CN115873853A - Plant silique specific promoter - Google Patents

Abstract

The invention discloses a plant silique specific promoter. The invention discloses a plant silique specific promoter SSEp which is characterized in that: the 3 'end at least contains 1801-3300 bit nucleotide sequence of sequence 1 in the sequence table, and extends from 1802 bit of sequence 1 to 5' end of sequence 1 according to the nucleotide sequence of sequence 1, to obtain any DNA fragment with length of 1500-3300 bp; the DNA molecule has a promoter function. Experiments prove that the SSEp has the function of a promoter, can specifically drive the expression of a target gene in plant siliques, particularly diaphragms and carpels, and has a good application prospect.

Description

Plant silique specific promoter

Technical Field

The invention relates to a plant silique specific promoter in the field of biotechnology.

Background

In angiosperms, flowering is an important turning point for the transition of plants from vegetative to reproductive growth. Flowering induction is regulated by genetic pathways such as photoperiod, temperature, vernalization, spontaneous, and the like. In Arabidopsis, the Florigen (Florigen) gene FLOWERING LOCUS T (FT) can serve as the key pivotal junction of several major FLOWERING control pathways. The regulation and convergence of the transcription level of the FT gene integrates the core flowering regulation and control approaches such as a photoperiod approach, a vernalization approach, a gibberellin approach and an autonomous approach.

The florigen FT has a conserved biological function of regulating flowering in various plants, and FT protein is expressed in vascular tissues of leaves and can be transported to a stem tip growing point for long distance to induce florigen transformation. The FT gene is found to be highly expressed in fruits, but it is not clear which key cis-acting elements regulate the expression. In addition, FT has important functions of inhibiting flower reversion and promoting the stability of inflorescence primordia, and FT and its homologous protein have a key function of regulating yield in crops such as tomatoes. However, the expression control mechanism of FT gene in the model plant silique and its biological function are still unclear after flowering induction, and therefore, it is important to functionally identify and analyze the FT promoter specifically expressed in the silique.

Disclosure of Invention

The invention aims to provide a plant Silique-Specific Promoter, which is named SSEp (simple-Specific Expression Promoter), wherein the SSEp is a) or b) or c) as follows:

a) The 3 'end at least contains 1801-3300 th nucleotide sequence of sequence 1 in the sequence table, and extends from 1802 th position of sequence 1 to 5' end of sequence 1 according to the nucleotide sequence of sequence 1 to obtain any DNA fragment with length of 1500-3300 bp; the DNA molecule has a promoter function;

b) A DNA fragment which has 75% or more than 75% of identity with the nucleotide sequence defined by a) and has a promoter function;

c) A DNA segment which is hybridized with the nucleotide sequence defined by a) or b) under strict conditions and has the function of a promoter.

The stringent conditions are hybridization and washing of the membrane 2 times at 68 ℃ in a solution of 2 XSSC, 0.1% SDS. 0.5 XSSC, 0.1% SDS solution at 5min each time, hybridization and washing of membranes 2 times at 68 ℃. Each time for 15min.

The SSEp nucleotide sequences of the invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which have been artificially modified to have 75% or more identity to the SSEp nucleotide sequence isolated in the present invention are derived from and identical to the nucleotide sequence of the present invention as long as the promoter activity for expressing the target gene is maintained.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identical to the nucleotide sequence of a DNA molecule of the invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The identity of 75% or more may be 80%, 85%, 90%, 95% or more.

The last nucleotide at the 3' end of SSEp is position 3300 of sequence 1.

SSEp may be 1) or 2) or 3) or 4) below:

1) A DNA molecule shown in 1801-3300 site of sequence 1 in the sequence table;

2) DNA molecules shown in 1301-3300 bit of sequence 1 in the sequence table;

3) DNA molecules shown in 601-3300 th site of sequence 1 in the sequence table;

4) DNA molecule shown in sequence 1 in the sequence table.

The invention also provides a biomaterial containing SSEp, which is any one of the following B1) to B19):

b1 An SSEp-containing expression cassette;

b2 A recombinant vector comprising SSEp;

b3 A recombinant vector containing the expression cassette of B1);

b4 A recombinant microorganism comprising SSEp;

b5 A recombinant microorganism containing the expression cassette of B1);

b6 A recombinant microorganism containing the recombinant vector of B2);

b7 A recombinant microorganism containing the recombinant vector of B3);

b8 A transgenic plant cell line containing SSEp;

b9 A transgenic plant cell line containing the expression cassette of B1);

b10 A transgenic plant cell line containing the recombinant vector of B2);

b11 A transgenic plant cell line containing the recombinant vector of B3);

b12 SSEp-containing transgenic plant tissue;

b13 A transgenic plant tissue containing the expression cassette of B1);

b14 A transgenic plant tissue containing the recombinant vector of B2);

b15 A transgenic plant tissue containing the recombinant vector of B3);

b16 A transgenic plant organ containing SSEp;

b17 A transgenic plant organ containing the expression cassette of B1);

b18 A transgenic plant organ containing the recombinant vector of B2);

b19 A transgenic plant organ containing the recombinant vector of B3).

In the biological material, the expression cassette can consist of SSEp, a target gene for which the SSEp initiates expression, and a transcription termination sequence; the SSEp is functionally linked to the gene of interest, and the gene of interest is linked to the transcription termination sequence. In one embodiment of the present invention, the target gene is specifically GUS gene.

In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector. The plasmid can be a vector pGreen-GW-GUS.

In the recombinant vector, the SSEp promotes the expression of a target gene. In one embodiment of the invention, the recombinant vector is 1.5kb SSEp:: GUS, 2.0kb SSEp:: GUS, 2.7kb SSEp:: GUS or 3.3kb SSEp:: GUS.

GUS contains a DNA fragment shown in 1801-3300 th position of a sequence 1 in a sequence table, the DNA fragment is obtained by inserting a DNA fragment shown in 1801-3300 th position of the sequence 1 in the sequence table into the upstream of the GUS gene in a pGreen-GW-GUS vector, and the DNA fragment shown in 1801-3300 th position of the sequence 1 in the sequence table in the 1.5kbSSEp can drive the expression of the GUS gene.

The 2.0kbSSEp comprises a DNA fragment shown in the 1301 th to 3300 th sites of a sequence 1 in a sequence table, which is obtained by inserting a DNA fragment shown in the 1301 th to 3300 th sites of the sequence 1 in the sequence table into the upstream of a GUS gene in a pGreen-GW-GUS vector, and the 2.0kbSSEp comprises a DNA fragment shown in the 1301 th to 3300 th sites of the sequence 1 in the sequence table in the GUS, which can drive the expression of the GUS gene.

The 2.7kbSSEp comprises a DNA fragment shown in 601 st to 3300 th positions of a sequence 1 in a sequence table, which is obtained by inserting a DNA fragment shown in 601 st to 3300 th positions of the sequence 1 in the sequence table into the upstream of a GUS gene in a pGreen-GW-GUS vector, and the 2.7kbSSEp comprises a DNA fragment shown in 601 st to 3300 th positions of the sequence 1 in the sequence table in the GUS which can drive the expression of the GUS gene.

The 3.3kb SSEp comprises a DNA fragment shown in a sequence 1 in a sequence table, wherein GUS is obtained by inserting the DNA fragment shown in the sequence 1 in the sequence table into the upstream of a GUS gene in a pGreen-GW-GUS vector, and the 3.3kb SSEp comprises a DNA fragment shown in the sequence 1 in the sequence table in the GUS which can drive the expression of the GUS gene.

In the above biological material, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacteria can be Agrobacterium.

The expression cassette or recombinant vector can be used to transform animal organs or tissues or cells by conventional biological methods such as prokaryotic microinjection, embryonic stem cell-mediated method, retroviral vector method, sperm-mediated gene transfer, nuclear transfer, somatic cell nuclear transfer, mitochondrial-mediated method, and the like, to obtain transgenic plant cells or tissues or organs.

In the above biological material, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

The invention also provides the use of SSEp as a promoter.

In such applications, SSEp may be a plant silique-specific promoter.

In such applications, SSEp may be a plant silique membrane or carpel specific promoter.

The invention also provides the use of SSEp or the biomaterial in any one of the following (a) to (d):

(a) Cultivating a plant variety or strain;

(b) Driving expression of a gene of interest in a plant;

(c) Driving expression of a gene of interest in the silique;

(d) Driving the expression of the gene of interest in the plant silique septum or carpel.

The invention also provides a method for specifically expressing the target gene in the plant silique, which comprises the following steps: and introducing an expression cassette containing the SSEp and the target gene into a plant to realize the specific expression of the target gene in the plant silique.

The invention also provides a method for specifically expressing the target gene in the plant silique septum or carpel, which comprises the following steps: and (3) introducing an expression cassette containing the SSEp and the target gene into a plant to realize the specific expression of the target gene in the plant silique septum or carpel.

In the above application, the plant may be a dicotyledonous plant or a monocotyledonous plant. The dicot may be a crucifer. The crucifer may be arabidopsis thaliana.

Experiments prove that the SSEp has the function of a promoter, can specifically drive the expression of a target gene in plant horns and fruits, particularly diaphragms and carpels, and has good application prospect.

Drawings

FIG. 1 shows the GUS staining results.

(A) From left to right, the fruits of 1.5kbSSEp, GUS/Col-0, 2.0kbSSEp, GUS/Col-0, 2.7kbSSEp, GUS/Col-0 and 3.3kbSSEp, GUS/Col-0.

(B) From left to right, 1.5kbSSEp, GUS/Col-0, 2.0kbSSEp, GUS/Col-0, 2.7kbSSEp, GUS/Col-0, 3.3kbSSEp, GUS/Col-0, cauline leaf (cauline leaf) is respectively shown.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

Examples 1,

1. Amplification of fragments of interest

The method comprises the steps of taking the genomic DNA of Arabidopsis thaliana (Arabidopsis thaliana) ecotype Col-0 as a template, amplifying a primer pair consisting of BP-1.5kb SSEp-F and BP-SSEp-R to obtain a PCR product of 1.5kb, amplifying a primer pair consisting of BP-2.0kb SSEp-F and BP-SSEp-R to obtain a PCR product of 2.0kb, amplifying a primer pair consisting of BP-2.7kb SSEp-F and BP-SSEp-R to obtain a PCR product of 2.7kb, and amplifying a primer pair consisting of BP-3.3kb SSEp-F and BP-SSEp-R to obtain a PCR product of 3.3kb. The 5' end of the primer contains attB1 or attB2 sequences, and each primer sequence is as follows:

BP-1.5kbSSEp-F：GGGGACAAGTTTGTACAAAAAAGCAGGCTGAAATGATAAGATAAAGTTC；

BP-2.0kbSSEp-F：GGGGACAAGTTTGTACAAAAAAGCAGGCTAGAAGAAATACAAAATGAAT；

BP-2.7kbSSEp-F：GGGGACAAGTTTGTACAAAAAAGCAGGCTATTTTCACCGGGGAAACCTT；

BP-3.3kbSSEp-F：GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTGTAAACGTAGGTTTGCC；

BP-SSEp-R：GGGGACCACTTTGTACAAGAAAGCTGGGTCTTTGATCTTGAACAAACAG。

2. construction of recombinant vectors

And (2) respectively preparing a BP reaction system from the four PCR products obtained in the step (1) according to the following system, incubating the obtained system for 1h at 25 ℃, adding 1 mu L of protease K (Sigma, P2308), beating uniformly, and incubating for 1h at 37 ℃. Then transformed into Escherichia coli competent cells by heat shock method, and spread on LB solid medium (50. Mu.g/mL, gentamycin) after completion of resuscitation. After 12-14h, selecting single colony for colony PCR, and screening positive clone. Detecting the correct size of the band by agarose gel electrophoresis, sending the band to a sequencing company for first-generation sequencing, and extracting a target vector of positive clone with a correct sequence, namely an Entry vector.

TABLE 1 BP reaction System

And (3) respectively preparing an LR reaction system from the obtained entry vector according to the following systems, incubating the obtained system for 1h at 25 ℃, adding 1 mu L of protease K, beating uniformly, and incubating for 1h at 37 ℃. Then transformed into Escherichia coli competent cells by heat shock method, and spread on LB solid medium (50. Mu.g/mL, kanamycin) after completion of resuscitation. After 12-14h, selecting single colony for colony PCR, and screening positive clone. Detecting the correct size of the band by agarose gel electrophoresis, sending the band to a sequencing company for first-generation sequencing, and extracting a positively cloned target vector with a correct sequence, namely the target recombinant vector.

TABLE 2 LR reaction System

Wherein, BP close ^TM II enzyme mix, cat # 11789-020, LR clone ^TM II enzyme mix, cat # 11791-020 from Invitrogen corporation; pDONOR vector is invitrogen corporation; the sequence of pGreen-GW-GUS is shown as a sequence 2 in a sequence table.

The objective recombinant vectors obtained from PCR product 1.5kb, PCR product 2.0kb, PCR product 2.7kb and PCR product 3.3kb were respectively designated 1.5kb SSEp:: GUS, 2.0kb SSEp:: GUS, 2.7kb SSEp:: GUS, 3.3kb SSEp: GUS.1.5kbSSEp, wherein GUS contains a DNA fragment (the fragment is marked as 1.5 kb-DNA) shown in 1801-3300 th site of a sequence 1 in a sequence table, and 1.5kbSSEp, wherein the 1.5kb-DNA in GUS is positioned at the upstream of a GUS gene and can drive the expression of the GUS gene; 2.0kb SSEp, wherein GUS contains a DNA fragment shown in the 1301 rd to 3300 th sites of a sequence 1 in a sequence table (the fragment is marked as 2.0 kb-DNA), and 2.0kb SSEp, wherein the 2.0kb-DNA in GUS is positioned at the upstream of a GUS gene and can drive the expression of the GUS gene; 2.7kb SSEp: GUS contains a DNA fragment represented by the 601 st to 3300 th sites of the sequence 1 in the sequence table (the fragment is referred to as 2.7 kb-DNA), and 2.7kb SSEp: GUS contains a 2.7kb-DNA upstream of the GUS gene and can drive the expression of the GUS gene; 3.3kbSSEp:: GUS contains a DNA fragment represented by the 1 st to 3300 th positions of the sequence 1 in the sequence list (this fragment is referred to as 3.3 kb-DNA), and 3.3kbSSEp:: 3.3kb-DNA in GUS is located upstream of the GUS gene and can drive the expression of the GUS gene.

3. Obtaining transgenic plants

3.1 Agrobacterium transformation

Precooling an electric rotor in advance at the temperature of minus 20 ℃, wiping off water on electrodes at two sides, adding 100 mu L of freshly prepared agrobacterium GV3101 to be electric-rotor competent, taking 1.5kb SSEp obtained in the step 2 as the:: GUS, 2.0kb SSEp as the:: GUS, 2.7kb SSEp as the:: GUS or 3.3kb SSEp as the GUS, and adding 1mL of LB liquid culture medium to be re-suspended immediately after electric shock is finished, sucking out the liquid from the electric rotor, transferring the liquid to 1.5mL of a centrifugal tube to be resuscitated in a shaking table at the temperature of 28 ℃ and the speed of 200rpm according to the proportion of 1. After completion of resuscitation, the cells were plated on LB solid medium (50. Mu.g/mL Kanamycin, 50. Mu.g/mL Rifamicin, 5. Mu.g/mL Tetracycline). After 12-14h, selecting single colony for colony PCR, and screening positive clone. After detecting the correct size of the band by agarose gel electrophoresis, the size of the band is determined by bacterial liquid: 60% glycerol =1:1, quickly freezing with liquid nitrogen, and storing the strain at-80 ℃. GUS and GUS are respectively recorded as GV3101/1.5kbSSEp, GUS, GV3101/2.0kbSSEp, GUS, GV3101/2.7kbSSEp, GUS 3101/2.7 kbSSEpGV and GUS 3101/3.3kbSSEp in the recombinant strain containing 1.5kbSSEp, GUS and 2.0 kbSSEp.

3.2 floral dipping transformation of Arabidopsis thaliana

Selecting plants of an Arabidopsis thaliana (Arabidopsis thaliana) ecotype Col-0 positive full-bloom stage, respectively transforming Arabidopsis thaliana by using each recombinant bacterium obtained in the step 3.1 through a flower soaking method, culturing the Arabidopsis thaliana in long sunlight (16 hours of illumination, 22 ℃,8 hours of darkness and 18 ℃) until seeds are mature, and harvesting the seeds to obtain T1 seeds.

3.3 screening of Positive transgenic plants

A large number of T1 generations are sowed, and leaves are cut at the 6-8 leaf period to determine whether the plants are positive transgenic plants or not through PCR. And (4) collecting seeds of the T2 generation from a single plant after the positive transgenic plant grows normally and matures. In the same method, about 100T 2 generation seeds are sown, the proportion of the plants which survive to the plants which die is counted, and the plants which survive are selected as follows: the dead plant ratio was 3:1, this is a single copy insertion plant, and culturing to harvest T3 generation seeds. All surviving lines in the T3 generation were tested in the same way, i.e.pure single copy insertion transgenic lines.

A single copy insertion transgenic line obtained by GV3101/1.5kbSSEp:: GUS was designated as 1.5kbSSEp:: GUS/Col-0, a single copy insertion transgenic line obtained by GV3101/2.0kbSSEp:: GUS was designated as 2.0kbSSEp:: GUS/Col-0, a single copy insertion transgenic line obtained by GV3101/2.7kbSSEp:: GUS was designated as 2.7kbSSEp:: GUS/Col-0, and a single copy insertion transgenic line obtained by GV3101/3.3kbSSEp:: GUS was designated as 3.3kbSSEp:: GUS/Col-0.

4. GUS identification of transgenic plants

1.5kb SSEp of the T3 generation, GUS/Col-0, 2.0kb SSEp, GUS/Col-0, 2.7kb SSEp, GUS/Col-0, 3.3kb SSEp, and GUS/Col-0 stem leaves and siliques were each stained with GUS using Arabidopsis thaliana (Arabidopsis thaliana) Col-0 as a control.

The results (FIG. 1) show that none of the four transgenic Arabidopsis shoots detected GUS staining signals in the cauline leaves, but in the siliques, both in the septum and in the carpel, and deeper GUS staining at the junction between the siliques and the mother. It was found that the 1.5kb-DNA fragment, 2.0kb-DNA fragment, 2.7kb-DNA fragment and 3.3kb-DNA fragment were all the specific promoters of siliques.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

<110> university of capital education

<120> a plant silique specific promoter

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 3300

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

cttgtaaacg taggtttgcc ggatctcttg ttcctcatcc acttgccaat cttcgtaatc 60

caaaaggtaa atatctatgt ttaattatct tctagatttt aaggcacaac ggattgatcg 120

ttctatattg tatgcacgat tgaagaagtt gtttaagaag cacaaacatt tgactatcgg 180

ctttaacacc tttttgtcac ttggagataa gatatttctt catggtgacg cagaagcctc 240

tactagctcc accgcaaaag actattgaaa tttcttatca tggtcattac accaatgata 300

ctatcaaaat ctctaaacta atctctatgt tcagtttttg atggtttatt atcaagtatg 360

tgtctttgta attatcttct cttctaagat tgaatcatca caatgttttt gaattatttg 420

attttcattg aatatttcaa ccaaccaaaa tgttttcgtt ctagaaataa agtcctaaag 480

tgacgtacat tcgttttcta atgaaaatgc tatttcataa gttattcctt tcattttttt 540

tgggtcgtca aaacataagt taatattctt tttttatttg actaaaacta cttttccaaa 600

attttcaccg gggaaacctt ctcaaagctt tatgagctta aacatatgca aagtgtctca 660

ttaacttaaa taaatataga gtacaattaa tttgttcaca acgtttttaa taggaaactt 720

agaatatgtt ctgtgatgca ctatatgttg cttcgtaagg aaattgcatg cgaaaatcta 780

gtggaagaaa tttagttaaa cggcaaaaat cttcaattaa tcgtttcctt tatctacatt 840

accaaaaggt tgcgaacatt atgcgacata tggtggttag aacttaatac actaatgttt 900

ttcaaagatg ctatttgtgg agttgataaa gacaaaacat atttgaagaa aataatttta 960

aacatgtagt gtttaggaac atcacggctt catagatata gagtcaactt aatatgttac 1020

aatgatattg aaatatgttc tctaaactct aaaaggttct acctgatttt cttaaacaat 1080

gcatcttcga aagataaaga aaatatattt ttctattttc tctttacatg tcaatgctta 1140

ctatatcatc ttacgatata ctataaacgt tttattcata agtaaaagac aagtggcaga 1200

tacgttaaat tttataatag aaataaatta gttaaatctt aaaaagttgc tgaaaataga 1260

aagcaaacta cttatcttaa agcaaacgta agtctcttta agaagaaata caaaatgaat 1320

atatatcgga ttaaatcaaa aaacaaaaag atacactttt gtttttctga acaaatgaaa 1380

aatgatatac acaagtggcg gacaatccat ctatctcatt ttagcgaaca attaatcttg 1440

tctgcgactg cgacctattt ttttctacat cacatctttt gtttcgtatg aacactaaca 1500

tgattgaatg acaaaattta ctaacaattc ttatagtact gagctctcct gtccaatatt 1560

taaaaatgca tacatttttt tgtgtgtaac taaaattagt agaaaataaa tgctagtcgt 1620

taaaaagtgc atatagcaga tttcgagttt tttttaattg cgatttcgat tatcaatggt 1680

cgatcgtaga cgtctttttt agtaaacaaa tctgaaattt ctatgaaggt taccaaatat 1740

tttggatttc aacctaagat gaagttaacc tatggacgtg tagaacagtg gctgaagtct 1800

gaaatgataa gataaagttc aatatgaata cattactgag atgttacaaa aaactacatc 1860

actgaataat tcctttattt tccagtttgg acagtagaac ctatcgctaa ttatttaatt 1920

accaattaaa agaaaaagaa agaataattc ctacagttgt taggctatgg ttataagttt 1980

catctttgaa cttaagaaat gctctaatta gtggtaatgg tagttacatc tatatatgtt 2040

gatgcaatgt caaaaagaaa atctctcaaa ttagcaaatc catacctatt tatagacgca 2100

taagtatata taccaattat cctggtcgtg caaatggatg gttagtattt ttacaaccaa 2160

actaatgtct aattttaaaa agtaatcatt attttgcttt agatttttaa tagttaatat 2220

tatatgtata gatagattac cgtatgatat aattgtttca agacactaga tactatctca 2280

attataaaac tcacttttcc ataatatggc cgcttgttta taaaaaaaga agagaaataa 2340

aacaattgat ttggtttata ttatttaatt gcagatatct tgtacttaat tcattttgag 2400

ataattttgc gtatttgagt tcggacattg gtaggtatgg acgatgaaaa taactgcctt 2460

cattctacat gtttgagatt tgtttgtcga ccatataaca caagcggcta gaaaaatagg 2520

tgactattct caaatgtcct ggttctatct aacctgaagg atcccttgtt ctacctggta 2580

taactacaag aaaaggctgt tttataaaat atatcatttc ttctatgatt tctatctcaa 2640

cttttttttt agtttttttc ttttagaacg ttttcgcttt cgaatttttt aagaattttt 2700

tttttcttta tatctctaaa taatagtttt aaaaacataa caagtgatac tgtaattttt 2760

ttttctctat aaacttggcg gtaccctact tttttcttat ttttattaat aatcttactt 2820

tgttatgata aattatgtta atatatggca aaactaaata tatatgaaac tactgattac 2880

tcattatcat aattaatatc tttgtataaa agtaaataat atttagtcga gagaggtatc 2940

ttgttaaagg aaataaatca aaaattagtg gctaccaagt gggagatata atttggaata 3000

tttccagtgt attagtgtgg tgggtttgga ataccacaaa cagaaataaa aagaaagaaa 3060

aatatgaaat aagacgacaa tgtgtgatgt acgtagaatc agttttagat tctagtacat 3120

caatagacaa gaaaaagatt gtggttatga tttcaccgac ccgagttaat gcaaatccga 3180

aacagtataa atatgtgtag agggttcatg cctatgatac aaattaaaga agcagaaaca 3240

aaaacaagta aaacagaaac aatcaacaca gagaaaccac ctgtttgttc aagatcaaag 3300

<210> 2

<211> 8240

<212> DNA

<213> Artificial sequence

<400> 2

cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg 60

ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta 120

acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat 180

acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg 240

cggtgtcatc tatgttacta gatcgggaat tcagctccag cttttgttcc ctttagtgag 300

ggttaattcc gagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc 360

cgctcacaat tccacacaac atacgagccg gaaghcataa agtgtaaagc ctggggtgcc 420

taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 480

aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 540

attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 600

cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 660

gcaggaaaga acatgaaggc cttgacagga tatattggcg ggtaaactaa gtcgctgtat 720

gtgtttgttt gagatctcat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 780

gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 840

cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 900

ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 960

tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 1020

gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 1080

tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 1140

ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 1200

ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg tatctgcgct 1260

ctgctgaagc cagttacctt cggaagaaga gttggtagct cttgatccgg caaacaaacc 1320

accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 1380

tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 1440

cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 1500

taaaaatgaa gttttaaatc aatctaaagt atatatgtgt aacattggtc tagtgattag 1560

aaaaactcat cgagcatcaa atgaaactgc aatttattca tatcaggatt atcaatacca 1620

tatttttgaa aaagccgttt ctgtaatgaa ggagaaaact caccgaggca gttccatagg 1680

atggcaagat cctggtatcg gtctgcgatt ccgactcgtc caacatcaat acaacctatt 1740

aatttcccct cgtcaaaaat aaggttatca agtgagaaat caccatgagt gacgactgaa 1800

tccggtgaga atggcaaaag tttatgcatt tctttccaga cttgttcaac aggccagcca 1860

ttacgctcgt catcaaaatc actcgcatca accaaaccgt tattcattcg tgattgcgcc 1920

tgagcgagac gaaatacgcg atcgctgtta aaaggacaat tacaaacagg aatcgaatgc 1980

aaccggcgca ggaacactgc cagcgcatca acaatatttt cacctgaatc aggatattct 2040

tctaatacct ggaatgctgt tttccctggg atcgcagtgg tgagtaacca tgcatcatca 2100

ggagtacgga taaaatgctt gatggtcgga agaggcataa attccgtcag ccagtttagt 2160

ctgaccatct catctgtaac aacattggca acgctacctt tgccatgttt cagaaacaac 2220

tctggcgcat cgggcttccc atacaatcgg tagattgtcg cacctgattg cccgacatta 2280

tcgcgagccc atttataccc atataaatca gcatccatgt tggaatttaa tcgcggcctt 2340

gagcaagacg tttcccgttg aatatggctc ataacacccc ttgtattact gtttatgtaa 2400

gcagacagtt ttattgttca tgatgatata tttttatctt gtgcaatgta acatcagaga 2460

ttttgagaca caacgtggct ttgttgaata aatcgaactt ttgctgagtt gaaggatcag 2520

atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa agcaaaagtt caaaatcacc 2580

aactggtcca cctacaacaa agctctcatc aaccgtggct ccctcacttt ctggctggat 2640

gatggggcga ttcaggcgat ccccatccaa cagcccgccg tcgagcgggc ttttttatcc 2700

ccggaagcct gtggatagag ggtagttatc cacgtgaaac cgctaatgcc ccgcaaagcc 2760

ttgattcacg gggctttccg gcccgctcca aaaactatcc acgtgaaatc gctaatcagg 2820

gtacgtgaaa tcgctaatcg gagtacgtga aatcgctaat aaggtcacgt gaaatcgcta 2880

atcaaaaagg cacgtgagaa cgctaatagc cctttcagat caacagcttg caaacacccc 2940

tcgctccggc aagtagttac agcaagtagt atgttcaatt agcttttcaa ttatgaatat 3000

atatatcaat tattggtcgc ccttggcttg tggacaatgc gctacgcgca ccggctccgc 3060

ccgtggacaa ccgcaagcgg ttgcccaccg tcgagcgcca gcgcctttgc ccacaacccg 3120

gcggccggcc gcaacagatc gttttataaa tttttttttt tgaaaaagaa aaagcccgaa 3180

aggcggcaac ctctcgggct tctggatttc cgatccccgg aattagagat cttggcagga 3240

tatattgtgg tgtaacgtta tcagcttgca tgccggtcga tctagtaaca tagatgacac 3300

cgcgcgcgat aatttatcct agtttgcgcg ctatattttg ttttctatcg cgtattaaat 3360

gtataattgc gggactctaa tcaaaaaacc catctcataa ataacgtcat gcattacatg 3420

ttaattatta catgcttaac gtaattcaac agaaattata tgataatcat cgcaagaccg 3480

gcaacaggat tcaatcttaa gaaactttat tgccaaatgt ttgaacgatc tgcttgactc 3540

taggggtcat cagatttcgg tgacgggcag gaccggacgg ggcggcaccg gcaggctgaa 3600

gtccagctgc cagaaaccca cgtcatgcca gttcccgtgc ttgaagccgg ccgcccgcag 3660

catgccacgg ggggcatatc cgagcgcctc gtgcatgcgc acgctcgggt cgttgggcag 3720

cccgatgaca gcgaccacgc tcttgaagcc ctgtgcctcc agggacttca gcaggtgggt 3780

gtagagcgtg gagcccagtc ccgtccgctg gtggcggggg gagacgtaca cggttgactc 3840

ggccgtccag tcgtaggcgt tgcgtgcctt ccagggaccc gcgtaggcga tgccggcgac 3900

ctcgccgtcc acctcggcga cgagccaggg atagcgctcc cgcagacgga cgaggtcgtc 3960

cgtccactcc tgcggttcct gcggctcggt acggaagttg accgtgcttg tctggatgta 4020

gtggttgacg atggtgcaga ccgccggcat gtccgcctcg gtggcacggc ggatgtcggc 4080

cgggcgtcgt tctgggctca tggtagatcc ccctcgatcg agttgagagt gaatatgaga 4140

ctctaattgg ataccgaggg gaatttatgg aacgtcagtg gagcattttt gacaagaaat 4200

atttgctagc tgatagtgac cttaggcgac ttttgaacgc gcaataatgg tttctgacgt 4260

atgtgcttag ctcattaaac tccagaaacc cggctgagtg gctccttcaa cgttgcggtt 4320

ctgtcagttc caaacgtaaa acggcttgtc ccgcgtcatc ggcgggggtc ataacgtgac 4380

tcccttaatt ctcatgtatc gataacatta acgtttacaa tttcgcgcca ttcgccattc 4440

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 4500

gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 4560

cgacgttgta aaacgacggc cagtgaattg taatacgact cactataggg cgaattgggt 4620

acagtactga tatcacaagt ttgtacaaaa aagctgaacg agaaacgtaa aatgatataa 4680

atatcaatat attaaattag attttgcata aaaaacagac tacataatac tgtaaaacac 4740

aacatatcca gtcatattgg cggccgcatt aggcacccca ggctttacac tttatgcttc 4800

cggctcgtat aatgtgtgga ttttgagtta ggatccgtcg agattttcag gagctaagga 4860

agctaaaatg gagaaaaaaa tcactggata taccaccgtt gatatatccc aatggcatcg 4920

taaagaacat tttgaggcat ttcagtcagt tgctcaatgt acctataacc agaccgttca 4980

gctggatatt acggcctttt taaagaccgt aaagaaaaat aagcacaagt tttatccggc 5040

ctttattcac attcttgccc gcctgatgaa tgctcatccg gaattccgta tggcaatgaa 5100

agacggtgag ctggtgatat gggatagtgt tcacccttgt tacaccgttt tccatgagca 5160

aactgaaacg ttttcatcgc tctggagtga ataccacgac gatttccggc agtttctaca 5220

catatattcg caagatgtgg cgtgttacgg tgaaaacctg gcctatttcc ctaaagggtt 5280

tattgagaat atgtttttcg tctcagccaa tccctgggtg agtttcacca gttttgattt 5340

aaacgtggcc aatatggaca acttcttcgc ccccgttttc accatgggca aatattatac 5400

gcaaggcgac aaggtgctga tgccgctggc gattcaggtt catcatgccg tttgtgatgg 5460

cttccatgtc ggcagaatgc ttaatgaatt acaacagtac tgcgatgagt ggcagggcgg 5520

ggcgtaaacg cgtggatccg gcttactaaa agccagataa cagtatgcgt atttgcgcgc 5580

tgatttttgc ggtataagaa tatatactga tatgtatacc cgaagtatgt caaaaagagg 5640

tatgctatga agcagcgtat tacagtgaca gttgacagcg acagctatca gttgctcaag 5700

gcatatatga tgtcaatatc tccggtctgg taagcacaac catgcagaat gaagcccgtc 5760

gtctgcgtgc cgaacgctgg aaagcggaaa atcaggaagg gatggctgag gtcgcccggt 5820

ttattgaaat gaacggctct tttgctgacg agaacagggg ctggtgaaat gcagtttaag 5880

gtttacacct ataaaagaga gagccgttat cgtctgtttg tggatgtaca gagtgatatt 5940

attgacacgc ccgggcgacg gatggtgatc cccctggcca gtgcacgtct gctgtcagat 6000

aaagtctccc gtgaacttta cccggtggtg catatcgggg atgaaagctg gcgcatgatg 6060

accaccgata tggccagtgt gccggtctcc gttatcgggg aagaagtggc tgatctcagc 6120

caccgcgaaa atgacatcaa aaacgccatt aacctgatgt tctggggaat ataaatgtca 6180

ggctccctta tacacagcca gtctgcaggt cgaccatagt gactggatat gttgtgtttt 6240

acagcattat gtagtctgtt ttttatgcaa aatctaattt aatatattga tatttatatc 6300

attttacgtt tctcgttcag ctttcttgta caaagtggtg atatcaagct tgggtaccac 6360

tcgagtggcc accatggtcc gtcctgtaga aaccccaacc cgtgaaatca aaaaactcga 6420

cggcctgtgg gcattcagtc tggatcgcga aaactgtgga attgatcagc gttggtggga 6480

aagcgcgtta caagaaagcc gggcaattgc tgtgccaggc agttttaacg atcagttcgc 6540

cgatgcagat attcgtaatt atgcgggcaa cgtctggtat cagcgcgaag tctttatacc 6600

gaaaggttgg gcaggccagc gtatcgtgct gcgtttcgat gcggtcactc attacggcaa 6660

agtgtgggtc aataatcagg aagtgatgga gcatcagggc ggctatacgc catttgaagc 6720

cgatgtcacg ccgtatgtta ttgccgggaa aagtgtacgt atcaccgttt gtgtgaacaa 6780

cgaactgaac tggcagacta tcccgccggg aatggtgatt accgacgaaa acggcaagaa 6840

aaagcagtct tacttccatg atttctttaa ctatgccgga atccatcgca gcgtaatgct 6900

ctacaccacg ccgaacacct gggtggacga tatcaccgtg gtgacgcatg tcgcgcaaga 6960

ctgtaaccac gcgtctgttg actggcaggt ggtggccaat ggtgatgtca gcgttgaact 7020

gcgtgatgcg gatcaacagg tggttgcaac tggacaaggc actagcggga ctttgcaagt 7080

ggtgaatccg cacctctggc aaccgggtga aggttatctc tatgaactgt gcgtcacagc 7140

caaaagccag acagagtgtg atatctaccc gcttcgcgtc ggcatccggt cagtggcagt 7200

gaagggccaa cagttcctga ttaaccacaa accgttctac tttactggct ttggtcgtca 7260

tgaagatgcg gacttacgtg gcaaaggatt cgataacgtg ctgatggtgc acgaccacgc 7320

attaatggac tggattgggg ccaactccta ccgtacctcg cattaccctt acgctgaaga 7380

gatgctcgac tgggcagatg aacatggcat cgtggtgatt gatgaaactg ctgctgtcgg 7440

ctttaacctc tctttaggca ttggtttcga agcgggcaac aagccgaaag aactgtacag 7500

cgaagaggca gtcaacgggg aaactcagca agcgcactta caggcgatta aagagctgat 7560

agcgcgtgac aaaaaccacc caagcgtggt gatgtggagt attgccaacg aaccggatac 7620

ccgtccgcaa gtgcacggga atatttcgcc actggcggaa gcaacgcgta aactcgaccc 7680

gacgcgtccg atcacctgcg tcaatgtaat gttctgcgac gctcacaccg ataccatcag 7740

cgatctcttt gatgtgctgt gcctgaaccg ttattacgga tggtatgtcc aaagcggcga 7800

tttggaaacg gcagagaagg tactggaaaa agaacttctg gcctggcagg agaaactgca 7860

tcagccgatt atcatcaccg aatacggcgt ggatacgtta gccgggctgc actcaatgta 7920

caccgacatg tggagtgaag agtatcagtg tgcatggctg gatatgtatc accgcgtctt 7980

tgatcgcgtc agcgccgtcg tcggtgaaca ggtatggaat ttcgccgatt ttgcgacctc 8040

gcaaggcata ttgcgcgttg gcggtaacaa gaaagggatc ttcactcgcg accgcaaacc 8100

gaagtcggcg gcttttctgc tgcaaaaacg ctggactggc atgaacttcg gtgaaaaacc 8160

gcagcaggga ggcaaacaat gaatcaacaa ctctcctggc gcaccatcgt cgctacagcc 8220

tcgggaattg ctaccgagct 8240

Claims (10)

1. A dna molecule which is a) or b) or c) below:

   a) The 3 'end at least contains 1801-3300 th nucleotide sequence of sequence 1 in the sequence table, and extends from 1802 th position of sequence 1 to 5' end of sequence 1 according to the nucleotide sequence of sequence 1 to obtain any DNA fragment with length of 1500-3300 bp; the DNA molecule has a promoter function;

   b) A DNA fragment which has 75% or more than 75% of identity with the nucleotide sequence defined by a) and has a promoter function;

   c) A DNA segment which is hybridized with the nucleotide sequence defined by a) or b) under strict conditions and has the function of a promoter.
2. 2. The DNA molecule of claim 1, wherein: the last nucleotide at the 3' end of the DNA molecule is the 3300 th nucleotide of the sequence 1.
3. 3. The DNA molecule of claim 1 or 2, characterized in that: the DNA molecule is 1) or 2) or 3) or 4) as follows:

   1) A DNA molecule shown in 1801-3300 bit of a sequence 1 in a sequence table;

   2) DNA molecules shown in 1301-3300 bit of sequence 1 in the sequence table;

   3) DNA molecules shown in 601 st to 3300 th sites of a sequence 1 in a sequence table;

   4) A DNA molecule shown in a sequence 1 in a sequence table.
4. 4. A biomaterial containing the DNA molecule of any one of claims 1 to 3, which is any one of the following B1) to B19):

   b1 An expression cassette comprising a DNA molecule according to any one of claims 1 to 3;

   b2 A recombinant vector comprising the DNA molecule of any one of claims 1 to 3;

   b3 A recombinant vector containing the expression cassette of B1);

   b4 A recombinant microorganism comprising a DNA molecule according to any one of claims 1 to 3;

   b5 A recombinant microorganism containing the expression cassette of B1);

   b6 A recombinant microorganism containing the recombinant vector of B2);

   b7 A recombinant microorganism containing the recombinant vector of B3);

   b8 A transgenic plant cell line containing a DNA molecule according to any one of claims 1 to 3;

   b9 A transgenic plant cell line containing the expression cassette of B1);

   b10 A transgenic plant cell line containing the recombinant vector of B2);

   b11 A transgenic plant cell line containing the recombinant vector of B3);

   b12 A transgenic plant tissue containing a DNA molecule of any one of claims 1 to 3;

   b13 A transgenic plant tissue containing the expression cassette of B1);

   b14 A transgenic plant tissue containing the recombinant vector of B2);

   b15 A transgenic plant tissue containing the recombinant vector of B3);

   b16 A transgenic plant organ containing a DNA molecule according to any one of claims 1 to 3;

   b17 A transgenic plant organ containing the expression cassette of B1);

   b18 A transgenic plant organ containing the recombinant vector of B2);

   b19 A transgenic plant organ containing the recombinant vector of B3).
5. 5. Use of the DNA molecule of claim 1 as a promoter.
6. 6. Use according to claim 5, characterized in that: the promoter is a plant silique specific promoter.
7. 7. Use according to claim 5, characterized in that: the promoter is a plant silique septum or carpel specific promoter.
8. 8. Use of the DNA molecule of any one of claims 1 to 3 or the biomaterial of claim 4 in any one of the following (a) to (d):

   (a) Cultivating a plant variety or strain;

   (b) Driving expression of a gene of interest in a plant;

   (c) Driving expression of a gene of interest in the silique;

   (d) Driving the expression of the gene of interest in the plant silique septum or carpel.
9. 9. A method for specific expression of a gene of interest in a plant silique, comprising: introducing into a plant an expression cassette comprising a DNA molecule according to any one of claims 1 to 3 and a gene of interest, to effect specific expression of the gene of interest in the silique of the plant.
10. 10. A method for specific expression of a target gene in the diaphragm or carpel of a plant silique, comprising: introducing into a plant an expression cassette comprising a DNA molecule according to any one of claims 1 to 3 and a gene of interest, to effect specific expression of the gene of interest in the cuticle or carpel of the plant.

Images