CN105368868A

CN105368868A - Upland cotton transformation event LF-ICR22 and method for identifying specificity thereof

Info

Publication number: CN105368868A
Application number: CN201510880447.7A
Authority: CN
Inventors: 李付广; 武芝侠; 杨召恩; 张雪妍; 张朝军; 杨作仁; 秦文强; 鲁丽丽; 王晔; 孔德培; 王倩华; 王玉芬
Original assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2015-12-03
Filing date: 2015-12-03
Publication date: 2016-03-02
Anticipated expiration: 2035-12-03
Also published as: CN105368868B

Abstract

The invention discloses an upland cotton transformation event LF-ICR22 and a method for identifying the specificity thereof. GhKCS6 genes are over-expressed in upland cotton CCRI24 to obtain transgenic cotton LF-ICR22, exogenous DNA (deoxyribonucleic acid) molecules shown in sequences 1 of sequence tables are inserted in positions among 65694545-65696799<th> sites of A09<th> chromosomes of genomes of the upland cotton CCRI24, and base sequences of 2254bp among the 65694545-65696799<th> sites of the A09<th> chromosomes are substituted to obtain the transgenic cotton LF-ICR22. The upland cotton transformation event LF-ICR22 and the method have the advantages that as proved by tests, the lengths, micronaire values, the specific strength and the uniformity of fibers of the transgenic cotton LF-ICR22 are higher than the lengths, micronaire values, the specific strength and the uniformity of receptor materials, the plant heights, the leaf lengths, the leaf widths, the petiole lengths, the petiole widths, the fruit branch numbers and the like of the transgenic cotton LF-ICR22 are higher than the plant heights, the leaf lengths, the leaf widths, the petiole lengths, the petiole widths, the fruit branch numbers and the like of the receptor materials, and a foundation can be laid for research on breeding of transgenic cotton with excellent fiber quality.

Description

Upland cotton transformation event LF-ICR22 and specificity identification method thereof

Technical field

The invention belongs to biological technical field, be specifically related to upland cotton transformation event LF-ICR22 and specificity identification method thereof.

Background technology

Transformation event is the molecular structure be made up of at upstream and downstream flanking region and the foreign gene of genomic insertion site foreign gene.Usually, gene transformation plant can obtain a transformant colony, and this transformant colony comprises a large amount of independently event, and wherein each event is unique.The expression of foreign gene in plant is subject to the impact of the chromosome position that foreign gene inserts.This may be derived from the impact of transcriptional regulatory element near chromatin Structure or integration site.The expression level of homologous genes in different transformation event has very large difference, and the space of expressing or temporal mode also may there are differences.And the insertion of foreign gene also may affect the expression of native gene.Therefore, the impact of each separate transformation events on recipient plant is different.Obtain energy effective expression foreign gene, the Plant Transformation event simultaneously not affecting the economical character of plant own has important using value in cultivation genetically modified crops new variety.

Cotton, as important cash crop, is the important source material of textile industry, be the important strategic material of national defense industry, plays to act in national economy.Cotton fiber cell is occurring in nature the longest naturally occurring cell, is the best materials of research cell elongation regulatory mechanism; Upland cotton cultivates cultivar the most widely, and 95% of current global output of cotton comes from upland cotton, and along with the raising of labor cost, it is that future development obtains inexorable trend that cotton mechanization is plucked.Length and the specific tenacity good fiber quality cotton all more than 30 is necessary on producing, but because China introduces the deficiency of time 100 years of upland cotton, macrofiber upland cotton resource material is relatively deficient, causes traditional breeding method to be difficult to produce in a short time the cotton of the fibrous quality being applicable to the improvement of producing upper application.

Forefathers' research shows that cotton fiber development can be divided into and is respectively four overlapping periods: the initial phase (blooming first 1 day to Post flowering 2-3 days) of Fibre Development, elongate fiber phase (Post flowering 3 days to 25 days), secondary wall thicken phase (Post flowering 15 days to 45 days) and ripening stage (Post flowering 45 days to 50 days).Post flowering 15 days is the rapid elongation phase of fiber, and elongate fiber speed can reach 2mm/ days the soonest.The length of fiber is the important indicator of fibrous quality, and the Mechanism Study of Fibre Development is that the improvement of fibrous quality is laid a good foundation.

Summary of the invention

An object of the present invention is to provide a kind of method of cultivation of transgene cotton.

The method of cultivation of transgene cotton of the present invention is for insert object cotton gene group No. A09 chromosomal 65694545-65696799 interdigit by exogenous dna fragment, replace the base sequence of No. A09 chromosomal 65694545-65696799 interdigit 2253bp, obtain transgene cotton;

The fibrous quality of described transgene cotton is higher than described object cotton;

Described exogenous dna fragment is the DNA molecular containing GhKCS6 gene.

In aforesaid method,

The nucleotides sequence of described exogenous dna fragment is classified as sequence 1 in sequence table;

To be that No. A09th, described object cotton gene group is chromosomal at the upstream flanking fragment of described transgene cotton extend to its updrift side any one DNA fragmentation that the length obtained is 0 to 5Kb to described exogenous dna fragment from the 65694545th Nucleotide;

To be that No. A09th, described object cotton gene group is chromosomal at the downstream flanking fragment of described transgene cotton extend to its downstream direction any one DNA fragmentation that the length obtained is 0 to 5Kb to described exogenous dna fragment from the 65696799th Nucleotide.

In aforesaid method,

Described upstream flanking fragment is the Nucleotide shown in sequence in sequence table 2;

Described downstream flanking fragment is the Nucleotide shown in sequence in sequence table 3;

The fibrous quality of described transgene cotton is embodied in following B1 higher than described object cotton)-B13):

B1) length of transgene cotton fiber is higher than described object cotton;

B2) specific tenacity of transgene cotton fiber is higher than described object cotton;

B3) reguarity of transgene cotton fiber is higher than described object cotton;

B4) seed cotton yield of transgene cotton is higher than described object cotton;

B5) plant height of transgene cotton is higher than described object cotton;

B6) blade length of transgene cotton is higher than described object cotton;

B7) width of blade of transgene cotton is higher than described object cotton;

B8) the petiole length of transgene cotton is higher than described object cotton;

B9) the petiole width of transgene cotton is higher than described object cotton;

B10) single bell number of transgene cotton is higher than described object cotton;

B11) the one-tenth bell number of transgene cotton is higher than described object cotton;

B12) the fruit branch number of transgene cotton is higher than described object cotton;

B13) ginning outturn of transgene cotton is higher than described object cotton;

Described exogenous dna fragment imports described object cotton by the recombinant vectors containing described exogenous dna fragment;

Described object cotton is upland cotton.

In aforesaid method,

Described transgene cotton is transgene cotton LF-ICR22.

Another object of the present invention is to provide for detect or whether auxiliary detection plant sample derives from the method for above-mentioned transgene cotton LF-ICR22 or its offspring.

Provided by the inventionly to comprise the steps: for the method detected or whether auxiliary detection plant sample derives from above-mentioned transgene cotton LF-ICR22 or its offspring

Detect whether containing DNA fragmentation A in the genomic dna of described plant sample,

Described DNA fragmentation A is made up of at the upstream flanking fragment of described transgene cotton LF-ICR22, above-mentioned exogenous dna fragment and the above-mentioned exogenous dna fragment downstream flanking fragment at described transgene cotton LF-ICR22 above-mentioned exogenous dna fragment;

If the genomic dna of described plant sample contains described DNA fragmentation A, then described plant sample is or candidate is described transgene cotton LF-ICR22 or its offspring;

If the genomic dna of described plant sample is not containing described DNA fragmentation A, then described plant sample be or candidate is not described transgene cotton LF-ICR22 or its offspring.

In aforesaid method,

Described method is following 1) or 2) or 3):

1) direct Sequencing;

2) carry out pcr amplification with the genomic dna of primer pair 1 and/or primer pair 2 pairs of plant samples, if there is object amplified production, then described plant sample derives from described transgene cotton LF-ICR22 or its offspring;

Described primer pair 1 is the primer pair of DNA molecular first that the part or all of fragment of described upstream flanking sequence of holding and be close to it by described exogenous dna fragment 5 ' forms of can increasing; The object amplified production of its correspondence is described DNA molecular first;

Described primer pair 2 is the primer pair of the DNA molecular second holding and be close to the part or all of composition of its described downstream flanking sequence containing described exogenous dna fragment 3 ' of can increasing; The object amplified production of its correspondence is described DNA molecular second;

3) with the probe of DNA molecular first described in energy specific combination or its DNA molecular second, Southern hybridization is carried out to described plant sample DNA to be measured, if can hybridize and obtain hybridized fragment, then described plant sample derives from described transgene cotton LF-ICR22 or its offspring.

In aforesaid method,

2), in, described primer pair 1 is made up of the single strand dna shown in sequence 6 in the single strand dna shown in sequence in sequence table 5 and sequence table;

Described primer pair 2 is made up of the single strand dna shown in sequence 8 in the single strand dna shown in sequence in sequence table 7 and sequence table.

A further object of the invention is to provide the test kit whether deriving from described transgene cotton LF-ICR22 or its offspring for detecting sample.

The test kit whether deriving from described transgene cotton LF-ICR22 or its offspring for detecting sample provided by the invention comprises above-mentioned primer pair 1 and/or above-mentioned primer pair 2.

The application of above-mentioned transgene cotton LF-ICR22 in breeding also belongs to protection scope of the present invention.

A further object of the invention is to provide a kind of method obtaining the cotton that fibrous quality improves.

The method of the cotton that acquisition fibrous quality provided by the invention improves comprises the steps:

(1) transgene cotton is obtained according to the method described above;

(2) by described transgene cotton selfing or hybridization, obtain breeding offspring, breed offspring described in qualification according to the method described above, obtain target plant;

The deposit number of described transgene cotton is CCTCCNo.P201516.

Last object of the present invention is to provide the product of the cultivation for transgene cotton.

The product of the cultivation for transgene cotton provided by the invention is following a)-c):

A) above-mentioned upstream flanking fragment and above-mentioned downstream flanking fragment;

B) above-mentioned exogenous dna fragment;

C) relevant to above-mentioned exogenous dna fragment biomaterial;

Described biomaterial is following A 1) to A11) in any one:

A1) expression cassette containing above-mentioned exogenous dna fragment;

A2) recombinant vectors containing above-mentioned exogenous dna fragment;

A3) containing A1) recombinant vectors of described expression cassette;

A4) recombinant microorganism containing above-mentioned exogenous dna fragment;

A5) containing A1) recombinant microorganism of described expression cassette;

A6) containing A2) recombinant microorganism of described recombinant vectors;

A7) containing A3) recombinant microorganism of described recombinant vectors;

A8) the transgenic plant cells system containing above-mentioned exogenous dna fragment;

A9) containing A1) the transgenic plant cells system of described expression cassette;

A10) containing A2) the transgenic plant cells system of described recombinant vectors;

A11) containing A3) the transgenic plant cells system of described recombinant vectors.

The application of the said products in the length of regulating plant fiber and/or mic value and/or specific tenacity and/or reguarity also belongs to protection scope of the present invention;

The said products is at regulating plant plant height and/or blade length and/or width of blade and/or petiole length and/or petiole width and/or fruit branch number and/or single bell number and/or become the application in bell number and/or in ginning outturn also to belong to protection scope of the present invention.

The present invention is by GhKCS6 channel genes upland cotton CCRI24, make GhKCS6 gene process LAN in upland cotton CCRI24, obtain transgene cotton LF-ICR22, transgene cotton LF-ICR22 is for inserting upland cotton CCRI24 genome No. A09 chromosomal 65694545-65696799 interdigit by the exogenous DNA molecule shown in sequence in sequence table 1, replace the base sequence of No. A09 chromosomal 65694545-65696799 interdigit 2253bp, the cotton obtained.By test prove: transgene cotton LF-ICR22 not only staple length, mic value, specific tenacity and reguarity higher than acceptor material, and the output of unginned cotton, plant height, blade length, width of blade, petiole length, petiole width, fruit branch number, single bell number, become the aspect such as bell number and ginning outturn also all higher than acceptor material, lay the foundation for cultivating the research with the transgene cotton of fine fiber quality and high yield.

Accompanying drawing explanation

Fig. 1 is the graphic representation of transformation event LF-ICR22.[A]: 5 ' engaging zones; [B]: 3 ' engaging zones; [C]: correspond to the 5 ' end of the transgenosis DNA inserted and coupled flanking genomic region; [D]: correspond to the 3 ' end of the transgenosis DNA inserted and coupled flanking genomic region; [E]: transgene expression cassette; [F]: the continuous sequence of upland cotton genomic flanking sequence and transgene expression cassette.

Fig. 2 is that the staple length of transgene cotton LF-ICR22 and acceptor material CCR124 compares

Fig. 3 is that the staple length of transgene cotton LF-ICR22 and acceptor material CCR124 compares.

Fig. 4 is that the seed cotton yield of breeding offspring and acceptor material CCR124 of transgene cotton LF-ICR22 compares.

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Upland cotton CCRI24 in following embodiment is disclosed in document " PAG1, acottonbrassinosteroidcatabolismgene, modulatesfiberelongation ", and the public can obtain from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.

Agrobacterium LBA4404 in following embodiment is disclosed in document " Constitutiveexpressionofthevirulencegenesimprovestheeffi ciencyofplanttransformationbyAgrobacterium ", and the public can obtain from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.

Embodiment 1, the acquisition turning GhKCS6 cotton and Analysis of agronomic characters

One, the acquisition of GhKCS6 cotton is turned

1, the structure of recombinant vectors

Expression cassette A is inserted pCambia2300 carrier, and (this plasmid is purchased from the BioVector plasmid vector bacterium cell gene preservation center of NTCC Type Tissue Collection subordinate, article No. is: Biovectorpcambia2300) EcoRI and HindIII restriction enzyme site between, and keep other sequences of pCambia2300 carrier constant, obtain recombinant vectors (sequence 4).The nucleotide sequence of above-mentioned expression cassette A is as shown in the 2151-4383 position Nucleotide in sequence table 1.Expression cassette A comprises the promotor of the CAMV35S from cauliflower mosaic virus, GhKCS6 gene and NOS terminator successively from upstream; Wherein, the nucleotide sequence of CAMV35S promotor is as shown in the 3845-4383 position Nucleotide in sequence table 1; The nucleotide sequence of GhKCS6 gene is as shown in the 2421-3824 position Nucleotide in sequence table 1; The nucleotide sequence of NOS terminator is as shown in the 2151-2404 position Nucleotide in sequence table 1.

PCambia2300 carrier self comprises expression cassette B, and expression cassette B comprises the promotor of the CAMV35S of cauliflower mosaic virus, neomycin phosphotransferase (NPTII) and PloyA terminator successively from upstream.

2, the acquisition of recombinant bacterium

Recombinant vectors step 1 obtained imports in Agrobacterium LBA4404, obtains recombinant bacterium.

3, the acquisition of GhKCS6 cotton is turned

The recombinant bacterium adopting agriculture bacillus mediated method step 2 to be obtained transforms the explant (2000) of upland cotton CCRI24, induced synthesis callus is being cultivated containing on the substratum of sulphuric acid kanamycin, select the callus transformed, callus forms embryo callus in sulphuric acid kanamycin screening culture medium, the embryo callus subculture selecting survival transforms and forms regeneration cotton, finally obtain 80 T0 altogether for turning GhKCS6 cotton, and use it for screening.

4, the qualification of GhKCS6 cotton is turned

(1) GhKCS6 cotton seeds is turned at chamber planting to the T1 generation of results, carry out greenhouse efficiency analysis and analysis of molecules.Extract the DNA that T1 generation turns GhKCS6 cotton leaf, primer: CAGTCTCAGAAGACCAAAGGGCA and GCCACCCGAACGAAACAAACAAT is adopted to carry out pcr amplification, whether testing goal gene exists, and the segregation ratio of statistical material, according to mendel's law, in the T1 generation obtaining 21 single copies, turns GhKCS6 cotton.

(2) adopt the T1 generation of TaqmanPCR and Southernblot to 21 single copies that above-mentioned steps (1) obtains to turn GhKCS6 cotton to verify further.Concrete steps are as follows: turn in the T1 generation of flowering and boll-setting period to 21 that obtain single copies the mensuration that GhKCS6 cotton carries out GhKCS6 gene expression analysis, respectively Post flowering 0 day (same day of blooming is designated as 0 day), 5 days, 15 days, the GhKCS6 expression amount being turned to GhKCS6 cotton and acceptor material CCRI24 the T1 generation of 21 single copies is analyzed, show the T1 generation of 21 single copies turn in GhKCS6 cotton have 10 T1 generations to turn GhKCS6 cotton expression amount comparatively acceptor material CCRI24 significantly improve.

(3) measure in the wadding phase fibrous quality that 10 T1 generation that above-mentioned steps (2) obtains turns GhKCS6 cotton: result show 10 T1 generations to turn in GhKCS6 cotton cotton fiber length that 8 T1 generations turn GhKCS6 cotton comparatively acceptor material CCRI24 improve or extend.

(4) assess in the paired plot of same position in the field experiment of First Year field 8 T2 generation turn GhKCS6 cotton Agronomic character (fibrous quality, Single boll weight, ginning outturn, seed refer to, plant height, beginning are high, fruit branch number, breeding time, wherein fibrous quality comprises length, specific tenacity, mic value, elongation, reguarity) and the impact of transgenosis insertion on Developmental of Cotton, output of cotton.Result shows: 8 T2 generation turns in GhKCS6 cotton and has the Agronomic character that 2 T2 generations turn GhKCS6 cotton and be better than acceptor material CCRI24.

(5) assess in the paired plot of same position in the field experiment of Second Year field 2 T2 generations that above-mentioned steps (4) obtains turn GhKCS6 cotton Agronomic character (fibrous quality, Single boll weight, ginning outturn, seed refer to, plant height, beginning are high, fruit branch number, breeding time, wherein fibrous quality comprises length, specific tenacity, mic value, elongation, reguarity) and the impact of transgenosis insertion on Developmental of Cotton, output of cotton.

Result shows: 2 T2 generation turns in GhKCS6 cotton and has the Agronomic character that 1 T2 generation turns GhKCS6 cotton and be better than acceptor material CCRI24, is turned the seed called after LF-ICR22 of GhKCS6 cotton this T2 generation, and on November 4th, 2015, T2 is preserved in China typical culture collection center for turning GhKCS6 cotton seeds LF-ICR22, preservation address is Wuhan University of Wuhan City of Hubei China province, Classification And Nomenclature is cotton seeds (GossypiumhirsutumL.), and deposit number is CCTCCNo.P201516.

In T2 generation, is turned GhKCS6 cotton LF-ICR22 and carries out selfing, until obtain T5 generation to turn GhKCS6 cotton homozygous lines LF-ICR22.

Two, the Analysis of agronomic characters of GhKCS6 cotton is turned

1, fibrous quality and seed cotton yield

In T5 generation, is turned GhKCS6 cotton homozygous lines LF-ICR22 and acceptor material CCRI24 carries out field yield test.In Earthquake of Anyang station in Henan design plot experiment, arrange 3 communities, each community is 1 repetition, the long 8m of cell row, often capable plantation 30 strain, each material 3 row, line space 80cm.Students ' test is adopted to turn the staple length of GhKCS6 cotton homozygous lines LF-ICR22 and acceptor material CCRI24 fiber, mic value, reguarity and specific tenacity to T5 generation and seed cotton yield carries out statistical study.

Statistics is as table 1: compared with acceptor material CCRI24, in T5 generation, turns the staple length of GhKCS6 cotton homozygous lines LF-ICR22, mic value, reguarity, specific tenacity and seed cotton yield and is improved, wherein, in pole salient pole work sex differernce between staple length and acceptor material CCRI24, seed cotton yield is significant difference.Fig. 2 is that transgene cotton LF-ICR22 compares with the mature fibers length of acceptor material CCRI24, and Fig. 3 is that transgene cotton LF-ICR22 compares with the cell production of acceptor material CCRI24.

The cotton of table 1, transgene cotton LF-ICR22 and the fiber quality data of acceptor material CCR124

2, otherwise impact

Because promotor is not just expressed in the fibre, its hetero-organization also can be affected, in order to study except fibres modified quality especially staple length, whether its hetero-organization of GhKCS6 gene pairs has an impact, to T5 for turning blade length, width of blade, petiole length, petiole width, plant height, the fruit branch number of GhKCS6 cotton homozygous lines LF-ICR22 with acceptor material CCRI24, becoming bell number, bell weight and ginning outturn to detect.

Result is as shown in table 2-table 4: as can be seen from the table, and T5 generation turns the plant height of GhKCS6 cotton homozygous lines LF-ICR22, blade length, width of blade, petiole length, petiole width all higher than acceptor material CCRI24.Illustrate that the plant height of expression on plant of GhKCS6 gene, blade length, width of blade, petiole length, petiole width create impact to a certain degree.The Single boll weight that T5 generation turns GhKCS6 cotton homozygous lines LF-ICR22 is significantly higher than acceptor material CCRI24, and fruit branch number, one-tenth bell number and ginning outturn are also all higher than acceptor material CCRI24.

The data of the cotton of table 2, transgene cotton LF-ICR22 and the blade length of acceptor material CCR124 and wide, petiole length and width

The cotton of table 3, transgene cotton LF-ICR22 and the plant height comparative data of acceptor material CCR124

The cotton of table 4, transgene cotton LF-ICR22 and the fruit branch number of acceptor material CCR124, become that bell number, bell are heavy, ginning outturn

Three, the phenetic analysis of the DNA sequence dna of LF-ICR22

Adopt the genomic inset of molecular biological methods analyst LF-ICR22 and genome sequence that the flank that is connected with inset is connected.Concrete steps are as follows:

1, the genome of cotton is extracted.Under greenhouse or field condition, the young tender leaf agreement that contracts a film or TV play to an actor or actress 100mg getting the cotton of LF-ICR22 is placed in the EP pipe of 2.0ml, adopt liquid nitrogen freezing EP pipe, then adopt the grinding of freeze grinding instrument, adopt the scheme provided in Qiagen company DNeasyPlantMiniKit (50) (article No. 69104) to extract genomic dna.The method can be improved through those skilled in the art to extract DNA from any tissue (including but not limited to seed).

2, according to the UniversalGenomeWalker of Clontech company ^tM(specification sheets in Cat.No.634923 adopts 4 kinds of different restriction enzymes (DraI, EcoRV, PvuII, StuI) to carry out genomic digestion, digested overnight, obtains digestion product 2.0UserManual test kit.Adopt the built-in NucleoSpinGelandPCRClean-Upkit box of test kit to reclaim digestion product, then adopt T4-DNA ligase enzyme to add the joint that test kit is built-in at recovery product two ends, so far 4 DNA library adding joint build complete.

3, according to known transgenic insertions sequence, (5 ' two nested primers held are as shown in sequence 9 and sequence 10 to design two nested primers respectively at its 5 ' end and 3 ' end, 3 ' two nested primers held are as shown in sequence 11 and sequence 12), then adopt the scheme provided in test kit to increase.Agarose gel electrophoresis is utilized to be separated the amplicon produced from reaction, use QIAGEN gel purification kit (Qiagen subsequently, Valencia, CA) purifying is carried out, the amplicons cloned of gel-purified enters in T cloning vector by the scheme provided in pMD-19T-Simple (article No.: the D104A) test kit according to the precious biological life Science and Technology Ltd. in Dalian, and in transformation of E. coli DH5 α, the flat board of ammonia benzyl resistance screens transformant, and carrying out bacterium colony PCR, positive colony carries out mono-clonal order-checking.

Sequencing result shows: transgene cotton LF-ICR22 is for inserting upland cotton CCRI24 genome No. A09 chromosomal 65694545-65696799 interdigit by the exogenous DNA molecule shown in sequence in sequence table 1, replace the base sequence of No. A09 chromosomal 65694545-65696799 interdigit 2253bp, the transgene cotton obtained, and from the 65694545th upstream and the nucleotides sequence of upstream flanking fragment of next-door neighbour's the 65694545th Nucleotide is classified as sequence 2, from the 65696799th downstream and the nucleotides sequence of downstream flanking fragment of next-door neighbour's the 65696799th Nucleotide is classified as sequence 3 (Fig. 1).

Embodiment 2, LF-ICR22 breed the acquisition of offspring and qualification and Analysis of agronomic characters

One, LF-ICR22 breeds the acquisition of offspring

1, hybridize

The pollen of 1 afternoon manual or artificial action removing first cotton by people before flowering, and adopt ceratuba to entangle colored column cap, prevent foreign pollen from contacting with column cap, the next morning is when the pollen loose powder of the second cotton, the pollen of the second cotton is collected by hand by people, and the style of this pollen and the first plant or column cap are contacted, namely complete crossover process.Wherein, when the first cotton is the LF-ICR22 in embodiment, the second cotton is other cottons, or the second cotton is LF-ICR22, and the first cotton is other cottons.

Results hybridization in term of opening bolls bell, and cotton is dried naturally, cotton ginning, and adopt the vitriol oil to drag suede, namely obtain cenospecies.Plantation, obtains hybrid generation, is LF-ICR22 and breeds offspring.

2, selfing

1 day before flowering, adopt Grafting clip directly clamp the bud of LF-ICR22 or adopt fine rule binding bud, when preventing from blooming, foreign pollen contacted with the column cap of LF-ICR22; Or by mesh bag, whole cotton plants is entangled, can effectively prevent by pollination such as insects, the self-pollination of cotton can be realized.Selfing can be completed by above-mentioned steps.

Results hybridization in term of opening bolls bell, and cotton is dried naturally, cotton ginning, and adopt the vitriol oil to drag suede, namely obtain selfed seed, plantation, obtains self progeny, is LF-ICR22 and breeds offspring.

Two, LF-ICR22 breeds qualification and the Analysis of agronomic characters thereof of offspring

(1) LF-ICR22 breeds the authentication method of characters of progenies

The genomic dna of offspring is bred for template with LF-ICR22, Auele Specific Primer is adopted to carry out pcr amplification, if pcr amplification product contains the amplicon (amplicon refers to one or the one section DNA molecular adopting the synthesis of pcr amplification technology) of LF-ICR22, illustrate that LF-ICR22 breeds offspring and has the proterties identical with LF-ICR22, if pcr amplification product containing the amplicon of LF-ICR22, does not illustrate that LF-ICR22 breeds offspring and do not have the proterties identical with LF-ICR22.Concrete authentication method is as follows:

1, authentication method 1

(1) design of primer

The present embodiment designs following primers designed based on upstream flanking sequence and exogenous DNA molecule:

GSP1:AGGAAGCGAATCCAGAACACCACT (sequence 5);

GSP2:TCCAGTACTAAAATCCAGATCCCCC (sequence 6).

(2) breed the genomic dna of offspring with LF-ICR22 for template, the primer adopting step (1) to design carries out pcr amplification, obtains pcr amplification product.

PCR amplification system is as follows: 2 × MASTREPCRMIX10 μ l, upstream primer GSP1 (10 μMs) 0.5 μ l, downstream primer GSP1 (10 μMs) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, ultrapure water 8 μ l, cumulative volume 20 μ l.

PCR reaction conditions is as follows: 94 DEG C of 5min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations; 72 DEG C of 5min.

(3) pcr amplification product that step (2) obtains is carried out agarose gel electrophoresis, and it is checked order.If the size of pcr amplification product is 511bp, then explanation LF-ICR22 breeds the amplicon that offspring contains LF-ICR22, and LF-ICR22 breeds offspring and has LF-ICR22 proterties, otherwise does not have LF-ICR22 proterties.

2, authentication method 2

(1) design of primer

The present embodiment designs following primers designed based on downstream flanking sequence and exogenous DNA molecule:

GSP3:GTCGTTTTACAACGTCGTGACTGG (sequence 7);

GSP4:GGGGATACTCTATGCTCTATTCTG (sequence 8).

PCR amplification system is as follows: 2 × MASTREPCRMIX10 μ l, upstream primer GSP3 (10 μMs) 0.5 μ l, downstream primer GSP4 (10 μMs) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, ultrapure water 8 μ l, cumulative volume 20 μ l.

(3) pcr amplification product that step (2) obtains is carried out agarose gel electrophoresis, and it is checked order.If the size of pcr amplification product is 586bp, then explanation LF-ICR22 breeds the amplicon that offspring contains LF-ICR22, and LF-ICR22 breeds offspring and has LF-ICR22 proterties, otherwise does not have LF-ICR22 proterties.

(2) LF-ICR22 breeds the Analysis of agronomic characters of characters of progenies

Fibrous quality and the seed cotton yield that the LF-ICR22 with LF-ICR22 amplicon obtained in above-mentioned steps () breeds offspring (LF-ICR22) and acceptor material CCRI24 is detected according to the method in the step 2 in embodiment 1.

1, LF-ICR22 breeds the seed cotton yield of characters of progenies

LF-ICR22 breeds the detected result of the seed cotton yield of offspring (LF-ICR22) as shown in Figure 4: as can be seen from the figure, compared with the seed cotton yield of acceptor material CCRI24, the seed cotton yield that LF-ICR22 breeds offspring (LF-ICR22) improves 65.6%, illustrates that LF-ICR22 breeds offspring (LF-ICR22) and has high seed cotton yield.

2, LF-ICR22 breeds the fibrous quality of characters of progenies

The detected result that LF-ICR22 breeds the seed cotton yield of offspring (LF-ICR22) is as shown in table 5: as can be seen from the table, compared with acceptor material CCRI24, LF-ICR22 breeds the staple length of offspring (LF-ICR22), specific tenacity, mic value and reguarity and all increases, and illustrates that the cotton fiber quality that LF-ICR22 breeds offspring (LF-ICR22) increases.

Table 5, LF-ICR22 breed the detected result of the fibrous quality of offspring (LF-ICR22)

Therefore can to detect as follows or whether auxiliary detection plant sample derives from transgene cotton LF-ICR22 or its offspring:

Carry out pcr amplification with the genomic dna of primer pair 1 or primer pair 2 pairs of plant samples, obtain pcr amplification product, detect whether containing DNA fragmentation A in pcr amplification product,

If containing DNA fragmentation A, then plant sample is or candidate is transgene cotton LF-ICR22 or its offspring;

If not containing DNA fragmentation A, then plant sample be or candidate is not transgene cotton LF-ICR22 or its offspring.

Primer pair 1 is made up of the single strand dna shown in sequence 6 in the single strand dna shown in sequence in sequence table 5 and sequence table;

Primer pair 2 is made up of the single strand dna shown in sequence 8 in the single strand dna shown in sequence in sequence table 7 and sequence table;

DNA fragmentation A is made up of upstream flanking fragment (sequence 2), exogenous dna fragment (sequence 1) and downstream flanking fragment (sequence 3).

Claims

1. the method for cultivation of a transgene cotton, for exogenous dna fragment being inserted object cotton gene group No. A09 chromosomal 65694545-65696799 interdigit, replace the base sequence of No. A09 chromosomal 65694545-65696799 interdigit 2253bp, obtain transgene cotton;

Described exogenous dna fragment is the DNA molecular containing GhKCS6 gene.

2. method according to claim 1, is characterized in that:

3. method according to claim 1 or 2, is characterized in that:

B1) length of transgene cotton fiber is higher than described object cotton;

B3) reguarity of transgene cotton fiber is higher than described object cotton;

B5) plant height of transgene cotton is higher than described object cotton;

B6) blade length of transgene cotton is higher than described object cotton;

B7) width of blade of transgene cotton is higher than described object cotton;

Described object cotton is upland cotton.

4., according to described method arbitrary in claim 1-3, it is characterized in that: described transgene cotton is transgene cotton LF-ICR22.

5., for detect or whether auxiliary detection plant sample derives from the method for the LF-ICR22 of transgene cotton described in claim 4 or its offspring, comprise the steps:

Described DNA fragmentation A is made up of at the downstream flanking fragment of described transgene cotton LF-ICR22 the described exogenous dna fragment of the described exogenous dna fragment in claim 2 in the upstream flanking fragment, claim 2 of described transgene cotton LF-ICR22 and the described exogenous dna fragment in claim 2;

6. method according to claim 5, is characterized in that:

Described method is following 1) or 2) or 3):

1) direct Sequencing;

Described primer pair 1 is specifically made up of the single strand dna shown in sequence 6 in the single strand dna shown in sequence in sequence table 5 and sequence table;

Described primer pair 2 is specifically made up of the single strand dna shown in sequence 8 in the single strand dna shown in sequence in sequence table 7 and sequence table;

7. whether derive from the test kit of described transgene cotton LF-ICR22 or its offspring for detecting sample, it comprises: the described primer pair 1 in claim 6 and/or the described primer pair 2 in claim 6.

8. the application of transgene cotton LF-ICR22 in breeding described in claim 4.

9. obtain a method for the cotton that fibrous quality improves, comprise the steps:

(1) transgene cotton is obtained according to described method arbitrary in claim 1-4;

(2) by described transgene cotton selfing or hybridization, obtain breeding offspring, described in the method qualification described in claim 5 or 6, breed offspring, obtain target plant;

The deposit number of described transgene cotton is CCTCCNo.P201516.

10., for the product of the cultivation of transgene cotton, it is following a)-c):

A) the upstream flanking fragment described in claim 2 and the downstream flanking fragment described in claim 2;

B) exogenous dna fragment described in claim 2;

C) relevant to the exogenous dna fragment described in claim 2 biomaterial;

Described biomaterial is following A 1) to A11) in any one:

A1) expression cassette containing the described exogenous dna fragment in claim 2;

A2) recombinant vectors containing the described exogenous dna fragment in claim 2;

A3) containing A1) recombinant vectors of described expression cassette;

A4) recombinant microorganism containing the described exogenous dna fragment in claim 2;

A5) containing A1) recombinant microorganism of described expression cassette;

A6) containing A2) recombinant microorganism of described recombinant vectors;

A7) containing A3) recombinant microorganism of described recombinant vectors;

A8) the transgenic plant cells system containing the described exogenous dna fragment in claim 2;

A11) containing A3) the transgenic plant cells system of described recombinant vectors;

Or, the application of the said products in the length of regulating plant fiber and/or mic value and/or specific tenacity and/or reguarity;

Or the said products is at regulating plant plant height and/or blade length and/or width of blade and/or petiole length and/or petiole width and/or fruit branch number and/or single bell number and/or become application in bell number and/or in ginning outturn.