgcgg 18240
tgatcacagg cagcaacgct ctgtcatcgt tacaatcaac atgctaccct ccgcgagatc 18300
atccgtgttt caaacccggc agcttagttg ccgttcttcc gaatagcatc ggtaacatga 18360
gcaaagtctg ccgccttaca acggctctcc cgctgacgcc gtcccggact gatgggctgc 18420
ctgtatcgag tggtgatttt gtgccgagct gccggtcggg gagctgttgg ctggct 18476
<210> 2
<211> 7423
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acaaattcgg gtcaaggcgg aagccagcgc gccaccccac gtcagcaaat acggaggcgc 60
ggggttgacg gcgtcacccg gtcctaacgg cgaccaacaa accagccaga agaaattaca 120
gtaaaaaaaa agtaaattgc actttgatcc accttttatt acctaagtct caatttggat 180
cacccttaaa cctatctttt caatttgggc cgggttgtgg tttggactac catgaacaac 240
ttttcgtcat gtctaacttc cctttcagca aacatatgaa ccatatatag aggagatcgg 300
ccgtatacta gagctgatgt gtttaaggtc gttgattgca cgagaaaaaa aaatccaaat 360
cgcaacaata gcaaatttat ctggttcaaa gtgaaaagat atgtttaaag gtagtccaaa 420
gtaaaactta tagataataa aatgtggtcc aaagcgtaat tcactcaaaa aaaatcaacg 480
agacgtgtac caaacggaga caaacggcat cttctcgaaa tttcccaacc gctcgctcgc 540
ccgcctcgtc ttcccggaaa ccgcggtggt ttcagcgtgg cggattctcc aagcagacgg 600
agacgtcacg gcacgggact cctcccacca cccaaccgcc ataaatacca gccccctcat 660
ctcctctcct cgcatcagct ccacccccga aaaatttctc cccaatctcg cgaggctctc 720
gtcgtcgaat cgaatcctct cgcgtcctca aggtacgctg cttctcctct cctcgcttcg 780
tttcgattcg atttcggacg ggtgaggttg ttttgttgct agatccgatt ggtggttagg 840
gttgtcgatg tgattatcgt gagatgttta ggggttgtag atctgatggt tgtgatttgg 900
gcacggttgg ttcgataggt ggaatcgtgg ttaggttttg ggattggatg ttggttctga 960
tgattggggg gaatttttac ggttagatga attgttggat gattcgattg gggaaatcgg 1020
tgtagatctg ttggggaatt gtggaactag tcatgcctga gtgattggtg cgatttgtag 1080
cgtgttccat cttgtaggcc ttgttgcgag catgttcaga tctactgttc cgctcttgat 1140
tgagttattg gtgccatggg ttggtgcaaa cacaggcttt aatatgttat atctgttttg 1200
tgtttgatgt agatctgtag ggtagttctt cttagacatg gttcaattat gtagcttgtg 1260
cgtttcgatt tgatttcata tgttcacaga ttagataatg atgaactctt ttaattaatt 1320
gtcaatggta aataggaagt cttgtcgcta tatctgtcat aatgatctca tgttactatc 1380
tgccagtaat ttatgctaag aactatatta gaatatcatg ttacaatctg tagtaatatc 1440
atgttacaat ctgtagttca tctatataat ctattgtggt aatttctttt tactatctgt 1500
gtgaagatta ttgccactag ttcattctac ttatttctga agttcaggat acgtgtgctg 1560
ttactaccta tctgaataca tgtgtgatgt gcctgttact atctttttga atacatgtat 1620
gttctgttgg aatatgtttg ctgtttgatc cgttgttgtg tccttaatct tgtgctagtt 1680
cttaccctat ctgtttggtg attatttctt gcagtacgta atggactaca aggaccacga 1740
cggggattac aaagaccacg acatagacta caaggatgac gatgacaaaa tggcaccgaa 1800
gaaaaaaagg aaggtcggaa tccatggcgt tccagctgcc gataagaaat attccatcgg 1860
actcgccatt ggcacgaata gcgtcggatg ggctgttatt actgatgagt acaaagttcc 1920
gtctaagaag ttcaaggtgc tgggcaacac agaccgccac agcataaaga aaaatctcat 1980
cggtgcactc cttttcgata gtggggagac tgcagaagcg acaagattga aaaggactgc 2040
gagaaggcgc tatacacggc gtaagaatag aatctgctac cttcaggaga ttttctctaa 2100
cgaaatggct aaggtcgatg acagtttctt tcatagactt gaggaatcgt tcttggttga 2160
ggaggataag aaacatgaga ggcacccgat atttggaaac atcgtggatg aggtcgcata 2220
tcatgaaaag taccccacaa tctaccacct gagaaagaaa ctcgttgatt ccaccgacaa 2280
agcggatttg agactcatct acctcgctct tgcccatatg ataaagttcc gcggacactt 2340
tctgatcgag ggcgacctca accctgataa tagcgacgtc gataagctct tcatccagtt 2400
ggttcaaacc tacaatcagc tctttgagga aaacccaatt aatgctagtg gagtggatgc 2460
aaaagcgata ctgtcggcca gactctccaa gagcagaagg ttggagaacc tgatcgctca 2520
acttcctgga gaaaagaaaa acggtctttt tgggaatttg attgccttgt ctctgggcct 2580
cacaccaaac ttcaagtcaa attttgacct cgctgaggat gccaaacttc agttgtctaa 2640
ggatacctat gatgacgatc ttgacaattt gctggcacaa attggcgacc agtacgcgga 2700
tctgttcctc gcagcgaaga atctgagtga tgctattctc ctttcggaca tactcagggt 2760
taacactgag atcacaaaag cacctttgag tgcgtcgatg attaagcgct atgatgaaca 2820
tcaccaagac ctcactttgc tgaaggccct tgtgcggcag caattgccag agaagtacaa 2880
agaaatcttc tttgaccaat ctaagaacgg atacgctggc tatattgatg gaggagcttc 2940
tcaggaggaa ttctataagt ttatcaaacc tatacttgag aagatggatg gtacagagga 3000
actccttgtt aaattgaaca gagaagattt gctgcgcaag caacggacct ttgacaacgg 3060
atcaattccg catcagatac acctcggcga gcttcatgcc atccttcgcc ggcaggaaga 3120
tttctacccc tttttgaagg acaaccgcga gaagatagaa aaaatcctta cgttccggat 3180
tccttactat gtgggtccat tggcaagggg gaattcccgc tttgcgtgga tgactcggaa 3240
aagcgaggaa actatcacac cgtggaactt cgaggaagtt gtggacaagg gagcttctgc 3300
ccaatcattc attgagagga tgactaactt cgataagaac ctgccgaacg agaaagttct 3360
ccccaagcac tccctccttt acgagtattt caccgtgtat aacgaactta cgaaggttaa 3420
atacgtgact gagggtatga ggaagccagc attcttgagc ggggaacaaa agaaagcgat 3480
tgttgatttg ctgtttaaaa ctaatcgcaa ggtgacagtc aagcagctca aagaggatta 3540
tttcaagaaa attgaatgtt tcgactctgt ggagatatca ggagtcgaag ataggtttaa 3600
cgcttccctt ggcacatacc atgacctcct taagatcatt aaggacaaag atttcctgga 3660
taacgaggaa aatgaggaca tcctcgaaga tattgttctt accttgacgc tgtttgagga 3720
tcgcgaaatg atcgaggaac ggcttaagac gtatgctcac ttgttcgacg ataaggttat 3780
gaagcagctc aagcgtagaa ggtacactgg atggggccgt ctgtctagaa agctcatcaa 3840
cggaatacgt gataaacaaa gtggcaagac aattttggat tttctgaagt cggacggatt 3900
cgccaacaga gcttttgcgg cactgattgc tgacgatagt ctcaccttca aagaggacat 3960
acagaaggct caagtgagtg gtcaagggga ttcgctgcat gaacacatcg caaacctcgc 4020
gggttcaccg gccataaaga aaggaatcct tcaaactgtt aaggtcgttg atgagttggt 4080
taaagtgatg ggtaggcaca agcccgaaaa catagtgatc gagatggctc gcgaaaatca 4140
gactacacaa aaagggcaga agaactctcg cgagcggatg aaaaggattg aggaaggaat 4200
caaggaactg ggctcacaga ttctcaaaga gcatccagtc gaaaacacac agctgcaaaa 4260
tgagaagctc tatctttact atctccaaaa tggccgggac atgtatgttg atcaggagct 4320
tgacatcaac cgtttgtccg actatgatgt ggaccacatt gtcccgcaat ctttccttaa 4380
ggacgattca atcgataata aggtgttgac ccggagcgat aaaaaccgtg gaaagtctga 4440
caatgtccct tcagaggaag tggttaagaa gatgaagaac tactggagac aattgctgaa 4500
tgcaaaactg atcacacaga gaaagttcga caacctcacc aaagcagaga gaggtgggct 4560
cagtgaactt gataaagcgg gcttcattaa gcgtcagctc gttgagacta gacagatcac 4620
gaagcatgtc gcgcagattt tggattcgcg gatgaacacg aagtacgacg agaatgataa 4680
actgatacgt gaagtcaagg ttatcactct taagtccaaa ttggtgagcg atttcagaaa 4740
ggacttccaa ttctataagg tcagggagat caacaattat catcacgctc acgatgccta 4800
ccttaatgct gttgtgggga ccgcccttat taagaaatac cctaaattgg agtctgaatt 4860
cgtttacggg gattataagg tctacgacgt taggaaaatg atagctaaga gtgagcagga 4920
gatcggtaaa gcaactgcga agtatttctt ttactcgaac atcatgaatt tctttaagac 4980
cgagataacg ctggcaaatg gcgaaattag aaagaggcct ctcatagaga ctaacggtga 5040
gacaggggaa atcgtctggg ataagggtag ggactttgcg acagtgcgca aggtcctctc 5100
tatgccgcaa gttaatattg tgaagaaaac cgaggtgcag acgggaggct tctccaagga 5160
aagcatactt cccaaacgga actctgataa gttgatcgct cgtaagaaag attgggaccc 5220
taagaaatat ggtgggttcg attccccaac tgttgcttac agcgtgctgg tcgttgccaa 5280
ggtcgagaag ggtaaatcca agaaactcaa aagcgttaag gaactccttg ggattactat 5340
catggagaga tcttcattcg aaaagaatcc tatcgacttt cttgaggcca aaggatataa 5400
ggaagttaag aaagatctga taatcaaact cccaaagtac tcattgtttg agctggaaaa 5460
cggcaggaag cgcatgcttg cttccgccgg agagttgcag aaagggaacg agttggctct 5520
gccttctaag tatgttaact tcctctatct tgcctctcat tacgagaagc tcaaaggctc 5580
accagaggac aacgaacaga aacaactttt tgtcgagcaa cataagcact atttggatga 5640
gattatagaa cagatcagtg aattctcgaa aagggttatc cttgcagatg cgaatcttga 5700
caaggtgttg tctgcataca acaaacatag agataagccg atcagggagc aagcggaaaa 5760
tatcattcac ctcttcactc ttacaaactt gggtgctccc gctgccttca agtattttga 5820
taccacgatt gaccggaaac gttacacctc aacgaaggag gtgctggatg ccaccctcat 5880
ccaccaatct attaccggac tctacgagac tagaatcgat ctctcacagc tcggcgggga 5940
taaaagacca gcagcgacga aaaaggcagg acaggctaag aagaagaaag agctcggagg 6000
aggaggcacg ggaggaggag gctccgccga gtatgtgcgc gcgctcttcg acttcaacgg 6060
caatgacgag gaggatctcc ctttcaagaa gggcgacatc ctccgcatcc gcgataagcc 6120
ggaggagcag tggtggaacg cagaggactc cgagggcaag cggggcatga tcctggtgcc 6180
atacgtcgag aagtacagcg gcgattacaa ggaccacgat ggcgactaca aggatcatga 6240
catcgattac aaggacgatg acgataagtc cggcgtcgac atgacggacg cggagtatgt 6300
gcgcatccac gagaagctcg atatctacac cttcaagaag cagttcttca acaataagaa 6360
gtcggtgtcc catcggtgct acgtcctctt cgagctgaag cgcaggggag agcgccgcgc 6420
ctgcttctgg ggctacgcgg tgaataagcc gcagtcaggc acagagcgcg gcatccacgc 6480
cgagatcttc tcgatccgga aggtcgagga gtacctccgc gacaacccag gccagttcac 6540
gatcaattgg tactccagct ggtccccttg cgcagattgc gcagagaaga tcctcgagtg 6600
gtacaaccag gagctgaggg gcaatggcca taccctcaag atctgggcct gcaagctgta 6660
ctacgagaag aacgcgagga atcagatcgg cctctggaac ctgcgggata atggcgtggg 6720
cctcaacgtg atggtgtccg agcactacca gtgctgccgc aagatcttca tccagtcctc 6780
ccacaatcag ctgaacgaga ataggtggct cgaaaagacc ctgaagcgcg ccgagaagtg 6840
gaggagcgag ctgtctatca tgatccaggt caagatcctg cacaccacaa agtcaccggc 6900
ggtgggcggc ggcggcagcg aattctccgg cggcagcacg aacctcagcg acatcatcga 6960
gaaggagaca ggcaagcagc tcgtgatcca ggagtctatc ctcatgctgc ctgaggaggt 7020
ggaggaggtc atcggcaaca agccggagtc cgatatcctc gtgcacaccg cctacgacga 7080
gtcgacagat gagaatgtca tgctcctgac ctccgacgca ccagagtaca agccatgggc 7140
gctcgtgatc caggattcca acggcgagaa taagatcaag atgctgtctg gcggctcccc 7200
gaagaagaag cgcaaggtct agactagtct gaaatcacca gtctctctct acaaatctat 7260
ctctctctat aataatgtgt gagtagttcc cagataaggg aattagggtt cttatagggt 7320
ttcgctcatg tgttgagcat ataagaaacc cttagtatgt atttgtattt gtaaaatact 7380
tctatcaata aaatttctaa ttcctaaaac caaaatccag tgg 7423
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tagcgacggc gagcaagtgg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgatgacggc gagcaagtgg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cggcagcggc gagcaagtgg 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cggcgatagc gagcaagtgg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cggcgacgat gagcaagtgg 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cggcgacggc aggcaagtgg 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cggcgacggc gaataagtgg 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cggcgacggc gagcgggtgg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cggcgacggc gagcaaacgg 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cggcgacggc gagcaagtaa 20
<210> 13
<211> 1833
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 13
Met Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp
1 5 10 15
Tyr Lys Asp Asp Asp Asp Lys Met Ala Pro Lys Lys Lys Arg Lys Val
20 25 30
Gly Ile His Gly Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu
35 40 45
Ala Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr
50 55 60
Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His
65 70 75 80
Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu
85 90 95
Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr
100 105 110
Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu
115 120 125
Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe
130 135 140
Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn
145 150 155 160
Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His
165 170 175
Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu
180 185 190
Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu
195 200 205
Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe
210 215 220
Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile
225 230 235 240
Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser
245 250 255
Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys
260 265 270
Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr
275 280 285
Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln
290 295 300
Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln
305 310 315 320
Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser
325 330 335
Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr
340 345 350
Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His
355 360 365
Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu
370 375 380
Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly
385 390 395 400
Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys
405 410 415
Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu
420 425 430
Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser
435 440 445
Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg
450 455 460
Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu
465 470 475 480
Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg
485 490 495
Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile
500 505 510
Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln
515 520 525
Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu
530 535 540
Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr
545 550 555 560
Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro
565 570 575
Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe
580 585 590
Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe
595 600 605
Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp
610 615 620
Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile
625 630 635 640
Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu
645 650 655
Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu
660 665 670
Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys
675 680 685
Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys
690 695 700
Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp
705 710 715 720
Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Ala Phe Ala Ala Leu Ile
725 730 735
Ala Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val
740 745 750
Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly
755 760 765
Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp
770 775 780
Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile
785 790 795 800
Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser
805 810 815
Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser
820 825 830
Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu
835 840 845
Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp
850 855 860
Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile
865 870 875 880
Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu
885 890 895
Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu
900 905 910
Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala
915 920 925
Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg
930 935 940
Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu
945 950 955 960
Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser
965 970 975
Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val
980 985 990
Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp
995 1000 1005
Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His
1010 1015 1020
Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr
1025 1030 1035 1040
Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp
1045 1050 1055
Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr
1060 1065 1070
Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu
1075 1080 1085
Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr
1090 1095 1100
Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala
1105 1110 1115 1120
Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys
1125 1130 1135
Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys
1140 1145 1150
Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys
1155 1160 1165
Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val
1170 1175 1180
Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys
1185 1190 1195 1200
Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn
1205 1210 1215
Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp
1220 1225 1230
Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly
1235 1240 1245
Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu
1250 1255 1260
Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His
1265 1270 1275 1280
Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu
1285 1290 1295
Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile
1300 1305 1310
Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys
1315 1320 1325
Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln
1330 1335 1340
Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro
1345 1350 1355 1360
Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr
1365 1370 1375
Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr
1380 1385 1390
Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys
1395 1400 1405
Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu
1410 1415 1420
Leu Gly Gly Gly Gly Thr Gly Gly Gly Gly Ser Ala Glu Tyr Val Arg
1425 1430 1435 1440
Ala Leu Phe Asp Phe Asn Gly Asn Asp Glu Glu Asp Leu Pro Phe Lys
1445 1450 1455
Lys Gly Asp Ile Leu Arg Ile Arg Asp Lys Pro Glu Glu Gln Trp Trp
1460 1465 1470
Asn Ala Glu Asp Ser Glu Gly Lys Arg Gly Met Ile Leu Val Pro Tyr
1475 1480 1485
Val Glu Lys Tyr Ser Gly Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys
1490 1495 1500
Asp His Asp Ile Asp Tyr Lys Asp Asp Asp Asp Lys Ser Gly Val Asp
1505 1510 1515 1520
Met Thr Asp Ala Glu Tyr Val Arg Ile His Glu Lys Leu Asp Ile Tyr
1525 1530 1535
Thr Phe Lys Lys Gln Phe Phe Asn Asn Lys Lys Ser Val Ser His Arg
1540 1545 1550
Cys Tyr Val Leu Phe Glu Leu Lys Arg Arg Gly Glu Arg Arg Ala Cys
1555 1560 1565
Phe Trp Gly Tyr Ala Val Asn Lys Pro Gln Ser Gly Thr Glu Arg Gly
1570 1575 1580
Ile His Ala Glu Ile Phe Ser Ile Arg Lys Val Glu Glu Tyr Leu Arg
1585 1590 1595 1600
Asp Asn Pro Gly Gln Phe Thr Ile Asn Trp Tyr Ser Ser Trp Ser Pro
1605 1610 1615
Cys Ala Asp Cys Ala Glu Lys Ile Leu Glu Trp Tyr Asn Gln Glu Leu
1620 1625 1630
Arg Gly Asn Gly His Thr Leu Lys Ile Trp Ala Cys Lys Leu Tyr Tyr
1635 1640 1645
Glu Lys Asn Ala Arg Asn Gln Ile Gly Leu Trp Asn Leu Arg Asp Asn
1650 1655 1660
Gly Val Gly Leu Asn Val Met Val Ser Glu His Tyr Gln Cys Cys Arg
1665 1670 1675 1680
Lys Ile Phe Ile Gln Ser Ser His Asn Gln Leu Asn Glu Asn Arg Trp
1685 1690 1695
Leu Glu Lys Thr Leu Lys Arg Ala Glu Lys Trp Arg Ser Glu Leu Ser
1700 1705 1710
Ile Met Ile Gln Val Lys Ile Leu His Thr Thr Lys Ser Pro Ala Val
1715 1720 1725
Gly Gly Gly Gly Ser Glu Phe Ser Gly Gly Ser Thr Asn Leu Ser Asp
1730 1735 1740
Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val Ile Gln Glu Ser Ile
1745 1750 1755 1760
Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu
1765 1770 1775
Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn
1780 1785 1790
Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu
1795 1800 1805
Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly
1810 1815 1820
Gly Ser Pro Lys Lys Lys Arg Lys Val
1825 1830

Claims (10)

1. The fusion protein consists of nickase, cytosine nucleoside deaminase PmCDA1 and uracil DNA glucoamylase inhibitor UGI; the nicking enzyme, the cytosine nucleoside deaminase PmCDA1 and the uracil DNA glucoamylase inhibitor UGI in the fusion protein are sequentially arranged from the N end; the nicking enzyme is shown as amino acids from 1 st to 1423 rd positions of the N end of a sequence 13 in a sequence table.
2. A gene encoding the fusion protein of claim 1.
3. A base editing system comprising the fusion protein of claim 1.
4. The base editing system according to claim 3, wherein: the system also includes a sgRNA.
5. A recombinant expression vector, expression cassette or recombinant bacterium for expressing the base editing system of claim 3 or 4.
6. A recombinant expression vector for genome base substitution comprises an expression cassette A and an expression cassette B; the expression cassette A expresses the fusion protein of claim 1; the expression cassette B comprises n elements B; the element b comprises sgRNA and a target sequence; the recombinant expression vector can target n different target sequences for base substitution.
7. A method of base substitution in a plant genome comprising the steps of: the base substitution of plant genome is accomplished by using the base editing system of claim 3 or 4.
8. A method of base substitution in a plant genome comprising the steps of: the recombinant expression vector of claim 6 is introduced into a plant of interest to effect base substitution of the plant genome.
9. The nicking enzyme is shown as amino acids from 1 st to 1423 rd position of the N end of a sequence 13 in a sequence table.
10. Use of the fusion protein of claim 1 or the base editing system of claim 3 or 4 or the recombinant expression vector, expression cassette or recombinant bacterium of claim 5 or the recombinant expression vector of claim 6 or the nicking enzyme of claim 9 for base replacement in a plant genome; the base substitution is a substitution of base C to T.
CN201811122909.9A 2018-09-26 2018-09-26 Nicking enzyme and application thereof in genome base replacement Active CN109265562B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811122909.9A CN109265562B (en) 2018-09-26 2018-09-26 Nicking enzyme and application thereof in genome base replacement

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811122909.9A CN109265562B (en) 2018-09-26 2018-09-26 Nicking enzyme and application thereof in genome base replacement

Publications (2)

Publication Number Publication Date
CN109265562A CN109265562A (en) 2019-01-25
CN109265562B true CN109265562B (en) 2021-03-30

Family

ID=65198467

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811122909.9A Active CN109265562B (en) 2018-09-26 2018-09-26 Nicking enzyme and application thereof in genome base replacement

Country Status (1)

Country Link
CN (1) CN109265562B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108350449A (en) * 2015-08-28 2018-07-31 通用医疗公司 The CRISPR-Cas9 nucleases of engineering
WO2018156818A1 (en) * 2017-02-22 2018-08-30 Io Biosciences, Inc. Nucleic acid constructs comprising gene editing multi-sites and uses thereof
CN108513575A (en) * 2015-10-23 2018-09-07 哈佛大学的校长及成员们 Nucleobase editing machine and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2894668A1 (en) * 2012-12-12 2014-06-19 The Broad Institute, Inc. Crispr-cas systems and methods for altering expression of gene products in eukaryotic cells
US9926546B2 (en) * 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108350449A (en) * 2015-08-28 2018-07-31 通用医疗公司 The CRISPR-Cas9 nucleases of engineering
CN108513575A (en) * 2015-10-23 2018-09-07 哈佛大学的校长及成员们 Nucleobase editing machine and application thereof
WO2018156818A1 (en) * 2017-02-22 2018-08-30 Io Biosciences, Inc. Nucleic acid constructs comprising gene editing multi-sites and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Enhanced proofreading governs CRISPR-Cas9 targeting accuracy;Janice S.Chen等;《Nature》;20171019;第550卷(第7676期);第4页第2段 *

Also Published As

Publication number Publication date
CN109265562A (en) 2019-01-25

Similar Documents

Publication Publication Date Title
CN110577965B (en) Application of xCas9n-epBE base editing system in gene editing
CN1643147B (en) Methods and means for monitoring and modulating gene silencing
CN106939316B (en) Method for site-directed knockout of rice OsPDCD5 gene second exon by CRISPR/Cas9 system
US20030049835A1 (en) Methods and means for producing efficient silencing construct using recombinational cloning
CN109722439B (en) Application of MLO2, MLO6 and MLO12 genes of tobacco in preparation of powdery mildew resistant tobacco variety and method thereof
CN113512577A (en) Methods for nucleic acid assembly and high throughput sequencing
CN110724685A (en) Transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence and application thereof
CN110878322B (en) Double-plasmid system for Klebsiella pneumoniae gene editing
CN109355306B (en) Upland cotton transformation event ICR24-397 and specificity identification method thereof
CN109266686A (en) A kind of method of genome nucleotide fixed point replacement
CN114438104A (en) SlGRAS9 gene for regulating sugar content of tomato fruits and application of SlGRAS9 gene in cultivation of tomatoes with high sugar content
AU2005252598A1 (en) Transformation vectors
CN109666693B (en) Application of MG132 in editing receptor genome by base editing system
CN109666694B (en) Application of SCR7 in editing receptor genome by base editing system
CN109265562B (en) Nicking enzyme and application thereof in genome base replacement
CN114763556B (en) Guide base editing system with improved gene editing efficiency and application thereof
CN111560373B (en) Plant constitutive promoter OsUbipro and application thereof
KR20240009946A (en) Redox-sensitive CRALBP mutant protein
CN112680474A (en) Fluorescent-labeled CRISPR/SpCas9 system-mediated gene replacement system and application thereof in plants
CN111607545B (en) Recombinant bacterium for high-yield farnesene as well as construction method and application thereof
CN113881670B (en) Construction method of transgenic plant resisting soybean mosaic virus
CN108728389B (en) Escherichia coli engineering bacterium for producing 2,3,5, 6-tetramethylpyrazine and application thereof
CN114369560A (en) Method for improving biological indigo yield
CN114686454B (en) PE-P3 guided editing system and application thereof in genome base editing
CN113215160A (en) Plant-derived promoter, expression vector and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant