CN110229843B - Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof - Google Patents
Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof Download PDFInfo
- Publication number
- CN110229843B CN110229843B CN201910270483.XA CN201910270483A CN110229843B CN 110229843 B CN110229843 B CN 110229843B CN 201910270483 A CN201910270483 A CN 201910270483A CN 110229843 B CN110229843 B CN 110229843B
- Authority
- CN
- China
- Prior art keywords
- cotton
- sequence
- 19pfa1
- transgenic cotton
- dna fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
- C12N15/8275—Glyphosate
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a upland cotton transformation event 19PFA1-135-17 and a specificity identification method thereof. The EPSPS gene is introduced into the upland cotton CCRI24, so that the gene is overexpressed in the upland cotton CCRI24 to obtain the transgenic cotton, wherein the transgenic cotton is obtained by inserting an exogenous DNA fragment shown in a sequence 1 into positions 38496180-38496245 of chromosome A10 of a target cotton genome and replacing a base sequence of 64bp between positions 38496180-38496245 of chromosome A10. Experiments prove that the transgenic cotton has high glyphosate resistance, the number of the nodes, the fruit branches and the bolls of the first fruit branch is higher than that of the cotton CCRI24, and the plant height and the length of the first fruit branch are lower than that of the cotton CCRI24. The invention lays a foundation for cultivating the transgenic cotton with glyphosate resistance and has important application value.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an upland cotton transformation event 19PFA1-135-17 and a specificity identification method thereof.
Background
Transformation events are molecular structures consisting of foreign genes and flanking regions upstream and downstream of the genomic insertion site. Generally, transformation of a plant with a foreign gene results in a population of transformants that contains a number of independent events, each of which is unique. Expression of the foreign gene in the plant is affected by the chromosomal location into which the foreign gene is inserted. This may result from the chromatin structure or the influence of transcriptional regulatory elements near the integration site. The expression levels of the same gene in different transformation events vary greatly, and there may also be differences in the spatial or temporal pattern of expression. Moreover, the insertion of foreign genes may also affect the expression of endogenous genes. Thus, the effect of each independent transformation event on the recipient plant is different. The obtained plant transformation event which can effectively express the exogenous gene and does not influence the agronomic characters of the plant has important application value in cultivating new varieties of transgenic crops.
China is the biggest cotton producing and consuming country in the world, and is also the biggest textile and clothing producing and exporting country. The total cotton yield accounts for about 25% of the world cotton yield. The growth and decline of cotton production have certain influence on the development of national economy of China and even the improvement of the living level of people. Weeds seriously threaten the yield and quality of cotton. On one hand, it compete for light, water and nutrients with crops, and on the other hand, it can be used as intermediate host of crop diseases and pests to spread diseases and pests. In developed countries, the herbicide is used in the area of 100% and the amount of herbicide sold is 60-70% of the total amount of agricultural chemicals sold. In recent years, along with the gradual expansion of the popularization area of the oriented spraying technology between cotton lines, the use amount of various biocidal herbicides in China also tends to increase year by year.
The herbicide-resistant cotton is planted, so that the weed control spectrum of a cotton field can be expanded, the weed control in the field becomes simple and easy, and the method is an effective way for reducing the weeding cost and improving the cotton planting benefit. Glyphosate (glyphosate) is a systemic broad-spectrum herbicide widely used at present, and inhibits the synthesis of aromatic amino acids by inhibiting the activity of 5-enol pyruvyl-shikimate-3-phosphate synthase (EPSPS) in the synthetic pathway of aromatic amino acids in plants, thereby killing weeds and having no selectivity to plants. Technologists at home and abroad successively create herbicide-resistant cotton germplasm for transferring genes such as G6-EPSPS, CP4-EPSPS, GR79-EPSPS and the like, and lay a foundation for cultivating glyphosate-resistant cotton varieties with independent intellectual property rights in China. In recent years, the planting area of crops such as corn, soybean and rape with the glyphosate-resistant herbicide is increased year by year, and the economic benefit is obvious, so that the cultivation of domestic glyphosate-resistant cotton varieties with independent rights is urgent to meet the competitive demand of new cotton production.
Disclosure of Invention
The invention aims to provide a method for cultivating transgenic cotton with herbicide resistance.
The invention firstly protects a method for cultivating transgenic cotton, which is characterized in that an exogenous DNA fragment is inserted into the position 38496180-38496245 of the A10 th chromosome of a target cotton genome, and a 64bp base sequence between 38496180-38496245 of the A10 th chromosome is replaced to obtain the transgenic cotton;
the glyphosate resistance and/or the number of the first fruit branch growing nodes and/or the number of fruit branches and/or the number of bolls of the transgenic cotton are higher than those of the target cotton; the plant height and/or the length of the first fruit branch of the transgenic cotton is lower than that of the target cotton;
the exogenous DNA fragment may be a DNA molecule containing an EPSPS gene. The nucleotide sequence of the EPSPS gene is shown as 3658-5146 th nucleotides from the 5' end of a sequence 1 in a sequence list.
In the above breeding method, the foreign DNA fragment may be introduced into the cotton of interest by a recombinant vector containing the foreign DNA fragment. The recombinant vector containing the exogenous DNA fragment can be obtained by inserting the expression cassette A between EcoRI and HindIII enzyme cutting sites of the pCambia1300 vector and keeping other sequences of the pCambia1300 vector unchanged; the nucleotide sequence of the expression cassette A is shown as 2942-5456 th from 5' end of the sequence 1 in the sequence table. The nucleotide sequence of the recombinant vector containing the exogenous DNA fragment can be shown as a sequence 4 in a sequence table.
In the above breeding method, the nucleotide sequence of the exogenous DNA fragment may be represented by sequence 1 in the sequence table.
The cultivation method specifically comprises the steps of inserting the exogenous DNA molecule shown in the sequence 1 in the sequence table into the position 38496180-38496245 of the A10 th chromosome of the target cotton genome (the 5 'end of the exogenous DNA molecule shown in the sequence 1 in the sequence table is adjacent to the position 38496245 of the A10 th chromosome, and the 3' end of the exogenous DNA molecule shown in the sequence 1 in the sequence table is adjacent to the position 38496180 of the A10 th chromosome), replacing the base sequence of 64bp in the position 38496180-38496245 of the A10 th chromosome, and obtaining the transgenic cotton.
The preservation number of any one of the transgenic cotton in the China center for type culture Collection is CCTCC NO: P201905.
The invention also provides a method for identifying whether a plant sample is derived from the transgenic cotton or the progeny thereof, which comprises the following steps: detecting whether the genome DNA of the plant sample to be detected contains a DNA fragment A; the DNA fragment A consists of the upstream flanking fragment of any one of the exogenous DNA fragments in the transgenic cotton, the exogenous DNA fragment and the downstream flanking fragment of the exogenous DNA fragment in the transgenic cotton;
if the genomic DNA of the plant sample to be detected contains the DNA fragment A, the plant sample to be detected is or is selected as the transgenic cotton or the descendant thereof;
and if the genomic DNA of the plant sample to be detected does not contain the DNA fragment A, the plant sample to be detected is not the transgenic cotton or the progeny thereof or is not a candidate.
The upstream flanking segment of any one of the exogenous DNA segments in the transgenic cotton can be any one DNA segment with the length of 0-5Kb obtained by extending the A10 th chromosome of the target cotton genome from the 38496245 th nucleotide to the 3' direction of the chromosome.
The downstream flanking segment of any one of the exogenous DNA segments in the transgenic cotton can be any DNA segment with the length of 0-5Kb obtained by extending the chromosome A10 of the target cotton genome from the 38496180 bit nucleotide to the 5' direction of the chromosome A10.
The nucleotide sequence of any upstream flanking sequence can be shown as a sequence 2 in a sequence table.
The nucleotide sequence of any one of the downstream flanking sequences can be shown as a sequence 3 in a sequence table.
Above, the higher resistance of the transgenic cotton to glyphosate than the cotton of interest can be embodied as: compared with the target cotton, the resistance of the transgenic cotton to the glyphosate is obviously increased (namely after the glyphosate is smeared on the transgenic cotton, the death rate of leaves of the transgenic cotton is low or the whole growth vigor of the transgenic cotton is good). The glyphosate resistance of the transgenic cotton is obviously improved, and the transgenic cotton can be used for cultivating glyphosate-resistant cotton in production.
In the above method, the method for detecting whether the genomic DNA of the plant sample to be tested contains the DNA fragment a may be S1), S2) or S3).
S1) direct sequencing.
S2) carrying out PCR amplification on the genome DNA of the plant sample to be detected by using the primer pair 1 and/or the primer pair 2, and then judging as follows: if the target amplification product is obtained, the plant sample to be detected is or is selected as the transgenic cotton or the descendant of the transgenic cotton; if there is no target amplification product, the plant sample to be tested is not or is not a candidate for the transgenic cotton or the progeny thereof;
the primer pair 1 can be a primer pair capable of amplifying a DNA molecule A consisting of the 5' end of the exogenous DNA fragment and a part or all of the fragment of the upstream flanking sequence of the exogenous DNA fragment; the corresponding target amplification product is the DNA molecule A;
the primer pair 2 can be a primer pair which can amplify a DNA molecule B comprising the 3' end of the exogenous DNA fragment and a part or all of the downstream flanking sequence of the exogenous DNA fragment; the corresponding target amplification product is the DNA molecule B.
S3) carrying out Southern blot hybridization on the genomic DNA of the plant sample to be detected by using a probe capable of specifically binding the DNA molecule A or the DNA molecule B, and then carrying out judgment as follows: if the hybrid fragment can be obtained, the plant sample to be detected is or is selected as the transgenic cotton or the descendant thereof; and if the hybrid fragment cannot be obtained, the plant sample to be tested is not or is not a candidate to be the transgenic cotton or the descendant thereof.
The primer pair 1 can be composed of a single-stranded DNA molecule shown in a sequence 5 in a sequence table and a single-stranded DNA molecule shown in a sequence 7 in the sequence table. The primer pair 2 can be composed of a single-stranded DNA molecule shown in a sequence 6 in a sequence table and a single-stranded DNA molecule shown in a sequence 8 in the sequence table.
The invention also provides a kit for identifying whether a plant sample to be detected is derived from the transgenic cotton obtained by the culture method or the progeny thereof, which comprises any one of the primer pair 1 and/or the primer pair 2.
The invention also provides a method for obtaining cotton with improved glyphosate resistance and/or improved first fruit branch survival node and/or improved fruit branch number and/or improved boll number and/or reduced plant height and/or reduced first fruit branch length, which comprises the following steps:
(1) Obtaining transgenic cotton according to any of the above described methods of culturing;
(2) Selfing or hybridizing the transgenic cotton to obtain breeding progeny, and identifying the breeding progeny according to any one of the methods to obtain a target plant.
In the method, the preservation number of the transgenic cotton in China center for type culture Collection is CCTCC NO: P201905.
The invention also protects any one of D1) to D6).
D1 Application of the transgenic cotton obtained by adopting any one of the breeding methods in cotton breeding.
D2 Application of any one of the exogenous DNA fragments in regulation and control of glyphosate resistance of cotton.
D3 Use of any one of the above exogenous DNA fragments in regulating and controlling the number of growing nodes and/or fruit branches and/or bolls and/or plant height of first fruit branches of cotton.
D4 Use of any one of the above exogenous DNA fragments in identifying whether a plant sample to be tested is derived from transgenic cotton or progeny thereof obtained by any one of the above culturing methods.
D5 Use of any of the primer pairs 1 and/or 2) described above in identifying whether a plant sample to be tested is derived from transgenic cotton obtained by any of the breeding methods described above or progeny thereof.
D6 Use of any of the upstream flanking sequences and/or the downstream flanking sequences described above in the identification of whether a plant sample to be tested is derived from transgenic cotton or progeny thereof obtained by any of the breeding methods described above.
Above, the target cotton may be upland cotton. The upland cotton can be particularly the upland cotton CCRI24.
The invention leads the EPSPS gene into the upland cotton CCRI24, so that the EPSPS gene is over-expressed in the upland cotton CCRI24 to obtain transgenic cotton 19PFA1-135-17, wherein the transgenic cotton 19PFA1-135-17 is obtained by inserting an exogenous DNA fragment into the position 38496180-38496245 of the chromosome A10 of a target cotton genome and replacing the base sequence of 64bp between the position 38496180-38496245 of the chromosome A10 to obtain the cotton. Experiments prove that compared with cotton CCRI24, the glyphosate resistance of the transgenic cotton 19PFA1-135-17 is improved, the survival node, the fruit branch number and the bearing number of the first fruit branch are also obviously improved, and the plant height and the first fruit branch length are obviously reduced. The invention lays a foundation for cultivating the transgenic cotton with glyphosate resistance and has important application value.
Drawings
FIG. 1 is a sequence analysis of 19PFA1-135-17.
FIG. 2 shows the identification of field positive molecules and the molecular verification of the insertion of the RB flanking sequence into the genome of transgenic cotton 19PFA1-135-17.
FIG. 3 shows the results of the identification of glyphosate resistance of T5-generation glyphosate-transgenic cotton homozygous lines 19PFA1-135-17 and upland cotton CCRI24.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are all conventional ones unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
The upland cotton CCRI24 of the following examples is disclosed in "PAG1, a cotton fibrous gene, models fiber electrophoresis", publicly available from the Cotton research institute of the Chinese academy of agricultural sciences ".
Agrobacterium LBA4404 in the examples described below is disclosed in the literature "structural expression of the viral genes improvements of the plant transformation by Agrobacterium", publicly available from the Cotton research institute of the national academy of agricultural sciences.
The nucleotide sequences of the primers referred to in the examples below are shown in Table 1.
TABLE 1
| Nucleotide sequence (5 '-3') | Position in | ||
| Primer | |||
| 1 | GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT | - | |
| |
ACCAGCCC | - | |
| |
GTAATACGACTCACTATAGGGC | - | |
| Primer 4 | ACTATAGGGCACGCGTGGT | - | |
| |
gccgaacttggttccttatataggaaaactc | - | |
| Primer 6 | gtctctttcacaatcaccgaccttatcttc | - | |
| Primer 7 | | Sequence | 5 |
| Primer 8 | ggctaccgcctaataggagctcgagtttct | - | |
| Primer 9 | ctaataggagctcgagtttctccataataa | - | |
| Primer 10 | cctatagggtttcgctcatgtgttgagca | Sequence 6 | |
| Primer 11 | TCATCCACACTATCTAAGCCC | Sequence 7 | |
| Primer 12 | CAGTTGGTTGTGAATGGGAG | Sequence 8 |
Note: "-" means absent.
Example 1 EPSPS transgenic Cotton harvesting and agronomic traits analysis
1. Obtaining EPSPS-converted cotton
1. Construction of recombinant vectors
The expression cassette A was inserted into the EcoRI and HindIII cleavage sites of the pCambia1300 vector (this plasmid was purchased from Biovector plasmid vector bacterial cell Gene Collection (Biovector plasmid) having a accession number of Biovector plasmid 1300, which is a accession number: biovector 1300) belonging to the genus NTCC type culture Collection, while keeping the other sequences of the pCambia1300 vector unchanged, to obtain a recombinant vector (the nucleotide sequence is shown as sequence 4 in the sequence listing). The nucleotide sequence of the expression cassette A is shown as 2942-5456 th from 5' end of the sequence 1 in the sequence table. The expression cassette A sequentially comprises a CSV-promoter, an EPSPS gene and an NOS terminator from the upstream; wherein the nucleotide sequence of the CSV-promoter is represented by 2942-3657 th nucleotides from the 5' end of a sequence 1 in a sequence table; the nucleotide sequence of the EPSPS gene is shown as 3658-5146 th nucleotides from the 5' end of a sequence 1 in a sequence table; the nucleotide sequence of the NOS terminator is shown as 5201-5453 th nucleotide from 5' terminal of a sequence 1 in a sequence table.
The pCambia1300 vector itself also includes expression cassette B. The expression cassette B comprises, in order from the upstream, the enhanced promoter of CaMV35S of cauliflower mosaic virus, the EPSPS gene and the Ploy A terminator.
2. Obtaining of recombinant bacteria
And (3) introducing the recombinant vector obtained in the step (1) into agrobacterium LBA4404 to obtain a recombinant bacterium.
3. Obtaining EPSPS transgenic cotton
Transforming the recombinant bacteria obtained in the step 2 into explants (1500) of the upland cotton CCRI24 by adopting an agrobacterium-mediated method, culturing and inducing the explants on a culture medium containing glyphosate to form callus, selecting the transformed callus, forming embryogenic callus on a glyphosate screening culture medium from the callus, selecting the surviving embryogenic callus to transform to form regeneration cotton, and finally obtaining 50T 0 generation EPSPS transformed cotton in total and using the cotton for screening.
4. Identification of EPSPS transgenic cotton
(1) The harvested T1 generation EPSPS transgenic cotton seeds are planted in a greenhouse, and greenhouse efficacy analysis and molecular analysis are carried out. Extracting DNA of a T1 generation EPSPS-converted cotton leaf, performing PCR amplification by adopting 5 'AGCACAGCCATCAAGAACTA-3' and 5 'AACATAAGGCGGAAGCGT-3', detecting whether a target gene exists, and counting the separation ratio of materials. Obtaining 12 single copies of the EPSPS transgenic cotton of the T1 generation according to Mendelian genetic law;
(2) Further validation of the 12 single copies of EPSPS transgenic cotton of the T1 generation obtained in the step (1) above was carried out by Taqman PCR and Southern blot. The method comprises the following specific steps: the EPSPS gene expression quantity of the obtained 12 single-copy T1 generation EPSPS cotton materials and the obtained upland cotton CCRI24 materials is analyzed in the beginning of flowering period, and the expression quantity of 9T 1 generation EPSPS cotton in the 12 single-copy T1 generation EPSPS cotton is greatly improved compared with the upland cotton CCRI24.
(3) And (3) determining the agronomic characters and glyphosate resistance of the 9T 1 generation EPSPS transgenic cotton materials obtained in the step (2) in the flowering period. The results show that the first fruit branch survival node, the fruit branch number, the boll number and the glyphosate resistance of the 9T 1 generation EPSPS cotton are obviously improved compared with the cotton CCRI24, and the plant height and the first fruit branch length are obviously reduced compared with the cotton CCRI24.
(4) Agronomic and quality traits and glyphosate resistance of 9T 2 generation EPSPS cotton were evaluated in field trials in the first year in paired plots at the same location. The results show that: the first fruit branch survival node, the fruit branch number, the boll number and the glyphosate resistance of the 9T 2 generation EPSPS transgenic cotton which has 2T 2 generation EPSPS transgenic cotton are obviously improved compared with the cotton CCRI24, and the plant height and the first fruit branch length are obviously reduced compared with the cotton CCRI24.
(5) The agronomic and quality traits and glyphosate resistance of the 2T 2 generation EPSPS cotton plants obtained in step (4) above were evaluated in the field trials of the next year in pairs of plots at the same location. The results show that: compared with the cotton CCRI24, the first fruit branch survival node, the fruit branch number, the boll number and the glyphosate resistance of 1T 2 generation EPSPS-converted cotton in 2T 2 generation EPSPS-converted cotton are obviously improved, and the plant height and the first fruit branch length are obviously reduced compared with the cotton CCRI24. The seeds of the T2 generation EPSPS transgenic cotton are named as 19PFA1-135-17, and the T2 generation EPSPS transgenic cotton 19PFA1-135-17 is subjected to selfing until a T5 generation EPSPS transgenic cotton homozygous strain 19PFA1-135-17 is obtained, which is hereinafter referred to as 19PFA1-135-17.
A T5 generation EPSPS transgenic cotton seed (Gossypumhirsutum L.) 19PFA1-135-17 has been preserved in China center for type culture Collection (CCTCC for short, address: wuhan, china) in 04.02.2019, is classified and named as upland cotton seed ICR24-19PFA1-135-17, and the preservation number is CCTCC NO: P201905.
2. Agronomic character analysis of EPSPS transgenic cotton
1. Identification of glyphosate resistance
In the experiment, the solvent of the glyphosate solution is water, and the concentration is 800PPM.
19PFA1-135-17 and upland cotton CCRI24 are planted in the test field respectively, and random block design is carried out for 3 times. 1m isolation zone is arranged among cells, and the area of the cell is more than or equal to 20m 2 。
The treatment modes are respectively as follows:
treatment 1: clean water (as a control) was applied to the surface of the tender leaves of 19PFA1-135-17 with a brush pen;
and (3) treatment 2: coating glyphosate solution on the surfaces of tender leaves of 19PFA1-135-17 by using a writing brush;
and (3) treatment: applying clear water (as a control) to the surface of the tender leaf of the upland cotton CCRI24 with a writing brush;
and (4) treatment: and (3) coating the surface of the tender leaf of the upland cotton CCRI24 with a glyphosate solution by using a brush pen.
After 3-7 days of smearing, leaf damage was investigated and 19PFA1-135-17 was analyzed for glyphosate resistance.
The results of the resistance identification are shown in Table 2. The results show that the glyphosate resistance of 19PFA1-135-17 is obviously improved compared with the cotton CCRI24.
TABLE 2.19PFA1-135-17 and Glyphosate resistance of upland cotton CCRI24
| Cotton to be tested | Mortality (%) |
| 19PFA1-135-17 | 4.00 |
| Land cotton CCRI24 | 98.00 |
2. Agronomic traits
The T5 generation EPSPS transgenic cotton homozygous line 19PFA1-135-17 and upland cotton CCRI24 are subjected to investigation and determination of other agronomic traits. A plot experiment is designed in Anyang in Henan, 3 plots are set, the 3 plots are completely the same, the plot line length is 8m, 30 plants are planted in each line, the line spacing is 80cm, 3 lines are planted in each material, and the total number of plots is 6. Students' test is adopted to carry out statistical analysis on the growing node, the fruit branch number, the boll number, the plant height and the first fruit branch length of the T5 generation EPSPS cotton homozygous line 19PFA1-135-17 and the upland cotton CCRI24 respectively.
The statistical results are shown in Table 3. The result shows that compared with cotton CCRI24, the first fruit branch growing node, the fruit branch number and the boll number of the T5 generation EPSPS cotton homozygous line 19PFA1-135-17 are remarkably improved, and the plant height and the first fruit branch length are remarkably reduced.
TABLE 3 comparison of agronomic traits of transgenic Cotton 19PFA1-135-17 and upland Cotton CCRI24
3. Influence of other aspects
Since the promoter is a constitutive promoter, the promoter is not only expressed in green tissues (including stems, leaves, buds, growing points), but also other tissues are affected to some extent. In order to investigate whether the EPSPS gene has influence on other tissues besides improving the glyphosate resistance, fiber length, breaking ratio strength, micronaire value, uniformity index and elongation of a T5 generation EPSPS-transformed cotton homozygous line 19PFA1-135-17 and upland cotton CCRI24 were tested.
The statistical results are shown in Table 4. The result shows that compared with the cotton CCRI24, the T5 generation EPSPS cotton homozygous line 19PFA1-135-17 has no obvious difference in fiber length, breaking ratio strength, micronaire value, uniformity index and elongation.
TABLE 4 comparison of fiber quality data for transgenic cotton 19PFA1-135-17 and upland cotton CCRI24
3. Characterization of DNA sequence of 19PFA1-135-17
The 19PFA1-135-17 genome was analyzed for inserts and genomic sequences flanking the inserts by molecular biology. The method comprises the following specific steps:
1. extracting the genome of the cotton. Under greenhouse or field conditions, about 100mg of young cotton leaves of 19PFA1-135-17 were placed in a 2.0ml EP tube, the EP tube was frozen using liquid nitrogen, and then ground using a cryo-grinder, and genomic DNA was extracted using the protocol provided in Qiagen DNeasy Plant Mini Kit (50) (cat # 69104). The method can be modified by those skilled in the art to extract DNA from any tissue, including but not limited to seeds.
2. PCR amplification was performed according to the Genome Walking Kit from Takara. The extracted genomic DNA was divided into 4 tubes, digested with EcoRV, dra I, stu I, pvu II, respectively, the digested product was purified and ligated (ligation of primer 1 and primer 2), followed by 3 rounds of PCR: in the first round, a joint is taken as a template, and primers 3 and 5, 3 and 8 are used for amplification respectively; in the second round, the PCR product of the first round is taken as a template, and the PCR product is amplified by a primer 4, a primer 6, a primer 4 and a primer 9 respectively; the third round takes the second round PCR product as a template, and the PCR products are amplified by using a primer 4 and a primer 7, and a primer 4 and a primer 10 respectively. The amplicons generated from the reactions were separated by agarose gel electrophoresis, then purified using QIAGEN gel purification kit (Qiagen, valencia, CA), cloned into T-cloning vectors according to the protocol provided in the pMD-19T-Simple (cat # D104A) kit of Dalianbao BioBioBiotechnology, inc., and transformed into E.coli DH 5. Alpha. Transformants selected on ampicillin resistant plates and colony PCR was performed, and monoclonal sequencing of positive clones was performed.
The sequencing result shows that: the transgenic cotton 19PFA1-135-17 is obtained by inserting the exogenous DNA molecule shown in the sequence 1 in the sequence table into the position 38496180-38496245 of the chromosome A10 of the CCRI24 genome of the upland cotton (the 5 'end of the exogenous DNA molecule shown in the sequence 1 in the sequence table is adjacent to the position 38496245 of the chromosome A10, the 3' end of the exogenous DNA molecule shown in the sequence 1 in the sequence table is adjacent to the position 38496180 of the chromosome A10 for replacing the position 38496180), and removing the base sequence of 64bp between the positions 38496180-38496245 of the chromosome A10, wherein the nucleotide sequence of the upstream flanking fragment which is upstream from the position 38496245 and is adjacent to the nucleotide 384962496245 is sequence 2, and the nucleotide sequence of the downstream flanking fragment which is downstream from the position 38496180 and is adjacent to the nucleotide 38496180 is sequence 3 (FIG. 1).
Example 2, 19 obtaining and identification of the Properties of the bred offspring from PFA1-135-17 and agronomic trait analysis thereof
1. 19PFA1-135-17 breeding progeny trait acquisition
1. Hybridization of
Removing pollen of the first cotton by manual or artificial action 1 afternoon before flowering, covering the stigma of the flower with a wax tube to prevent the contact of foreign pollen with the stigma, and collecting pollen of the second cotton by manual operation when pollen of the second cotton is scattered the next morning, and contacting the pollen with the style or stigma of the first plant, thereby completing the hybridization process. Wherein, when the first cotton is 19PFA1-135-17 in the embodiment, the second cotton is other cotton, or the second cotton is 19PFA1-135-17, the first cotton is other cotton.
And harvesting the hybrid bolls in the boll opening period, naturally drying the cotton, ginning, and delinting by adopting concentrated sulfuric acid to obtain the hybrid seeds. Planting to obtain hybrid progeny, namely 19PFA1-135-17 breeding progeny.
2. Selfing
Directly clamping a bud of 19PFA1-135-17 by using a self-clamp or binding the bud by using a fine wire 1 day before flowering, and preventing external pollen from contacting with a stigma of 19PFA1-135-17 during flowering; or the whole cotton plant is sleeved by the mesh bag, so that pollination through insects and the like can be effectively prevented, and self-pollination of cotton can be realized. The selfing can be completed through the steps.
And harvesting hybrid bolls in a boll opening period, naturally drying cotton, ginning, delinting by concentrated sulfuric acid to obtain selfed seeds, and planting to obtain selfed progeny, namely 19PFA1-135-17 breeding progeny.
2. Identification of 19PFA1-135-17 breeding progeny character and agronomic character analysis thereof
(I) 19PFA1-135-17 breeding progeny character identification method
The genome DNA of the 19PFA1-135-17 breeding progeny is used as a template, and a specific primer is used for PCR amplification, if the PCR amplification product contains an amplicon (the amplicon refers to one or one section of DNA molecule synthesized by adopting a PCR amplification technology) of the 19PFA1-135-17, the 19PFA1-135-17 breeding progeny has the same character as the 19PFA1-135-17, and if the PCR amplification product does not contain the amplicon of the 19PFA1-135-17, the 19PFA1-135-17 breeding progeny does not have the same character as the 19PFA1-135-17. The specific identification method is as follows:
1. identification method 1
(1) And (3) performing PCR amplification by using the genome DNA of the bred offspring of 19PFA1-135-17 as a template and adopting a primer pair consisting of a primer 7 and a primer 11 to obtain a PCR amplification product.
The PCR amplification system is as follows: 2 XPASTRE PCR MIX 10. Mu.l, primer 7 (10. Mu.M) 0.5. Mu.l, primer 11 (10. Mu.M) 0.5. Mu.l, template DNA (50 ng/. Mu.l) 1. Mu.l, ultrapure water 8. Mu.l, total volume 20. Mu.l.
The PCR reaction conditions were as follows: 5min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 45s at 72 ℃ and 32 cycles; 5min at 72 ℃.
(2) Carrying out agarose gel electrophoresis on the PCR amplification product obtained in the step (1), and then judging as follows: if the PCR amplification product contains a DNA fragment of about 500bp, the result shows that the 19PFA1-135-17 breeding progeny contains the 19PFA1-135-17 amplicon, and the 19PFA1-135-17 breeding progeny has the 19PFA1-135-17 character; otherwise, the 19PFA1-135-17 character was not present.
The results are shown in the left panel of FIG. 2 (M is DNA Marker,1 is the progeny of the 19PFA1-135-17 strain).
2. Identification method 2
(1) And (3) performing PCR amplification by using the genome DNA of 19PFA1-135-17 breeding offspring as a template and adopting a primer pair consisting of a primer 10 and a primer 12 to obtain a PCR amplification product.
The PCR amplification system is as follows: 2 × MASTRE PCR MIX 10 μ l, primer 10 (10 μ M) 0.5 μ l, primer 12 (10 μ M) 0.5 μ l, template DNA (50 ng/. Mu.l) 1 μ l, ultrapure water 8 μ l, and total volume 20 μ l.
The PCR reaction conditions were as follows: 5min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 1min at 72 ℃ and 32 cycles; 5min at 72 ℃.
(2) Carrying out agarose gel electrophoresis on the PCR amplification product obtained in the step (1), and then judging as follows: if the PCR amplification product contains a DNA fragment of about 1000bp, the 19PFA1-135-17 breeding progeny contains the 19PFA1-135-17 amplicon, and the 19PFA1-135-17 breeding progeny has the 19PFA1-135-17 character; otherwise, the 19PFA1-135-17 character was not present.
The results are shown in the right panel of FIG. 2 (M is DNA Marker,2 is the progeny of the 19PFA1-135-17 strain).
(II) analysis of glyphosate resistance and agronomic traits of 19PFA1-135-17 breeding offspring traits
The 19PFA1-135-17 bred progeny with the 19PFA1-135-17 amplicon obtained in step one above and the cotton upland CCRI24 were tested for glyphosate resistance and agronomic performance analysis according to the method of step two of example 1.
The results of glyphosate resistance identification are shown in FIG. 3 and Table 5. The result shows that compared with cotton CCRI24, the glyphosate resistance of 19PFA1-135-17 breeding offspring is obviously improved.
TABLE 5 Glyphosate resistance
| Line number | Mortality (%) |
| 19PFA1-135-17 | 0.00 |
| Land cotton CCRI24 | 100.00 |
The results of the agronomic trait analysis are shown in Table 6. The result shows that compared with the land cotton CCRI24, the first fruit branch growing node, the fruit branch number and the boll number of the 19PFA1-135-17 breeding offspring are remarkably improved, and the plant height and the first fruit branch length are remarkably reduced.
TABLE 6 comparison of agronomic traits of transgenic Cotton 19PFA1-135-17 and upland Cotton CCRI24
<110> Cotton research institute of Chinese academy of agricultural sciences
<120> upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 5678
<212> DNA
<213> Artificial sequence
<400> 1
tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60
gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120
ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180
atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240
cttatctggg aactactcac acattattat ggagaaactc gagcttgtcg atcgactcta 300
gctagaggat cgatccgaac cccagagtcc cgcggcggta gcctcagcgt attcgaatct 360
agcaccaaga gcttcaaggt gagcgaagaa ctgagggtag gactttctga tgtggtgtgc 420
accggtgatt ctaagtggag catctgctct gagaccaaga agggtgagaa gcatgatcat 480
tctgtggtca ccgtgaccat cagcggtgat accaccagca aggtgagcag aaccagtaac 540
ggagagagaa tcggcggtct ctcttgctct aagaccaagt ctttcaagct cagctctggt 600
gtcagagatt ctatcgcatt ccttgagtct aagagtagca acgttttccc aggtggtatc 660
accctcagcg aaggcagcag cagcggtaag agcttgcacg gcgtcggtga aggaatcacc 720
atctctagta acagcgtgga gaggtctacc acctctcacg gtaagggtat caccttctct 780
aacgatatca gcacccatct ctctaagaac gttcacagct tccttctcac cctggaggtc 840
gtgttctcta aggttagaaa gtctaacctc acctgggaga agagcagcgg cggtaaggat 900
agcagcggaa ccagggtaat caccaggaac gagcactcta cctggtctgt acttctgacc 960
accagggatg gagattcttc taaggtcatc ggaggcagta gctctaacac cgaaatcaga 1020
gagggtgtca agtgtctgtc taagaggagc gtgggacttg atatcaccgg tgagtctaag 1080
ttcgagtccg tcaggaagaa gaggaccgag gaacataagg gcggaagcgt actgggagga 1140
tctttcggcg gaaacctcca ctgtaccacc tctaactgga ccggaaacgg agatagggag 1200
tctaccatcg ttggaggaca cccaagcacc aagtctttcg agggcttcaa gaaggtcacc 1260
ctgaggtctc ttaccaaggg aatcagggta atcggtaacg aaagttgtac cagaggtgag 1320
agcagcaaca cccataagga atctggccac tgcaccagcg ttacctgggt taagggtaac 1380
accagcctgt ggtctagcac cgaaacctct gatcacggcg tcatcaccaa caagctcaac 1440
accagcaccc caatctctga ggcatctgag catagcttcg gcatcctcag aggtagccac 1500
accaacaact ctggtttcac cctcagcgag agcagcggcg aggaggtatc tagtggtgta 1560
gttcttggat ggctgtgctc taagttcacc tctgagttct ctagctggat gcacgataac 1620
gtcgaaggta gctggaagag cgtcggatcc cttctccgcc gtggaaacag aagacatgac 1680
cttaagagga cgaagctcag agccaattaa agtcatccca ctcttcttca atccccacga 1740
tgaagaaatt ggataagctc gtggatgctg ctgagtcttc agagaaaccg ataagggaga 1800
tttcctttga ctggatttag agagattgga gataagagat gggttctgca caccattgca 1860
gattctgcta acttgagcca tggtcgatcg acagatctgc gaaagctcga gagagataga 1920
tttgtagaga gagactggtg atttcagcgt gtcctctcca aatgaaatga acttccttat 1980
atagaggaag gtcttgcgaa ggatagtggg attgtgcgtc atcccttacg tcagtggaga 2040
tatcacatca atccacttgc tttgaagacg tggttggaac gtcttctttt tccacgatgc 2100
tcctcgtggg tgggggtcca tctttgggac cactgtcggc agaggcatct tgaacgatag 2160
cctttccttt atcgcaatga tggcatttgt aggtgccacc ttccttttct actgtccttt 2220
tgatgaagtg acagatagct gggcaatgga atccgaggag gtttcccgat attacccttt 2280
gttgaaaagt ctcaatagcc ctttggtctt ctgagactgt atctttgata ttcttggagt 2340
agacgagagt gtcgtgctcc accatgttat cacatcaatc cacttgcttt gaagacgtgg 2400
ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac 2460
tgtcggcaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtagg 2520
tgccaccttc cttttctact gtccttttga tgaagtgaca gatagctggg caatggaatc 2580
cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctt tggtcttctg 2640
agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttggcaa 2700
gctgctctag ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 2760
ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag 2820
ttagctcact cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg 2880
tggaattgtg agcggataac aatttcacac aggaaacagc tatgaccatg attacgaatt 2940
caagcttcca gaaggtaatt atccaagatg tagcatcaag aatccaatgt ttacgggaaa 3000
aactatggaa gtattatgtg aactcagcaa gaagcagatc aatatgcggc acatatgcaa 3060
cctatgttca aaaatgaaga atgtacagat acaagatcct atactgccag aatacgaaga 3120
agaatacgta gaaattgaaa aagaagaacc aggcgaagaa aagaatcttg aagacgtaag 3180
cactgacgac aacaatgaaa agaagaagat aaggtcggtg attgtgaaag agacatagag 3240
gacacatgta aggtggaaaa tgtaagggcg gaaagtaacc ttatcacaaa ggaatcttat 3300
cccccactac ttatcctttt atatttttcc gtgtcactag tgaagacgta agcactgacg 3360
acaacaatga aaagaagaag ataaggtcgg tgattgtgaa agagacatag aggacacatg 3420
taaggtggaa aatgtaaggg cggaaagtaa ccttatcaca aaggaatctt atcccccact 3480
acttatcctt ttatattttt ccgtgtcatt tttgcccttg agttttccta tataaggaac 3540
caagttcggc atttgtgaaa acaagaaaaa atttggtgta agctattttc tttgaagtac 3600
tgaggataca acttcagaga aatttgtaag tttgtagatc taagagtaaa gaagaacaat 3660
ggcttcctct atgctctctt ccgctactat ggttgcctct ccggctcagg ccactatggt 3720
cgctcctttc aacggactta agtcctccgc tgccttccca gccacccgca aggctaacaa 3780
cgacattact tccatcacaa gcaacggcgg aagagttaac tgcatgcagg gatccgacgc 3840
tcttccagct accttcgacg ttatcgtgca tccagctaga gaactcagag gtgaacttag 3900
agcacagcca tccaagaact acaccactag atacctcctc gccgctgctc tcgctgaggg 3960
tgaaaccaga gttgttggtg tggctacctc tgaggatgcc gaagctatgc tcagatgcct 4020
cagagattgg ggtgctggtg ttgagcttgt tggtgatgac gccgtgatca gaggtttcgg 4080
tgctagacca caggctggtg ttacccttaa cccaggtaac gctggtgcag tggccagatt 4140
ccttatgggt gttgctgctc tcacctctgg tacaactttc gttaccgatt accctgattc 4200
ccttggtaag agacctcagg gtgaccttct tgaagccctc gaaagacttg gtgcttgggt 4260
gtcctccaac gatggtagac tccctatctc cgtttccggt ccagttagag gtggtacagt 4320
ggaggtttcc gccgaaagat cctcccagta cgcttccgcc cttatgttcc tcggtcctct 4380
tcttcctgac ggactcgaac ttagactcac cggtgatatc aagtcccacg ctcctcttag 4440
acagacactt gacaccctct ctgatttcgg tgttagagct actgcctccg atgaccttag 4500
aagaatctcc atccctggtg gtcagaagta cagaccaggt agagtgctcg ttcctggtga 4560
ttaccctggt tccgctgcta tccttaccgc cgctgctctt ctcccaggtg aggttagact 4620
ttctaacctt agagaacacg acctccaggg tgagaaggaa gctgtgaacg ttcttagaga 4680
gatgggtgct gatatcgtta gagaaggtga tacccttacc gtgagaggtg gtagacctct 4740
ccacgctgtt actagagatg gtgattcctt caccgacgcc gtgcaagctc ttaccgctgc 4800
tgctgccttc gctgagggtg ataccacctg ggaaaacgtt gctactctta gactcaagga 4860
atgcgataga atctctgaca ccagagctga gcttgaaaga cttggtctta gagcaagaga 4920
gaccgccgat tctctctccg ttactggttc tgctcacctt gctggtggta tcaccgctga 4980
tggtcacggt gaccacagaa tgatcatgct tctcaccctt cttggtctca gagcagatgc 5040
tccacttaga atcaccggtg cacaccacat cagaaagtcc taccctcagt tcttcgctca 5100
ccttgaagct cttggtgcta gattcgaata cgctgaggct accgccaagc tttcaaaacc 5160
aattaagtgt gaattacagg tgaccagctc gaatttcccc gatcgttcaa acatttggca 5220
ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 5280
gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 5340
ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 5400
gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcaagcttg 5460
gcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 5520
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 5580
cgcccttccc aacagttgcg cagcctgaat ggcgaatgct agagcagctt gagggaatta 5640
aactatcagt gtttgacagg atatattggc gggtaaac 5678
<210> 2
<211> 2000
<212> DNA
<213> Artificial sequence
<400> 2
agggttgata agcatgttga acttgttttc tagtaatgta atggaaatgc taatgggtta 60
tgatatatat gtgcatagca ttcgtgcggg ttattataac cgggttaagt cccgaaggca 120
ttcgtgcggg ttattataac cgggttaagt cccgaaggca ttcgtgtggg ttattataac 180
cgggttaagt cccaaaggca ttcgtgctgg ttgttacatc cgagccaaat tctgaaagta 240
tttatgtttg gaaaggtgcg attctgtcgt aataattccg attaatgtgc tcataatccc 300
taatatgacc aggtatggat cgtatataca ttggaaaaat ttggtacagt ataagttgtg 360
attatgtaat ccaataatgc tctcccggcc atttcttagg gttatatgaa gtctatagct 420
cacttgagtt acatgaaatt gattcaaatg aaatttagtt aagtttgact tcgagtgtgt 480
aaacatattg atagaagtgt aaattaaaat gaatatgtga tcttgtgcat aggcatttat 540
ttatccttat gaatgctatt tcttttgtgt ttttgtttca aatgatttcc ttacttataa 600
acttactaag catcaaaaca cttactctgt tgcttaaatt ctcggtatta tagattttgt 660
tcgttagcta tcggactcgg aagtgtcaaa gtcgaagtca tccacactat ctaagcccct 720
ttttgctact cttttagttg aactttgata atggcatgta taggactaac ctttgttgtt 780
aattaagtat cttttggtaa tgtatattcg tatagccatg cgaaaatggc ttgtatattt 840
tgagtatagc attataatca ttttgtatat atggtcttat gatatggtta ttgagtggta 900
tggaaatgct tggtaatgat tagccattgg aatggctaat catgatcata tttggtgcta 960
tgtatgtcaa attgctagct aatccatgga aacaatgaaa taggtcaaat cactaaaaat 1020
agtagaaatg gaattaaata atgaataagt tatggaatcg aagcttgatg agtctatttt 1080
catatggaag aagcaaaata ggtatatgag ctatatttta tgagatgttt aaatttttgt 1140
gaaacagggc cagagcgatt tctggatccc cttttatgac ttttgaaatt caccataaat 1200
tttacaaaga taattataag tcatgattta tatgtacaga ttcattattg agtctagttt 1260
tattagagac aaacggaata gtcatttaag ctctgtacaa gaagatatct gatttgtaat 1320
acatagaggt cagagtagtc gaaccctaaa ataggggaga ctttaactaa taaactgtac 1380
taattggccc gaccaaaaat tttggaaaac aattagtaga tagatgtata agtctagttt 1440
caggaaaaat ttatggaact ggatttcgag ttttggaact cgagatatga tttttaaagc 1500
gactgtgatg cagttagcca gcttgtctgg aaattttaaa atgaattgta tgagctcttt 1560
aagtaatgaa ttaagtccgt taacacctcg tgttcgactc cggcaatggt ctcgggtaca 1620
gggcgttaca taaagtgatg agtgacatca ttcccatgag gataggattt tggtgaaaag 1680
atggttaagt tattataatg aaatgctatg tcaaattagt aataagaatg caatggcaat 1740
gtcgaaagtt aataatgaag acagtatgcg taattgaaga ataactgaga atgctaaggc 1800
aatgcaagag taaaaatgca atggcaatta cgagaatgat tgtgtaaata aaataatata 1860
taaatgaaca aataaacaac taagaatatt atggaaaaga ttctacattt agggataaag 1920
gatatacgat gttgatacgt aaggtcggga ttactaagaa tctaccctta ctgtaaaaaa 1980
tgcctcagta aaatcataat 2000
<210> 3
<211> 2000
<212> DNA
<213> Artificial sequence
<400> 3
tatacctggt ataggatttt gtgcaagtat acatggcagt tcaagtgata aagtgtgaca 60
gccctaattt gaccctagtc ggaaagtggt ttcgggacca caaaatccga gtcgtaaaaa 120
taattaaccg tcatatttga tgcttattat atgtatatat gcatgtgtga aaattttatg 180
tttgaatttt gttaattgta agtgaatttt attaaatagg acttatatga gaaaatttag 240
aaatgtgcta gacaaaggta aaagtgatct aatagtgcat gatgtcaaaa aaaatgtact 300
tgcatgtcaa attagccaaa ttttagatag tggccggcca tgttatagat taaagaatat 360
tataactatt ttatgctaat agtttatgtt acaaaatgaa ataatgaata aggttaataa 420
aatacaagtt agtgggagga gaaaccaaag ttagcctatg ttttctcctc cattgccgta 480
actagagaaa gaagaggaag aaaagtcttt ggggaagaaa attcggctaa ggtggatacc 540
taaagtaagg taagttcaat gtcattcttg gaaaacttat gcaccatttg gatgattagt 600
ttaacttcta cctattttat ggtttgaaga taggttttgt atgagttaag tttcggttaa 660
ggtggattgt tttgatgtca ttagcatgct aagtgtgaag ctttgtaatg atacatgtga 720
tggtggattg attaattggg ttttataagg aaattatgcc atagccgaat gtgtcttgaa 780
gaagatgtca tatgtgctta ttataagtat atgtatattc ggctaatgag tttgaattga 840
agtttcgata ggttgtgggt tgagtggccg agtgaactat aggctttgca aggatggaat 900
ttacttataa gttgtgtgtg tatggcttta tttgttaatg acatttaaca ttatttttca 960
tttatatata tttgtgcatt catttttttg gggagatatg gtaagggata gattgatgtt 1020
ctaacggttt aatggagttt gaactagtaa atacttaatt gttggtattt atatgtgaaa 1080
gagatgaact tgaacttatt aagttgcatg aataaatctt ttgtttatct tagggttaaa 1140
ttaaagaaaa tgccattggg tgcttgaata aaataattag agattatttt atatatataa 1200
atcaaaaggt tcggctttgt aaatgaattt aagagtttaa atcttgaata atgttatgca 1260
taggtttcgg ccatgaatcc ttgtgttata acacttgctt aataatgaaa gaacatgagc 1320
ttaaagcttg agtaacactc ggctttagtg taagttaaaa tttgttagaa aataatttcc 1380
aagttagtag attatgtgtt aagtgaggga tttagattgt atatatatgt atacatattt 1440
atattgaatt attaaggcta tgatagccaa ttgagggttt cggccaaaat attaaaataa 1500
attggtgtga atgtttgagt gatgaatttg actcttgtgt cgatttggga cgatatgtgt 1560
atttatatga aactaaatga tgttaaataa attcgattat gcatggtatt aagctagtat 1620
tatgttcgtt ggtacatgag tagagcatat gtatgatgtt taatatctag ttaataacat 1680
catttgtact taattgtatg gtatacatgt attaaatcga atagctaaat tgataagtta 1740
tttaataaaa tctatttgtt gaatcaagct caagagctaa gagggtcaaa atcagataaa 1800
ggaaaagaaa aagcaatcga gtagtccatc cgcaactatt caaaatatcc gaggtaagtc 1860
tttgagtaac ggaacttagc ttatgatttt ataggtatca tattaaagca tagtagataa 1920
attgtgatct tatggttcta tataaattac atagtgaaac aaatgatttt tattttatat 1980
gacttggagc cgaatggtta 2000
<210> 4
<211> 11931
<212> DNA
<213> Artificial sequence
<400> 4
tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60
gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120
ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180
atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240
cttatctggg aactactcac acattattat ggagaaactc gagcttgtcg atcgactcta 300
gctagaggat cgatccgaac cccagagtcc cgcggcggta gcctcagcgt attcgaatct 360
agcaccaaga gcttcaaggt gagcgaagaa ctgagggtag gactttctga tgtggtgtgc 420
accggtgatt ctaagtggag catctgctct gagaccaaga agggtgagaa gcatgatcat 480
tctgtggtca ccgtgaccat cagcggtgat accaccagca aggtgagcag aaccagtaac 540
ggagagagaa tcggcggtct ctcttgctct aagaccaagt ctttcaagct cagctctggt 600
gtcagagatt ctatcgcatt ccttgagtct aagagtagca acgttttccc aggtggtatc 660
accctcagcg aaggcagcag cagcggtaag agcttgcacg gcgtcggtga aggaatcacc 720
atctctagta acagcgtgga gaggtctacc acctctcacg gtaagggtat caccttctct 780
aacgatatca gcacccatct ctctaagaac gttcacagct tccttctcac cctggaggtc 840
gtgttctcta aggttagaaa gtctaacctc acctgggaga agagcagcgg cggtaaggat 900
agcagcggaa ccagggtaat caccaggaac gagcactcta cctggtctgt acttctgacc 960
accagggatg gagattcttc taaggtcatc ggaggcagta gctctaacac cgaaatcaga 1020
gagggtgtca agtgtctgtc taagaggagc gtgggacttg atatcaccgg tgagtctaag 1080
ttcgagtccg tcaggaagaa gaggaccgag gaacataagg gcggaagcgt actgggagga 1140
tctttcggcg gaaacctcca ctgtaccacc tctaactgga ccggaaacgg agatagggag 1200
tctaccatcg ttggaggaca cccaagcacc aagtctttcg agggcttcaa gaaggtcacc 1260
ctgaggtctc ttaccaaggg aatcagggta atcggtaacg aaagttgtac cagaggtgag 1320
agcagcaaca cccataagga atctggccac tgcaccagcg ttacctgggt taagggtaac 1380
accagcctgt ggtctagcac cgaaacctct gatcacggcg tcatcaccaa caagctcaac 1440
accagcaccc caatctctga ggcatctgag catagcttcg gcatcctcag aggtagccac 1500
accaacaact ctggtttcac cctcagcgag agcagcggcg aggaggtatc tagtggtgta 1560
gttcttggat ggctgtgctc taagttcacc tctgagttct ctagctggat gcacgataac 1620
gtcgaaggta gctggaagag cgtcggatcc cttctccgcc gtggaaacag aagacatgac 1680
cttaagagga cgaagctcag agccaattaa agtcatccca ctcttcttca atccccacga 1740
tgaagaaatt ggataagctc gtggatgctg ctgagtcttc agagaaaccg ataagggaga 1800
tttcctttga ctggatttag agagattgga gataagagat gggttctgca caccattgca 1860
gattctgcta acttgagcca tggtcgatcg acagatctgc gaaagctcga gagagataga 1920
tttgtagaga gagactggtg atttcagcgt gtcctctcca aatgaaatga acttccttat 1980
atagaggaag gtcttgcgaa ggatagtggg attgtgcgtc atcccttacg tcagtggaga 2040
tatcacatca atccacttgc tttgaagacg tggttggaac gtcttctttt tccacgatgc 2100
tcctcgtggg tgggggtcca tctttgggac cactgtcggc agaggcatct tgaacgatag 2160
cctttccttt atcgcaatga tggcatttgt aggtgccacc ttccttttct actgtccttt 2220
tgatgaagtg acagatagct gggcaatgga atccgaggag gtttcccgat attacccttt 2280
gttgaaaagt ctcaatagcc ctttggtctt ctgagactgt atctttgata ttcttggagt 2340
agacgagagt gtcgtgctcc accatgttat cacatcaatc cacttgcttt gaagacgtgg 2400
ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac 2460
tgtcggcaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtagg 2520
tgccaccttc cttttctact gtccttttga tgaagtgaca gatagctggg caatggaatc 2580
cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctt tggtcttctg 2640
agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttggcaa 2700
gctgctctag ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 2760
ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag 2820
ttagctcact cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg 2880
tggaattgtg agcggataac aatttcacac aggaaacagc tatgaccatg attacgaatt 2940
caagcttcca gaaggtaatt atccaagatg tagcatcaag aatccaatgt ttacgggaaa 3000
aactatggaa gtattatgtg aactcagcaa gaagcagatc aatatgcggc acatatgcaa 3060
cctatgttca aaaatgaaga atgtacagat acaagatcct atactgccag aatacgaaga 3120
agaatacgta gaaattgaaa aagaagaacc aggcgaagaa aagaatcttg aagacgtaag 3180
cactgacgac aacaatgaaa agaagaagat aaggtcggtg attgtgaaag agacatagag 3240
gacacatgta aggtggaaaa tgtaagggcg gaaagtaacc ttatcacaaa ggaatcttat 3300
cccccactac ttatcctttt atatttttcc gtgtcactag tgaagacgta agcactgacg 3360
acaacaatga aaagaagaag ataaggtcgg tgattgtgaa agagacatag aggacacatg 3420
taaggtggaa aatgtaaggg cggaaagtaa ccttatcaca aaggaatctt atcccccact 3480
acttatcctt ttatattttt ccgtgtcatt tttgcccttg agttttccta tataaggaac 3540
caagttcggc atttgtgaaa acaagaaaaa atttggtgta agctattttc tttgaagtac 3600
tgaggataca acttcagaga aatttgtaag tttgtagatc taagagtaaa gaagaacaat 3660
ggcttcctct atgctctctt ccgctactat ggttgcctct ccggctcagg ccactatggt 3720
cgctcctttc aacggactta agtcctccgc tgccttccca gccacccgca aggctaacaa 3780
cgacattact tccatcacaa gcaacggcgg aagagttaac tgcatgcagg gatccgacgc 3840
tcttccagct accttcgacg ttatcgtgca tccagctaga gaactcagag gtgaacttag 3900
agcacagcca tccaagaact acaccactag atacctcctc gccgctgctc tcgctgaggg 3960
tgaaaccaga gttgttggtg tggctacctc tgaggatgcc gaagctatgc tcagatgcct 4020
cagagattgg ggtgctggtg ttgagcttgt tggtgatgac gccgtgatca gaggtttcgg 4080
tgctagacca caggctggtg ttacccttaa cccaggtaac gctggtgcag tggccagatt 4140
ccttatgggt gttgctgctc tcacctctgg tacaactttc gttaccgatt accctgattc 4200
ccttggtaag agacctcagg gtgaccttct tgaagccctc gaaagacttg gtgcttgggt 4260
gtcctccaac gatggtagac tccctatctc cgtttccggt ccagttagag gtggtacagt 4320
ggaggtttcc gccgaaagat cctcccagta cgcttccgcc cttatgttcc tcggtcctct 4380
tcttcctgac ggactcgaac ttagactcac cggtgatatc aagtcccacg ctcctcttag 4440
acagacactt gacaccctct ctgatttcgg tgttagagct actgcctccg atgaccttag 4500
aagaatctcc atccctggtg gtcagaagta cagaccaggt agagtgctcg ttcctggtga 4560
ttaccctggt tccgctgcta tccttaccgc cgctgctctt ctcccaggtg aggttagact 4620
ttctaacctt agagaacacg acctccaggg tgagaaggaa gctgtgaacg ttcttagaga 4680
gatgggtgct gatatcgtta gagaaggtga tacccttacc gtgagaggtg gtagacctct 4740
ccacgctgtt actagagatg gtgattcctt caccgacgcc gtgcaagctc ttaccgctgc 4800
tgctgccttc gctgagggtg ataccacctg ggaaaacgtt gctactctta gactcaagga 4860
atgcgataga atctctgaca ccagagctga gcttgaaaga cttggtctta gagcaagaga 4920
gaccgccgat tctctctccg ttactggttc tgctcacctt gctggtggta tcaccgctga 4980
tggtcacggt gaccacagaa tgatcatgct tctcaccctt cttggtctca gagcagatgc 5040
tccacttaga atcaccggtg cacaccacat cagaaagtcc taccctcagt tcttcgctca 5100
ccttgaagct cttggtgcta gattcgaata cgctgaggct accgccaagc tttcaaaacc 5160
aattaagtgt gaattacagg tgaccagctc gaatttcccc gatcgttcaa acatttggca 5220
ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 5280
gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 5340
ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 5400
gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcaagcttg 5460
gcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 5520
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 5580
cgcccttccc aacagttgcg cagcctgaat ggcgaatgct agagcagctt gagggaatta 5640
aactatcagt gtttgacagg atatattggc gggtaaacct aagagaaaag agcgtttatt 5700
agaataacgg atatttaaaa gggcgtgaaa aggtttatcc gttcgtccat ttgtatgtgc 5760
atgccaacca cagggttccc ctcgggatca aagtactttg atccaacccc tccgctgcta 5820
tagtgcagtc ggcttctgac gttcagtgca gccgtcttct gaaaacgaca tgtcgcacaa 5880
gtcctaagtt acgcgacagg ctgccgccct gcccttttcc tggcgttttc ttgtcgcgtg 5940
ttttagtcgc ataaagtaga atacttgcga ctagaaccgg agacattacg ccatgaacaa 6000
gagcgccgcc gctggcctgc tgggctatgc ccgcgtcagc accgacgacc aggacttgac 6060
caaccaacgg gccgaactgc acgcggccgg ctgcaccaag ctgttttccg agaagatcac 6120
cggcaccagg cgcgaccgcc cggagctggc caggatgctt gaccacctac gccctggcga 6180
cgttgtgaca gtgaccaggc tagaccgcct ggcccgcagc acccgcgacc tactggacat 6240
tgccgagcgc atccaggagg ccggcgcggg cctgcgtagc ctggcagagc cgtgggccga 6300
caccaccacg ccggccggcc gcatggtgtt gaccgtgttc gccggcattg ccgagttcga 6360
gcgttcccta atcatcgacc gcacccggag cgggcgcgag gccgccaagg cccgaggcgt 6420
gaagtttggc ccccgcccta ccctcacccc ggcacagatc gcgcacgccc gcgagctgat 6480
cgaccaggaa ggccgcaccg tgaaagaggc ggctgcactg cttggcgtgc atcgctcgac 6540
cctgtaccgc gcacttgagc gcagcgagga agtgacgccc accgaggcca ggcggcgcgg 6600
tgccttccgt gaggacgcat tgaccgaggc cgacgccctg gcggccgccg agaatgaacg 6660
ccaagaggaa caagcatgaa accgcaccag gacggccagg acgaaccgtt tttcattacc 6720
gaagagatcg aggcggagat gatcgcggcc gggtacgtgt tcgagccgcc cgcgcacgtc 6780
tcaaccgtgc ggctgcatga aatcctggcc ggtttgtctg atgccaagct ggcggcctgg 6840
ccggccagct tggccgctga agaaaccgag cgccgccgtc taaaaaggtg atgtgtattt 6900
gagtaaaaca gcttgcgtca tgcggtcgct gcgtatatga tgcgatgagt aaataaacaa 6960
atacgcaagg ggaacgcatg aaggttatcg ctgtacttaa ccagaaaggc gggtcaggca 7020
agacgaccat cgcaacccat ctagcccgcg ccctgcaact cgccggggcc gatgttctgt 7080
tagtcgattc cgatccccag ggcagtgccc gcgattgggc ggccgtgcgg gaagatcaac 7140
cgctaaccgt tgtcggcatc gaccgcccga cgattgaccg cgacgtgaag gccatcggcc 7200
ggcgcgactt cgtagtgatc gacggagcgc cccaggcggc ggacttggct gtgtccgcga 7260
tcaaggcagc cgacttcgtg ctgattccgg tgcagccaag cccttacgac atatgggcca 7320
ccgccgacct ggtggagctg gttaagcagc gcattgaggt cacggatgga aggctacaag 7380
cggcctttgt cgtgtcgcgg gcgatcaaag gcacgcgcat cggcggtgag gttgccgagg 7440
cgctggccgg gtacgagctg cccattcttg agtcccgtat cacgcagcgc gtgagctacc 7500
caggcactgc cgccgccggc acaaccgttc ttgaatcaga acccgagggc gacgctgccc 7560
gcgaggtcca ggcgctggcc gctgaaatta aatcaaaact catttgagtt aatgaggtaa 7620
agagaaaatg agcaaaagca caaacacgct aagtgccggc cgtccgagcg cacgcagcag 7680
caaggctgca acgttggcca gcctggcaga cacgccagcc atgaagcggg tcaactttca 7740
gttgccggcg gaggatcaca ccaagctgaa gatgtacgcg gtacgccaag gcaagaccat 7800
taccgagctg ctatctgaat acatcgcgca gctaccagag taaatgagca aatgaataaa 7860
tgagtagatg aattttagcg gctaaaggag gcggcatgga aaatcaagaa caaccaggca 7920
ccgacgccgt ggaatgcccc atgtgtggag gaacgggcgg ttggccaggc gtaagcggct 7980
gggttgtctg ccggccctgc aatggcactg gaacccccaa gcccgaggaa tcggcgtgac 8040
ggtcgcaaac catccggccc ggtacaaatc ggcgcggcgc tgggtgatga cctggtggag 8100
aagttgaagg ccgcgcaggc cgcccagcgg caacgcatcg aggcagaagc acgccccggt 8160
gaatcgtggc aagcggccgc tgatcgaatc cgcaaagaat cccggcaacc gccggcagcc 8220
ggtgcgccgt cgattaggaa gccgcccaag ggcgacgagc aaccagattt tttcgttccg 8280
atgctctatg acgtgggcac ccgcgatagt cgcagcatca tggacgtggc cgttttccgt 8340
ctgtcgaagc gtgaccgacg agctggcgag gtgatccgct acgagcttcc agacgggcac 8400
gtagaggttt ccgcagggcc ggccggcatg gccagtgtgt gggattacga cctggtactg 8460
atggcggttt cccatctaac cgaatccatg aaccgatacc gggaagggaa gggagacaag 8520
cccggccgcg tgttccgtcc acacgttgcg gacgtactca agttctgccg gcgagccgat 8580
ggcggaaagc agaaagacga cctggtagaa acctgcattc ggttaaacac cacgcacgtt 8640
gccatgcagc gtacgaagaa ggccaagaac ggccgcctgg tgacggtatc cgagggtgaa 8700
gccttgatta gccgctacaa gatcgtaaag agcgaaaccg ggcggccgga gtacatcgag 8760
atcgagctag ctgattggat gtaccgcgag atcacagaag gcaagaaccc ggacgtgctg 8820
acggttcacc ccgattactt tttgatcgat cccggcatcg gccgttttct ctaccgcctg 8880
gcacgccgcg ccgcaggcaa ggcagaagcc agatggttgt tcaagacgat ctacgaacgc 8940
agtggcagcg ccggagagtt caagaagttc tgtttcaccg tgcgcaagct gatcgggtca 9000
aatgacctgc cggagtacga tttgaaggag gaggcggggc aggctggccc gatcctagtc 9060
atgcgctacc gcaacctgat cgagggcgaa gcatccgccg gttcctaatg tacggagcag 9120
atgctagggc aaattgccct agcaggggaa aaaggtcgaa aaggtctctt tcctgtggat 9180
agcacgtaca ttgggaaccc aaagccgtac attgggaacc ggaacccgta cattgggaac 9240
ccaaagccgt acattgggaa ccggtcacac atgtaagtga ctgatataaa agagaaaaaa 9300
ggcgattttt ccgcctaaaa ctctttaaaa cttattaaaa ctcttaaaac ccgcctggcc 9360
tgtgcataac tgtctggcca gcgcacagcc gaagagctgc aaaaagcgcc tacccttcgg 9420
tcgctgcgct ccctacgccc cgccgcttcg cgtcggccta tcgcggccgc tggccgctca 9480
aaaatggctg gcctacggcc aggcaatcta ccagggcgcg gacaagccgc gccgtcgcca 9540
ctcgaccgcc ggcgcccaca tcaaggcacc ctgcctcgcg cgtttcggtg atgacggtga 9600
aaacctctga cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg 9660
gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat 9720
gacccagtca cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag 9780
attgtactga gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa 9840
taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 9900
ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 9960
gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 10020
gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 10080
cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 10140
ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 10200
tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 10260
gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 10320
tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 10380
ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 10440
ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 10500
ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 10560
accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 10620
tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 10680
cgttaaggga ttttggtcat gcattctagg tactaaaaca attcatccag taaaatataa 10740
tattttattt tctcccaatc aggcttgatc cccagtaagt caaaaaatag ctcgacatac 10800
tgttcttccc cgatatcctc cctgatcgac cggacgcaga aggcaatgtc ataccacttg 10860
tccgccctgc cgcttctccc aagatcaata aagccactta ctttgccatc tttcacaaag 10920
atgttgctgt ctcccaggtc gccgtgggaa aagacaagtt cctcttcggg cttttccgtc 10980
tttaaaaaat catacagctc gcgcggatct ttaaatggag tgtcttcttc ccagttttcg 11040
caatccacat cggccagatc gttattcagt aagtaatcca attcggctaa gcggctgtct 11100
aagctattcg tatagggaca atccgatatg tcgatggagt gaaagagcct gatgcactcc 11160
gcatacagct cgataatctt ttcagggctt tgttcatctt catactcttc cgagcaaagg 11220
acgccatcgg cctcactcat gagcagattg ctccagccat catgccgttc aaagtgcagg 11280
acctttggaa caggcagctt tccttccagc catagcatca tgtccttttc ccgttccaca 11340
tcataggtgg tccctttata ccggctgtcc gtcattttta aatataggtt ttcattttct 11400
cccaccagct tatatacctt agcaggagac attccttccg tatcttttac gcagcggtat 11460
ttttcgatca gttttttcaa ttccggtgat attctcattt tagccattta ttatttcctt 11520
cctcttttct acagtattta aagatacccc aagaagctaa ttataacaag acgaactcca 11580
attcactgtt ccttgcattc taaaacctta aataccagaa aacagctttt tcaaagttgt 11640
tttcaaagtt ggcgtataac atagtatcga cggagccgat tttgaaaccg cggtgatcac 11700
aggcagcaac gctctgtcat cgttacaatc aacatgctac cctccgcgag atcatccgtg 11760
tttcaaaccc ggcagcttag ttgccgttct tccgaatagc atcggtaaca tgagcaaagt 11820
ctgccgcctt acaacggctc tcccgctgac gccgtcccgg actgatgggc tgcctgtatc 11880
gagtggtgat tttgtgccga gctgccggtc ggggagctgt tggctggctg g 11931
<210> 5
<211> 29
<212> DNA
<213> Artificial sequence
<400> 5
gaagcttggc actggccgtc gttttacaa 29
<210> 6
<211> 29
<212> DNA
<213> Artificial sequence
<400> 6
cctatagggt ttcgctcatg tgttgagca 29
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence
<400> 7
tcatccacac tatctaagcc c 21
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
cagttggttg tgaatgggag 20
Claims (5)
1. A method for identifying whether a plant sample is derived from transgenic cotton or progeny thereof comprising the steps of:
detecting whether the genome DNA of a plant sample to be detected contains a DNA fragment A; the DNA fragment A consists of an exogenous DNA fragment on the upstream flank of the transgenic cotton, the exogenous DNA fragment and an exogenous DNA fragment on the downstream flank of the transgenic cotton;
if the genomic DNA of the plant sample to be detected contains the DNA fragment A, the plant sample to be detected is or is selected as the transgenic cotton or the descendant thereof;
if the genomic DNA of the plant sample to be detected does not contain the DNA fragment A, the plant sample to be detected is not or is not candidate to be the transgenic cotton or the descendant thereof;
the nucleotide sequence of the upstream flanking sequence is shown as a sequence 2 in a sequence table;
the nucleotide sequence of the downstream flanking sequence is shown as a sequence 3 in a sequence table;
the nucleotide sequence of the exogenous DNA fragment is shown as a sequence 1 in a sequence table;
the transgenic cotton is obtained by inserting an exogenous DNA fragment into the No. A10 chromosome of a target cotton genome between positions 38496180-38496245 and replacing a 64bp base sequence between positions 38496180-38496245 of the No. A10 chromosome;
the glyphosate resistance, the first fruit branch survival node, the fruit branch number and the boll number of the transgenic cotton are all higher than those of the target cotton; the plant height and/or the length of the first fruit branch of the transgenic cotton are/is lower than that of the target cotton.
2. The method of claim 1, wherein: the method for detecting whether the genome DNA of the plant sample to be detected contains the DNA fragment A is direct sequencing.
3. A method for obtaining cotton with improved glyphosate resistance, improved first fruit branch survival node, improved fruit branch number, improved boll number, reduced plant height and reduced first fruit branch length comprises the following steps:
(1) Obtaining transgenic cotton as claimed in claim 1;
(2) Selfing or crossing the transgenic cotton to obtain breeding progeny, and identifying the breeding progeny according to the method of claims 1-2 to obtain a target plant.
4. The method of claim 3, wherein: the preservation number of the transgenic cotton is CCTCC NO: P201905.
5. Use of the method of claim 1 in cotton breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910270483.XA CN110229843B (en) | 2019-04-04 | 2019-04-04 | Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910270483.XA CN110229843B (en) | 2019-04-04 | 2019-04-04 | Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110229843A CN110229843A (en) | 2019-09-13 |
| CN110229843B true CN110229843B (en) | 2023-02-28 |
Family
ID=67860637
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910270483.XA Active CN110229843B (en) | 2019-04-04 | 2019-04-04 | Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110229843B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182370B (en) * | 2018-08-03 | 2022-06-17 | 浙江大学 | Plant polygene expression vector, transformant and application thereof |
| CN113584071A (en) * | 2021-03-16 | 2021-11-02 | 山西省农业科学院棉花研究所 | Upland cotton transformant R1-3 and identification method thereof |
| CN113801892A (en) * | 2021-09-13 | 2021-12-17 | 山西省农业科学院棉花研究所 | Glyphosate-resistant upland cotton transformant R1-2HD and identification method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399794A (en) * | 2010-09-08 | 2012-04-04 | 创世纪转基因技术有限公司 | Cotton EPSP synthetase mutant gene and application thereof |
| WO2016086884A1 (en) * | 2014-12-04 | 2016-06-09 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans and preparation method and use thereof |
| CN106191219A (en) * | 2015-05-04 | 2016-12-07 | 中国农业科学院生物技术研究所 | The detection method of a kind of glyphosate tolerant transgenic Gossypium hirsutum L. BG2-7 and flanking sequence |
| CN109355306A (en) * | 2018-11-29 | 2019-02-19 | 中国农业科学院棉花研究所 | Upland cotton transformation event ICR24-397 and its specificity identification method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10501753B2 (en) * | 2013-07-12 | 2019-12-10 | Oms Investments, Inc. | Plants comprising events PP009-401, PP009-415, and PP009-469, compositions, sequences, and methods for detection thereof |
-
2019
- 2019-04-04 CN CN201910270483.XA patent/CN110229843B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399794A (en) * | 2010-09-08 | 2012-04-04 | 创世纪转基因技术有限公司 | Cotton EPSP synthetase mutant gene and application thereof |
| WO2016086884A1 (en) * | 2014-12-04 | 2016-06-09 | 中国农业科学院作物科学研究所 | Transgenic glyphosate-resistant soybeans and preparation method and use thereof |
| CN106191219A (en) * | 2015-05-04 | 2016-12-07 | 中国农业科学院生物技术研究所 | The detection method of a kind of glyphosate tolerant transgenic Gossypium hirsutum L. BG2-7 and flanking sequence |
| CN109355306A (en) * | 2018-11-29 | 2019-02-19 | 中国农业科学院棉花研究所 | Upland cotton transformation event ICR24-397 and its specificity identification method |
Non-Patent Citations (4)
| Title |
|---|
| Co-expression of and yields herbicide-resistant cotton with low glyphosate residues;Chengzhen Liang et al.;《Plant Biotechnology Journal》;20171231;第15卷;第1622-1629页 * |
| EPSPS外源基因对陆地棉农艺性状和纤维品质的影响;燕树锋 等;《棉花学报》;20151231;第27卷(第5期);第489-493页 * |
| 转EPSPS-G6基因抗草甘膦棉花的获得及抗性鉴定;燕树锋 等;《基因组学与应用生物学》;20181231;第37卷(第9期);第3944-3949页 * |
| 转G10eve基因高抗草甘膦棉花的农艺性状分析;陆国清等;《核农学报》;20181231;第32卷(第02期);第274-282页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110229843A (en) | 2019-09-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107043779B (en) | Application of CRISPR/nCas 9-mediated site-specific base substitution in plants | |
| CN110229843B (en) | Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof | |
| KR101951958B1 (en) | Elite event ee-gm3 and methods and kits for identifying such event in biological samples | |
| ES2382804T3 (en) | MON 88913 cotton event and compositions and procedures for its detection | |
| CN112279903B (en) | Gene for improving rice blast resistance of rice in panicle stage and application thereof | |
| CN106929532B (en) | Artificially creating male sterile line of maize and efficient transfer method | |
| CN112941087B (en) | Application of corn ZmBES1/BZR1-2 gene in improving plant drought tolerance | |
| ES2886551T3 (en) | Plants resistant to Phytophthora belonging to the Solanaceae family | |
| CN111206031A (en) | Nucleic acid sequence for detecting corn plant NAZ-4 and detection method thereof | |
| CN111593031B (en) | Rice ALS mutant gene, plant transgenic screening vector pCALSm3 containing gene and application thereof | |
| CN107417779B (en) | Plant aluminum-resistant related protein GmGRPL and coding gene and application thereof | |
| CN110564752B (en) | Application of differential agent technology in enrichment of C.T base substitution cells | |
| CN110881367A (en) | Corn event Ttrans-4 and methods of use thereof | |
| CN111471684B (en) | Plant constitutive promoter ALSpro and application thereof | |
| CN111411098B (en) | Rice ALS mutant gene, plant transgenic screening vector pCALSm2 containing gene and application thereof | |
| CN113185590B (en) | Gene for regulating early heading and flowering of rice and application thereof | |
| CN109112130B (en) | High-salt and aging specific induction promoter, engineering vector and application | |
| CN111560396B (en) | Plant transgenic screening vector pCALSm1 and application thereof | |
| CN110628794B (en) | Cell enrichment technology of C.T base substitution by taking inactivated screening agent resistance gene as report system and application thereof | |
| CN105255859B (en) | Method for improving abiotic stress resistance of plants | |
| CN109266631A (en) | A kind of method that genome fixed point knocks out | |
| CN114317596B (en) | Method for mutating A in plant genome target sequence into G | |
| US11873501B2 (en) | Soybean transgenic event IND-∅∅41∅-5 | |
| CN108949764B (en) | Dark and aging specific induction promoter, engineering vector and application | |
| CN114317589B (en) | Application of SpRYn-ABE base editing system in plant genome base substitution |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |