CN112279903B - Gene for improving rice blast resistance of rice in panicle stage and application thereof - Google Patents
Gene for improving rice blast resistance of rice in panicle stage and application thereof Download PDFInfo
- Publication number
- CN112279903B CN112279903B CN202011181413.6A CN202011181413A CN112279903B CN 112279903 B CN112279903 B CN 112279903B CN 202011181413 A CN202011181413 A CN 202011181413A CN 112279903 B CN112279903 B CN 112279903B
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- resistance
- improving
- blast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a gene for improving rice blast resistance of rice in a panicle stage and application thereof. The nucleotide sequence of the gene for improving the resistance of rice blast in the panicle stage of rice is shown as the base sequence from 108 th base to 797 th base of SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2. The invention successfully clones the gene for improving the rice blast resistance of the rice panicle stage from the rice blast durable resistant variety Sanhuangzhan No.2 for the first time, and constructs a rice transformation vector of over-expression Os03g0694000 gene by using a Camv35S promoter. After the vector is used for transforming rice, the expression level of the Os03g0694000 gene can be greatly improved, the resistance of the transformed plant to the rice blast in the panicle stage is obviously improved along with the improvement of the expression level, and the growth state and the agronomic characters of the transgenic plant are not obviously changed. The technology for over-expressing the Os03g0694000 gene can be applied to genetic engineering breeding and production practice of rice, and can improve the resistance of rice blast in the ear period of rice, so that the production safety of rice under the condition of food shortage at present is guaranteed.
Description
The technical field is as follows:
the invention belongs to the field of rice, and particularly relates to a gene for improving rice blast resistance of rice in a panicle stage and application thereof.
Background art:
the rice blast is mainly divided into leaf blast and panicle blast according to the occurring parts, and the panicle blast has the most serious harm to the rice yield. By utilizing the resistance of varieties, development of rice blast resistance breeding is considered to be the most economical, effective and environment-friendly way of control.
Research shows that the rice blast resistance of rice is divided into two main categories, namely quality resistance controlled by major disease resistance genes and quantitative resistance controlled by quantitative trait loci. In recent years, many rice blast resistant varieties have been developed using major resistance genes. However, the quality resistance controlled by the major gene is expressed by incompatibility between the rice host and rice blast fungus, and has microspecies specificity. When the varieties are popularized and applied in a large area or for a long time, the disease resistance of the varieties is easily lost once new microspecies or pathogenic bacteria are subjected to toxic variation, so that most of the disease-resistant varieties lose the rice blast resistance after being popularized and applied for 2-3 years. The quantity resistance controlled by a plurality of micro-effect genes is expressed by the affinity of the host and the pathogenic bacteria, inhibits the reproduction of the rice blast pathogenic bacteria, delays the disease process, and is expressed by the form that the number of the disease spots of the leaves is small and the disease spots are small. Because the small species of quantitative resistance is not strongly specific or because the nature of its micro-effective polygenes is not easily overcome by rice blast, quantitative resistance is considered to be closely related to the persistent resistance to rice blast, and has become a hotspot and frontier of research.
The invention content is as follows:
the first purpose of the invention is to provide a functional protein for improving the resistance of rice blast in the panicle stage of rice.
The amino acid sequence of the functional protein for improving the resistance to rice blast in the panicle stage of rice is shown in SEQ ID NO. 2.
The second purpose of the invention is to provide a gene which encodes the functional protein and improves the rice blast resistance of the rice at the panicle stage.
Preferably, the nucleotide sequence of the gene for improving the resistance to rice blast in the panicle stage of rice is shown as the base sequence from 108 th base to 797 th base of SEQ ID NO. 1. It is understood that modifications of the nucleotide sequence of the above-described encoding gene without changing the amino acid sequence in consideration of the degeneracy of codons also fall within the scope of the present invention.
The third purpose of the invention is to apply the gene for improving the resistance of rice blast in the panicle stage of rice to improve the resistance of the rice blast in the panicle stage of rice.
Preferably, the gene for improving the resistance to rice blast in the panicle stage of rice is overexpressed in rice, thereby improving the resistance to rice blast in the panicle stage of rice.
The invention successfully clones a gene-Os 03g0694000 gene for improving the rice blast resistance in the rice panicle stage from a rice blast durable resistant variety Sanhuangzhan No.2 (SHZ-2) for the first time, and utilizes a Camv35S promoter to construct a rice transformation vector for over-expressing the Os03g0694000 gene. After the vector is used for transforming rice, the expression level of the Os03g0694000 gene can be greatly improved, the resistance of the transformed plant to the rice blast in the panicle stage is obviously improved along with the improvement of the expression level, and the growth state and the agronomic characters of the transgenic plant are not obviously changed. Therefore, the technology for over-expressing the Os03g0694000 gene can be applied to genetic engineering breeding of rice, can be applied to production practice, and can improve the resistance of rice blast in the ear period of rice, thereby ensuring the production safety of rice under the condition of food shortage at present.
Description of the drawings:
FIG. 1 is a PHQSN vector map;
FIG. 2 is the detection of the expression level of Os03g0694000 gene in transgenic plants, wherein CK represents wild Nipponbare, and OE3, OE4 and OE6 are transgenic plants;
FIG. 3 shows that overexpression of the Os03g0694000 gene enhances the resistance to panicle blast of rice plants, wherein CK represents wild type Nipponbare, and OE3 and OE4 are transgenic plants.
The specific implementation mode is as follows:
the following examples are further illustrative of the present invention and are not intended to be limiting thereof.
Example 1:
cloning of Os03g0694000 gene and construction of overexpression vector
The young ear part of rice variety SHZ-2 was extracted with TriZol Reagent (Invitrogen, cat. No.: 15596026), the purity and amount of total RNA were measured by agarose gel electrophoresis and UV spectrophotometer, 1. mu.g of total RNA was used for starting reverse transcription, PrimeScript (TAKARA), and the reverse transcription procedure was described with reference to the instructions for the use of the reverse transcriptase. The reverse transcription product was used as a template, and PCR amplification was carried out using primers F: CGGAATTC (EcoR1 cleavage site) TGTCACTGCGCTTCTTTCCTAG and R: GAAGATCT (BglII cleavage site) ACACCATGAAAATGCTCTCGGA, with the polymerase used in PCR being KOD FX (Toyobo Co.). The reaction system was 50uL, and the PCR reaction system was prepared according to the instructions of KOD FX. The reaction conditions are as follows: 5min at 94 ℃; 30sec at 94 ℃, 30sec at 60 ℃, 60sec at 68 ℃, 35 cycles; 10min at 68 ℃. PCR amplification yielded a fragment of about 823 bp. After recovering the fragment by agarose gel electrophoresis, carrying out double digestion on the PCR fragment and the pHQS N vector (the vector diagram is shown in figure 1, and the nucleotide sequence is shown in SEQ ID NO. 3) by EcoR1 and BglII respectively, recovering the target fragment and the vector fragment after the double digestion, and connecting the target fragment and the vector fragment by T4 ligase (NEB company) for 16 hours at 16 ℃, wherein the connecting system is as follows: t4 ligase 1uL, 10Xb 1uL, Os03g0694000 gene fragment 6uL (200ng), pHQSN vector fragment 2uL (50 ng). 1uL of the ligation product was transformed into E.coli DH 5. alpha. by electroporation, and the transformation product was spread on a kanamycin-resistant LB solid medium. Culturing at 37 deg.C overnight, selecting 10 monoclonals to extract plasmid, and enzyme-cutting to identify. Two positive clones are selected for sequencing detection, and the sequencing finds that the full length of an amplified fragment sequence is 823 bases, the nucleotide sequence of the amplified fragment sequence is shown as SEQ ID NO.1, the amplified fragment sequence comprises an open reading frame and 690 bases (atggagcacagcttcaaaaccatagcagctggagtggtgatcgtcgtgctgctcctgcagcaggcgcccgtgctgattcgggccaccgacgcggaccctctccaggacttctgcgtcgccgacctcgacagcaaggtcacggtgaacgggcacgcgtgcaagccggcgtcggccgccggcgacgagttcctcttctcctccaagattgccacgggcggcgacgtgaacgctaacccgaacggctccaacgtcacggagctcgacgtcgccgagtggcccggcgtcaacacgctcggcgtgtccatgaaccgcgtcgacttcgcgcccggcggcaccaacccgccgcacatccacccgcgcgccaccgaggtcggcatcgtgctccgcggcgagctcctcgtcggcatcatcggcaccctcgacaccgggaacaggtactactccaaggtggtccgtgccggcgagacgttcgtcatcccgagggggctcatgcacttccagttcaacgttggcaagacggaggccaccatggtggtgtccttcaacagccagaaccccggcatcgtcttcgtcccgctcacattgttcggctccaacccgcccatcccgacgccggtgcttgtcaaggcgcttcgcgtggatgctggtgtagttgagctgctcaagtccaagttcaccggcgggtactaa), the amplified fragment sequence is the Os03g0694000 gene, the nucleotide sequence is shown as a base sequence from 108 th base to 797 th base of SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2. And obtaining a overexpression vector pHQSN carrying the Os03g0694000 gene, which is named as: the overexpression vector pHQSN-OE is characterized in that an Os03g0694000 gene fragment is inserted between enzyme cutting sites of EcoR1 and BglII at the downstream of a Camv35S promoter of the overexpression vector pHQSN.
2. Transformation of Os03g0694000 Gene
The overexpression vector pHQSN-OE is transferred into the Nipponbare of a normal japonica rice variety by adopting an agrobacterium EHA105 mediated genetic transformation method. Transformation of primary (T)0Generation) was detected by PCR and quantitative PCR (F: CGCGCTTCTTTCCTAGTTTCCTT; CTGAAGCTGTGCTCCATTGTTG is the ratio of R to R; length of product: 118bp), positive transformed plants were identified from the DNA level and RNA level. Selfing of positive plants to obtain transgenic 1 generation (T)1Generation) strains, selecting 10 plants which are positive through PCR detection from each strain, and breeding to obtain T2Plant generation, T2Performing PCR detection on the generation strain to find out the generation strains from different T0T for plant generation2The generation homozygous lines are 3 (OE3, OE4, OE 6). And (3) performing fluorescent quantitative PCR on the seedling leaves of the 3 strains, detecting the expression quantity of the target gene Os03g0694000, and taking a wild result as a control.
The over-expression effect program of the Os03g0694000 gene in transgenic plants is identified by fluorescent quantitative PCR as follows:
the total RNA extraction of three-leaf-stage seedling leaves of PCR-detected positive transgenic plants (OE3, OE4 and OE6) is carried out by using TriZol Reagent (Invitrogen, product number: 15596026) according to the procedures of the specification of the Reagent, detecting the purity and the amount of the total RNA by using agarose gel electrophoresis and an ultraviolet spectrophotometer, taking 1 mu g of the total RNA to carry out reverse transcription reaction, using PrimeScript (Takara), and referring to the use instructions of the reverse transcriptase in the reverse transcription reaction steps. The reverse transcription product is used as a template, a primer pair OsOXO4qF (CGCGCTTCTTTCCTAGTTTCCTT) and OsOXO4qR (CTGAAGCTGTGCTCCATTGTTG) is adopted to detect the expression condition of the Os03g0694000 gene, a primer pair EF1aqF (TTTCACTCTTGGTGTGAAGCAGAT) and EF1aqR (GACTTCCTTCACGATTTCATCGTAA) of the rice housekeeping gene EF1a gene are adopted to detect the expression of the rice EF1aqF 1a gene as an internal reference, and wild Nipponbare is as a control. The results are shown in FIG. 2. The results prove that the expression quantity of the Os03g0694000 gene of 3 transgenic plant lines is large compared with that of the wild type.
Identification of resistance of rice blast of Os03g0694000 gene overexpression transgenic plant in panicle stage
Homozygous 3 overexpressing transgenic T's as described above2Germinating seeds of generation strains (OE3, OE4 and OE6) and wild type Nipponbare plants at 37 deg.C, sowing the germinated seeds in blue pot after 2 days, selecting small seeds with consistent growth state after 10 days, placing in plastic bucket, covering the middle and upper part of the ear with cotton after 1-2 days of ear emergence, and injecting 2 ml of the solution with concentration of 1 × 106one/mL of Magnaporthe oryzae strain GD08-T13 spore suspension, and then cotton wrapped with tinfoil paper during which the inoculated spikes were spray moisturized every 2 hours for 2-3 minutes. After 3 weeks, the length of the ear inoculated with the germs and the length of the ear infected with the germs were measured, and the disease resistance of the material was evaluated by calculating the rate of ear infection. The experiment was performed in 3 biological replicates.
The results are shown in Table 1 and FIG. 3, and the average infection rate of rice blast fungus on the spike main axis of wild type plants is 83.23%, but the infection rates of rice blast fungus on the spike main axis are 32.36%, 35.25% and 34.11% in 3 overexpression lines, respectively. The Os03g0694000 gene overexpression transgenic plant is proved to have obviously higher resistance to rice blast in panicle stage than the wild type.
TABLE 1
| Name of plant | Investigation of plant number | Percentage of main axis infection | P value compared with CK |
| CK | 12 | 83.23±8.36 | |
| OsOXO4(OE3) | 12 | 32.36±5.78 | 1.85E-13 |
| OsOXO4(OE4) | 15 | 35.25±5.32 | 2.03E-14 |
| OsOXO4(OE6) | 17 | 34.11±6.90 | 1.62594E-14 |
In conclusion, the gene Os03g0694000 of the rice variety SHZ-2 is a functional gene for resisting rice blast in the panicle stage of rice, and the resistance of rice blast in the panicle stage of a transgenic plant of the over-expressed gene Os03g0694000 is obviously improved, and the growth state and the agronomic characters of the transgenic plant are not obviously changed.
Sequence listing
<110> Rice research institute of Guangdong province academy of agricultural sciences
<120> a gene for improving resistance to rice blast in panicle stage of rice and use thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 823
<212> DNA
<213> Sanhuangzhan No.2 Rice (Oryza sativa L)
<400> 1
tgtcactgcg cttctttcct agtttccttc tcaattctca ttctcaaaag agaatatatt 60
gagctgatcg agctagatat atagaagcac tagctagttg atcaacaatg gagcacagct 120
tcaaaaccat agcagctgga gtggtgatcg tcgtgctgct cctgcagcag gcgcccgtgc 180
tgattcgggc caccgacgcg gaccctctcc aggacttctg cgtcgccgac ctcgacagca 240
aggtcacggt gaacgggcac gcgtgcaagc cggcgtcggc cgccggcgac gagttcctct 300
tctcctccaa gattgccacg ggcggcgacg tgaacgctaa cccgaacggc tccaacgtca 360
cggagctcga cgtcgccgag tggcccggcg tcaacacgct cggcgtgtcc atgaaccgcg 420
tcgacttcgc gcccggcggc accaacccgc cgcacatcca cccgcgcgcc accgaggtcg 480
gcatcgtgct ccgcggcgag ctcctcgtcg gcatcatcgg caccctcgac accgggaaca 540
ggtactactc caaggtggtc cgtgccggcg agacgttcgt catcccgagg gggctcatgc 600
acttccagtt caacgttggc aagacggagg ccaccatggt ggtgtccttc aacagccaga 660
accccggcat cgtcttcgtc ccgctcacat tgttcggctc caacccgccc atcccgacgc 720
cggtgcttgt caaggcgctt cgcgtggatg ctggtgtagt tgagctgctc aagtccaagt 780
tcaccggcgg gtactaatta atccgagagc attttcatgg tgt 823
<210> 2
<211> 229
<212> PRT
<213> Sanhuangzhan No.2 Rice (Oryza sativa L)
<400> 2
Met Glu His Ser Phe Lys Thr Ile Ala Ala Gly Val Val Ile Val Val
1 5 10 15
Leu Leu Leu Gln Gln Ala Pro Val Leu Ile Arg Ala Thr Asp Ala Asp
20 25 30
Pro Leu Gln Asp Phe Cys Val Ala Asp Leu Asp Ser Lys Val Thr Val
35 40 45
Asn Gly His Ala Cys Lys Pro Ala Ser Ala Ala Gly Asp Glu Phe Leu
50 55 60
Phe Ser Ser Lys Ile Ala Thr Gly Gly Asp Val Asn Ala Asn Pro Asn
65 70 75 80
Gly Ser Asn Val Thr Glu Leu Asp Val Ala Glu Trp Pro Gly Val Asn
85 90 95
Thr Leu Gly Val Ser Met Asn Arg Val Asp Phe Ala Pro Gly Gly Thr
100 105 110
Asn Pro Pro His Ile His Pro Arg Ala Thr Glu Val Gly Ile Val Leu
115 120 125
Arg Gly Glu Leu Leu Val Gly Ile Ile Gly Thr Leu Asp Thr Gly Asn
130 135 140
Arg Tyr Tyr Ser Lys Val Val Arg Ala Gly Glu Thr Phe Val Ile Pro
145 150 155 160
Arg Gly Leu Met His Phe Gln Phe Asn Val Gly Lys Thr Glu Ala Thr
165 170 175
Met Val Val Ser Phe Asn Ser Gln Asn Pro Gly Ile Val Phe Val Pro
180 185 190
Leu Thr Leu Phe Gly Ser Asn Pro Pro Ile Pro Thr Pro Val Leu Val
195 200 205
Lys Ala Leu Arg Val Asp Ala Gly Val Val Glu Leu Leu Lys Ser Lys
210 215 220
Phe Thr Gly Gly Tyr
225
<210> 3
<211> 9928
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agagatagat ttgtagagag agactggtga tttcagcgtg tcctctccaa atgaaatgaa 60
cttccttata tagaggaagg tcttgcgaag gatagtggga ttgtgcgtca tcccttacgt 120
cagtggagat atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt 180
ccacgatgct cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt 240
gaacgatagc ctttccttta tcgcaatgat ggcatttgta ggtgccacct tccttttcta 300
ctgtcctttt gatgaagtga cagatagctg ggcaatggaa tccgaggagg tttcccgata 360
ttaccctttg ttgaaaagtc tcaatagccc tttggtcttc tgagactgta tctttgatat 420
tcttggagta gacgagagtg tcgtgctcca ccatgttatc acatcaatcc acttgctttg 480
aagacgtggt tggaacgtct tctttttcca cgatgctcct cgtgggtggg ggtccatctt 540
tgggaccact gtcggcagag gcatcttgaa cgatagcctt tcctttatcg caatgatggc 600
atttgtaggt gccaccttcc ttttctactg tccttttgat gaagtgacag atagctgggc 660
aatggaatcc gaggaggttt cccgatatta ccctttgttg aaaagtctca atagcccttt 720
ggtcttctga gactgtatct ttgatattct tggagtagac gagagtgtcg tgctccacca 780
tgttgggccc ggcgcgccaa gcttgcatgc ctgcaggtcc ccagattagc cttttcaatt 840
tcagaaagaa tgctaaccca cagatggtta gagaggctta cgcagcaggt ctcatcaaga 900
cgatctaccc gagcaataat ctccaggaaa tcaaatacct tcccaagaag gttaaagatg 960
cagtcaaaag attcaggact aactgcatca agaacacaga gaaagatata tttctcaaga 1020
tcagaagtac tattccagta tggacgattc aaggcttgct tcacaaacca aggcaagtaa 1080
tagagattgg agtctctaaa aaggtagttc ccactgaatc aaaggccatg gagtcaaaga 1140
ttcaaataga ggacctaaca gaactcgccg taaagactgg cgaacagttc atacagagtc 1200
tcttacgact caatgacaag aagaaaatct tcgtcaacat ggtggagcac gacacacttg 1260
tctactccaa aaatatcaaa gatacagtct cagaagacca aagggcaatt gagacttttc 1320
aacaaagggt aatatccgga aacctcctcg gattccattg cccagctatc tgtcacttta 1380
ttgtgaagat agtggaaaag gaaggtggct cctacaaatg ccatcattgc gataaaggaa 1440
aggccatcgt tgaagatgcc tctgccgaca gtggtcccaa agatggaccc ccacccacga 1500
ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg 1560
atatctccac tgacgtaagg gatgacgcac aatcccacta tccttcgcaa gacccttcct 1620
ctatataagg aagttcattt catttggaga gaacacgggg gactctagaa catggatccc 1680
tacagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct tttctctttt 1740
tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga ttggttatgg 1800
tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt gtctatgatg 1860
atgatgatag ttacagaacc gtcgacggat ccccgggaat tctaagagga gtccaccatg 1920
gtagatctga ctagtgttaa cgctagccac caccaccacc accacgtgtg aattacaggt 1980
gaccagctcg aatttccccg atcgttcaaa catttggcaa taaagtttct taagattgaa 2040
tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg ttaagcatgt 2100
aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga ttagagtccc 2160
gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact aggataaatt 2220
atcgcgcgcg gtgtcatcta tgttactaga tcgggaatta aactatcagt gtttgacagg 2280
atatattggc gggtaaacct aagagaaaag agcgtttatt agaataacgg atatttaaaa 2340
gggcgtgaaa aggtttatcc gttcgtccat ttgtatgtgc atgccaacca cagggttccc 2400
ctcgggatca aagtactttg atccaacccc tccgctgcta tagtgcagtc ggcttctgac 2460
gttcagtgca gccgtcttct gaaaacgaca tgtcgcacaa gtcctaagtt acgcgacagg 2520
ctgccgccct gcccttttcc tggcgttttc ttgtcgcgtg ttttagtcgc ataaagtaga 2580
atacttgcga ctagaaccgg agacattacg ccatgaacaa gagcgccgcc gctggcctgc 2640
tgggctatgc ccgcgtcagc accgacgacc aggacttgac caaccaacgg gccgaactgc 2700
acgcggccgg ctgcaccaag ctgttttccg agaagatcac cggcaccagg cgcgaccgcc 2760
cggagctggc caggatgctt gaccacctac gccctggcga cgttgtgaca gtgaccaggc 2820
tagaccgcct ggcccgcagc acccgcgacc tactggacat tgccgagcgc atccaggagg 2880
ccggcgcggg cctgcgtagc ctggcagagc cgtgggccga caccaccacg ccggccggcc 2940
gcatggtgtt gaccgtgttc gccggcattg ccgagttcga gcgttcccta atcatcgacc 3000
gcacccggag cgggcgcgag gccgccaagg cccgaggcgt gaagtttggc ccccgcccta 3060
ccctcacccc ggcacagatc gcgcacgccc gcgagctgat cgaccaggaa ggccgcaccg 3120
tgaaagaggc ggctgcactg cttggcgtgc atcgctcgac cctgtaccgc gcacttgagc 3180
gcagcgagga agtgacgccc accgaggcca ggcggcgcgg tgccttccgt gaggacgcat 3240
tgaccgaggc cgacgccctg gcggccgccg agaatgaacg ccaagaggaa caagcatgaa 3300
accgcaccag gacggccagg acgaaccgtt tttcattacc gaagagatcg aggcggagat 3360
gatcgcggcc gggtacgtgt tcgagccgcc cgcgcacgtc tcaaccgtgc ggctgcatga 3420
aatcctggcc ggtttgtctg atgccaagct ggcggcctgg ccggccagct tggccgctga 3480
agaaaccgag cgccgccgtc taaaaaggtg atgtgtattt gagtaaaaca gcttgcgtca 3540
tgcggtcgct gcgtatatga tgcgatgagt aaataaacaa atacgcaagg ggaacgcatg 3600
aaggttatcg ctgtacttaa ccagaaaggc gggtcaggca agacgaccat cgcaacccat 3660
ctagcccgcg ccctgcaact cgccggggcc gatgttctgt tagtcgattc cgatccccag 3720
ggcagtgccc gcgattgggc ggccgtgcgg gaagatcaac cgctaaccgt tgtcggcatc 3780
gaccgcccga cgattgaccg cgacgtgaag gccatcggcc ggcgcgactt cgtagtgatc 3840
gacggagcgc cccaggcggc ggacttggct gtgtccgcga tcaaggcagc cgacttcgtg 3900
ctgattccgg tgcagccaag cccttacgac atatgggcca ccgccgacct ggtggagctg 3960
gttaagcagc gcattgaggt cacggatgga aggctacaag cggcctttgt cgtgtcgcgg 4020
gcgatcaaag gcacgcgcat cggcggtgag gttgccgagg cgctggccgg gtacgagctg 4080
cccattcttg agtcccgtat cacgcagcgc gtgagctacc caggcactgc cgccgccggc 4140
acaaccgttc ttgaatcaga acccgagggc gacgctgccc gcgaggtcca ggcgctggcc 4200
gctgaaatta aatcaaaact catttgagtt aatgaggtaa agagaaaatg agcaaaagca 4260
caaacacgct aagtgccggc cgtccgagcg cacgcagcag caaggctgca acgttggcca 4320
gcctggcaga cacgccagcc atgaagcggg tcaactttca gttgccggcg gaggatcaca 4380
ccaagctgaa gatgtacgcg gtacgccaag gcaagaccat taccgagctg ctatctgaat 4440
acatcgcgca gctaccagag taaatgagca aatgaataaa tgagtagatg aattttagcg 4500
gctaaaggag gcggcatgga aaatcaagaa caaccaggca ccgacgccgt ggaatgcccc 4560
atgtgtggag gaacgggcgg ttggccaggc gtaagcggct gggttgtctg ccggccctgc 4620
aatggcactg gaacccccaa gcccgaggaa tcggcgtgac ggtcgcaaac catccggccc 4680
ggtacaaatc ggcgcggcgc tgggtgatga cctggtggag aagttgaagg ccgcgcaggc 4740
cgcccagcgg caacgcatcg aggcagaagc acgccccggt gaatcgtggc aagcggccgc 4800
tgatcgaatc cgcaaagaat cccggcaacc gccggcagcc ggtgcgccgt cgattaggaa 4860
gccgcccaag ggcgacgagc aaccagattt tttcgttccg atgctctatg acgtgggcac 4920
ccgcgatagt cgcagcatca tggacgtggc cgttttccgt ctgtcgaagc gtgaccgacg 4980
agctggcgag gtgatccgct acgagcttcc agacgggcac gtagaggttt ccgcagggcc 5040
ggccggcatg gccagtgtgt gggattacga cctggtactg atggcggttt cccatctaac 5100
cgaatccatg aaccgatacc gggaagggaa gggagacaag cccggccgcg tgttccgtcc 5160
acacgttgcg gacgtactca agttctgccg gcgagccgat ggcggaaagc agaaagacga 5220
cctggtagaa acctgcattc ggttaaacac cacgcacgtt gccatgcagc gtacgaagaa 5280
ggccaagaac ggccgcctgg tgacggtatc cgagggtgaa gccttgatta gccgctacaa 5340
gatcgtaaag agcgaaaccg ggcggccgga gtacatcgag atcgagctag ctgattggat 5400
gtaccgcgag atcacagaag gcaagaaccc ggacgtgctg acggttcacc ccgattactt 5460
tttgatcgat cccggcatcg gccgttttct ctaccgcctg gcacgccgcg ccgcaggcaa 5520
ggcagaagcc agatggttgt tcaagacgat ctacgaacgc agtggcagcg ccggagagtt 5580
caagaagttc tgtttcaccg tgcgcaagct gatcgggtca aatgacctgc cggagtacga 5640
tttgaaggag gaggcggggc aggctggccc gatcctagtc atgcgctacc gcaacctgat 5700
cgagggcgaa gcatccgccg gttcctaatg tacggagcag atgctagggc aaattgccct 5760
agcaggggaa aaaggtcgaa aaggtctctt tcctgtggat agcacgtaca ttgggaaccc 5820
aaagccgtac attgggaacc ggaacccgta cattgggaac ccaaagccgt acattgggaa 5880
ccggtcacac atgtaagtga ctgatataaa agagaaaaaa ggcgattttt ccgcctaaaa 5940
ctctttaaaa cttattaaaa ctcttaaaac ccgcctggcc tgtgcataac tgtctggcca 6000
gcgcacagcc gaagagctgc aaaaagcgcc tacccttcgg tcgctgcgct ccctacgccc 6060
cgccgcttcg cgtcggccta tcgcggccgc tggccgctca aaaatggctg gcctacggcc 6120
aggcaatcta ccagggcgcg gacaagccgc gccgtcgcca ctcgaccgcc ggcgcccaca 6180
tcaaggcacc ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc 6240
tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 6300
gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat gacccagtca cgtagcgata 6360
gcggagtgta tactggctta actatgcggc atcagagcag attgtactga gagtgcacca 6420
tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgctcttc 6480
cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 6540
tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 6600
gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 6660
ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 6720
aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc 6780
tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt 6840
ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 6900
gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta 6960
tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa 7020
caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 7080
ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt 7140
cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt 7200
ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 7260
cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat 7320
gcattctagg tactaaaaca attcatccag taaaatataa tattttattt tctcccaatc 7380
aggcttgatc cccagtaagt caaaaaatag ctcgacatac tgttcttccc cgatatcctc 7440
cctgatcgac cggacgcaga aggcaatgtc ataccacttg tccgccctgc cgcttctccc 7500
aagatcaata aagccactta ctttgccatc tttcacaaag atgttgctgt ctcccaggtc 7560
gccgtgggaa aagacaagtt cctcttcggg cttttccgtc tttaaaaaat catacagctc 7620
gcgcggatct ttaaatggag tgtcttcttc ccagttttcg caatccacat cggccagatc 7680
gttattcagt aagtaatcca attcggctaa gcggctgtct aagctattcg tatagggaca 7740
atccgatatg tcgatggagt gaaagagcct gatgcactcc gcatacagct cgataatctt 7800
ttcagggctt tgttcatctt catactcttc cgagcaaagg acgccatcgg cctcactcat 7860
gagcagattg ctccagccat catgccgttc aaagtgcagg acctttggaa caggcagctt 7920
tccttccagc catagcatca tgtccttttc ccgttccaca tcataggtgg tccctttata 7980
ccggctgtcc gtcattttta aatataggtt ttcattttct cccaccagct tatatacctt 8040
agcaggagac attccttccg tatcttttac gcagcggtat ttttcgatca gttttttcaa 8100
ttccggtgat attctcattt tagccattta ttatttcctt cctcttttct acagtattta 8160
aagatacccc aagaagctaa ttataacaag acgaactcca attcactgtt ccttgcattc 8220
taaaacctta aataccagaa aacagctttt tcaaagttgt tttcaaagtt ggcgtataac 8280
atagtatcga cggagccgat tttgaaaccg cggtgatcac aggcagcaac gctctgtcat 8340
cgttacaatc aacatgctac cctccgcgag atcatccgtg tttcaaaccc ggcagcttag 8400
ttgccgttct tccgaatagc atcggtaaca tgagcaaagt ctgccgcctt acaacggctc 8460
tcccgctgac gccgtcccgg actgatgggc tgcctgtatc gagtggtgat tttgtgccga 8520
gctgccggtc ggggagctgt tggctggctg gtggcaggat atattgtggt gtaaacaaat 8580
tgacgcttag acaacttaat aacacattgc ggacgttttt aatgtactga attaacgccg 8640
aattaattcg ggggatctgg attttagtac tggattttgg ttttaggaat tagaaatttt 8700
attgatagaa gtattttaca aatacaaata catactaagg gtttcttata tgctcaacac 8760
atgagcgaaa ccctatagga accctaattc ccttatctgg gaactactca cacattatta 8820
tggagaaact cgagcttgtc gatcgacaga tccggtcggc atctactcta tttctttgcc 8880
ctcggacgag tgctggggcg tcggtttcca ctatcggcga gtacttctac acagccatcg 8940
gtccagacgg ccgcgcttct gcgggcgatt tgtgtacgcc cgacagtccc ggctccggat 9000
cggacgattg cgtcgcatcg accctgcgcc caagctgcat catcgaaatt gccgtcaacc 9060
aagctctgat agagttggtc aagaccaatg cggagcatat acgcccggag tcgtggcgat 9120
cctgcaagct ccggatgcct ccgctcgaag tagcgcgtct gctgctccat acaagccaac 9180
cacggcctcc agaagaagat gttggcgacc tcgtattggg aatccccgaa catcgcctcg 9240
ctccagtcaa tgaccgctgt tatgcggcca ttgtccgtca ggacattgtt ggagccgaaa 9300
tccgcgtgca cgaggtgccg gacttcgggg cagtcctcgg cccaaagcat cagctcatcg 9360
agagcctgcg cgacggacgc actgacggtg tcgtccatca cagtttgcca gtgatacaca 9420
tggggatcag caatcgcgca tatgaaatca cgccatgtag tgtattgacc gattccttgc 9480
ggtccgaatg ggccgaaccc gctcgtctgg ctaagatcgg ccgcagcgat cgcatccata 9540
gcctccgcga ccggttgtag aacagcgggc agttcggttt caggcaggtc ttgcaacgtg 9600
acaccctgtg cacggcggga gatgcaatag gtcaggctct cgctaaactc cccaatgtca 9660
agcacttccg gaatcgggag cgcggccgat gcaaagtgcc gataaacata acgatctttg 9720
tagaaaccat cggcgcagct atttacccgc aggacatatc cacgccctcc tacatcgaag 9780
ctgaaagcac gagattcttc gccctccgag agctgcatca ggtcggagac gctgtcgaac 9840
ttttcgatca gaaacttctc gacagacgtc gcggtgagtt caggcttttt catatctcat 9900
tgccccccgg gatctgcgaa agctcgag 9928
Claims (3)
1. The application of the gene for improving the resistance to rice blast in the rice panicle stage in improving the resistance to rice blast caused by infection of Magnaporthe oryzae strain GD08-T13 in the rice panicle stage is disclosed, and the gene for improving the resistance to rice blast in the rice panicle stage is a gene for improving the resistance to rice blast in the rice panicle stage of encoding functional protein with an amino acid sequence shown as SEQ ID NO. 2.
2. The use of claim 1, wherein the gene for improving resistance to rice blast in panicle stage has a nucleotide sequence shown as the 108 th base to the 797 th base sequence of SEQ ID No. 1.
3. The use of claim 1, wherein the resistance to panicle blast is increased by overexpressing in rice a gene that increases resistance to panicle blast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011181413.6A CN112279903B (en) | 2020-10-29 | 2020-10-29 | Gene for improving rice blast resistance of rice in panicle stage and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011181413.6A CN112279903B (en) | 2020-10-29 | 2020-10-29 | Gene for improving rice blast resistance of rice in panicle stage and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112279903A CN112279903A (en) | 2021-01-29 |
| CN112279903B true CN112279903B (en) | 2021-08-24 |
Family
ID=74353405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011181413.6A Active CN112279903B (en) | 2020-10-29 | 2020-10-29 | Gene for improving rice blast resistance of rice in panicle stage and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112279903B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113185590B (en) * | 2021-06-11 | 2023-02-24 | 广东省农业科学院水稻研究所 | Gene for regulating early heading and flowering of rice and application thereof |
| CN116496371B (en) * | 2023-04-17 | 2024-03-01 | 西南大学 | Rice OsGLP3-5 for inhibiting sclerotinia and application thereof |
| CN116444636B (en) * | 2023-04-17 | 2024-02-20 | 西南大学 | Rice OsGLP3-6 for inhibiting sclerotinia and application thereof |
| CN116655764B (en) * | 2023-07-14 | 2024-04-12 | 广东省农业科学院水稻研究所 | Application of rice OsUGT706E2 gene in regulation and control of rice blast resistance |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103987848A (en) * | 2011-10-21 | 2014-08-13 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and method for making the same |
| CN105505955A (en) * | 2015-11-25 | 2016-04-20 | 广东省农业科学院水稻研究所 | Gene Os02g0532500 and protein capable of improving rice blast resistance, and applications of the gene |
-
2020
- 2020-10-29 CN CN202011181413.6A patent/CN112279903B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103987848A (en) * | 2011-10-21 | 2014-08-13 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and method for making the same |
| CN105505955A (en) * | 2015-11-25 | 2016-04-20 | 广东省农业科学院水稻研究所 | Gene Os02g0532500 and protein capable of improving rice blast resistance, and applications of the gene |
Non-Patent Citations (2)
| Title |
|---|
| Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight;Karmakar Subhasis等;《PLANTA》;20160131;第243卷(第1期);115-130 * |
| Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice;Molla KA等;《MOLECULAR PLANT PATHOLOGY》;20131231;第14卷(第9期);第918页右栏第3段，GenBank:KJ781300.1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112279903A (en) | 2021-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112279903B (en) | Gene for improving rice blast resistance of rice in panicle stage and application thereof | |
| CN107043779B (en) | Application of CRISPR/nCas 9-mediated site-specific base substitution in plants | |
| CN111593031B (en) | Rice ALS mutant gene, plant transgenic screening vector pCALSm3 containing gene and application thereof | |
| CA2521729A1 (en) | Methods and means for increasing the tolerance of plants to stress conditions | |
| CN112941087B (en) | Application of corn ZmBES1/BZR1-2 gene in improving plant drought tolerance | |
| CN106929532B (en) | Artificially creating male sterile line of maize and efficient transfer method | |
| CN110229843B (en) | Upland cotton transformation event 19PFA1-135-17 and specificity identification method thereof | |
| CN106701810A (en) | Gene editing system of Corynebacterium.glutamicum and application thereof | |
| CN113185590B (en) | Gene for regulating early heading and flowering of rice and application thereof | |
| CN107417779B (en) | Plant aluminum-resistant related protein GmGRPL and coding gene and application thereof | |
| CN110564752B (en) | Application of differential agent technology in enrichment of C.T base substitution cells | |
| CN113373157B (en) | Application of GF14C gene in improving salt resistance of rice | |
| CN114163509B (en) | PAO gene of Chinese cabbage and application thereof in regulating and controlling green-keeping character of plants | |
| CN111411098B (en) | Rice ALS mutant gene, plant transgenic screening vector pCALSm2 containing gene and application thereof | |
| CN111471684B (en) | Plant constitutive promoter ALSpro and application thereof | |
| CN109112130B (en) | High-salt and aging specific induction promoter, engineering vector and application | |
| CN111560396B (en) | Plant transgenic screening vector pCALSm1 and application thereof | |
| CN105255859B (en) | Method for improving abiotic stress resistance of plants | |
| CN114317589B (en) | Application of SpRYn-ABE base editing system in plant genome base substitution | |
| CN109266631A (en) | A kind of method that genome fixed point knocks out | |
| CN108949764B (en) | Dark and aging specific induction promoter, engineering vector and application | |
| CN115873853A (en) | Plant silique specific promoter | |
| KR102076333B1 (en) | Gene delivery vector for simultaneous expression of two foreign genes using broad bean wilt virus 2 | |
| CN114317596B (en) | Method for mutating A in plant genome target sequence into G | |
| CN110628794B (en) | Cell enrichment technology of C.T base substitution by taking inactivated screening agent resistance gene as report system and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220830 Address after: The third card on the right side of the first floor of the Agricultural Training Center Building, Renmin South Road, Luoding City, Yunfu City, Guangdong Province, 527299 Patentee after: Guangdong Huayi Industry Co.,Ltd. Address before: 510640 Academy of Agricultural Sciences, Wushan Road, Tianhe District, Guangzhou City, Guangdong Province Patentee before: RICE Research Institute GUANGDONG ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right |