CN103130884A - Protein relevant to plant spike shape and encoding gene and appliance thereof - Google Patents

Abstract

The invention discloses protein relevant to a plant spike shape and an encoding gene and appliance of the protein relevant to the plant spike shape. The protein relevant to the plant spike shape is the protein of a following (a) or the protein of a following (b). The protein of the following (a) is composed of an amino acid sequence shown in a sequence 1 in a sequence table; and the protein of the following (b) is relevant to the plant spike shape and is derived through the protein in (a) by displacing and/or deleting and/or adding one or a plurality of amino acid residues of the amino acid sequence shown in the sequence 1 in the sequence table. Due to the cloning of an SPEDJ gene, rice spike morphogenesis, especially a development problem of a tail end branch is further looked into, a determinant of transporting biological substance from a source to a bank is explored, a deep theoretical problem of 'ideal stripe shape' is finally solved, and the protein relevant to the plant spike shape and the encoding gene and appliance of the protein relevant to the plant spike shape are hopeful to be taken as a guide new direction of crop high-yield breeding.

Description

Albumen and encoding gene and the application relevant to plant fringe shape

Technical field

The present invention relates to albumen and encoding gene and the application relevant to plant fringe shape.

Background technology

In Gramineae, the main shaft of inflorescence is called cob (rachis) (Bell, AD (1991) Plant Form:An Illustrated Guide to Flowering Plant Morphology, Oxford University Press, New York.p.184-191.), the side direction of being born on cob and divide the lopwood stalk to be called the Their First Branch stalk, analogize along this mode, the more next stage branch of being born on the Their First Branch stalk and be called secondary branch stalk." branch stalk " this professional name only is used for the inflorescence branch and has the structure that the sufficient length support surpasses a small ear, when branch stalk is short to when only comprising a small ear (anthocaulus of at least one flower and connection thereof), can only be called peduncle (peduncle) (Ikeda, K, Sunohara H and Nagato Y (2004) Development Course of Inflorescence and Spikelet in Rice.Breed.Sci.54:147-156), and more be short to when only comprising a Xiao Hua, just be called bennet (pedicel).

The paddy rice inflorescence particularly the region between the heart and the diaphragm of sending out of branch stalk is a whole overall process, that is to say to only have main cob to complete differentiation to senior integrally-regulated from level to level according to merismatic type by elementary, just can start the differentiation of Their First Branch stalk; The differentiation that just starts the elongation program and enter simultaneously next stage branch stalk after all Their First Branch stalk differentiation are completed; After completing differentiation, all secondary branch stalks just start simultaneously the differentiation of small ear.In this process, the elongation of branch stalk has been subject to strict time limitation, always lag in the differentiation of various former bases, this the fully different (Ikeda of phenomenon of merisis first occur from general vital tissues, K, Sunohara H and Nagato Y (2004) Development Course of Inflorescence and Spikelet in Rice.Breed.Sci.54:147-156).

In the paddy rice inflorescence development, prerequisite property, the event that is also the most key property is exactly the growth of branch stalk.It is very important that this growth problem also seems on breeding practice.some advanced breeding theories that form in the traditional breeding method practice for many years, for example erect head shape has yield potential (Chen Wenfu, Xu Zhenjin, Zhang Longbu, et al. (2000) Theories and practices of rice breeding for super high yield.Proceedings of International Conference on Engineering and Technological Science[C] .378-382), rare heavy fringe has that contradiction is not mated in storehouse, solution source and the characteristics (Zhou Kaida that takes full advantage of energy, horse Yuqin, Liu Taiqing, Deng the seed selection of (1995) hybrid rice subspecies Heavy Grain Ear Type Combination.Sichuan Agricultural University's journal 13 (4): 403-407), close straight fringe can significantly increase production (HuangX, Qian Q, Liu Z, Sun H, He S, Luo D, Xia G, Chu C, Li J, Fu X (2009) Natural variaion at the DEP1 locus enhances grain yield in rice.Nature Genetics 41:494-497) etc., section is the target that the fringe shape improvement take the branch stalk as the basis just can reach.Therefore, only understand growth course and the molecule mechanism of branch stalk, and by molecular biological instrument, can by the method for molecule the region between the heart and the diaphragm kind, reach with a definite target in view the more breeding objective of high yield.

From growth course and structure, the branch stalk of paddy rice is grown and is related to four levels: cob (rachis), Their First Branch stalk (primary branches), secondary branch stalk (secondary branches), bennet (pedicels).The paddy rice inflorescence development need to form three class meristematic tissue: cob branch stalk meristematic tissue, adnation fringe meristematic tissue is given birth to the fringe meristematic tissue with the top.Cob, Their First Branch stalk and secondary branch stalk are all from the same class meristematic tissue, and bennet is respectively from two kinds of fringe meristematic tissue.The bennet that fringe is given birth on the top can directly be broken up out by the branch stalk, and adnation Honoka stalk must be directed to the formation of branch stalk lateral meristem.Up to the present, had been found that and surpassed the rice panicle type mutant of 17 types.the oligogene that participates in these morphology of terminal inflorescence controls has just been reported (the Kinoshita T of kind more than 20 as far back as many years ago, Takahashi M (1991) The one hundredth report of genetical studies on the rice plant.Linkage studies and future prospects.J.Fac.Agric.Hokkaido Univ.65:1-61), these gene clonings, provide molecule mechanism more and more clearly for understanding building up of fringe section form, make high-yield breeding of crops along the target of molecular designing Ideal Plant Morphology greatly near a step.particularly clearer and more definite for the molecular biological mechanism of controlling paddy rice cob, I and II branch stalk origin and development, antipeduncular growth, LAX1 can only explain bennet source (Oikawa T and Kyozuka J (2009) the Two-Step Regulation of LAX PANICLE 1Protein Accumulation in Axillary Meristem Formation in Rice.PLANT CELL 21 (4): 1095-1108) of adnation fringe, comprise all Florescence development information (Komatsu M in the merismatic differentiation information of the fringe of FZP Gene Handling, Maekawa M, Shimamoto K, and Kyozuka J (2001) The LAX1 and FRIZZY PANICLE 2 Genes Determine the Inflorescence Architecture of Rice by Controlling Rachis-Branch and Spikelet Development.Developmental Biology 23:364-373), but these genes all can not be explained a kind of rice mutant that bennet forms because of contraction in length---the fringe mutant clusters.

Nineteen fifty-seven, (Jodon NE (1957) Inheritance of some of the more striking characters in rice.J.Hered.48 (4): 181-192) report finds to cluster fringe mutant Cl to Jodon the earliest.Show as Xiao Hua on the Overall View of this mutant and lose the characteristic that classification is arranged on the branch stalk normally, and be the also living state that clusters together of 2 to 5 small ears.The discoverer is described as it " fringe clusters " according to its face shaping.Except this name, somebody general's called after " composite grain rice " (Tian Cui, Zhang Tao, Jiang Kaifeng, Yang Li, Yang Qianhua, Wan Xianqi, Zheng Jiakui (1010) paddy rice small ear the cluster genetic analysis of mutant and the Primary Location of gene thereof.Molecular Plant Breeding 8:29-34), the investigator is also arranged especially only having two fringes to cluster on the Their First Branch stalk, type mutant called after " wheat grain husk rice " (Chen Hongqi normally clusters at other positions, Liu Gang, Zhu Xudong waits (2002). paddy rice cluster evaluation and the heredity of fringe mutant. and Agricultural University Of Nanjing's journal 25 (3): 116-118).From the above Preliminary Genetic positioning result of delivering the mutant of different names document (Zheng Leiying, Zhu Xudong, before money, Zhao Zhong, Zhang Jianjun, Hu Xiaohe, Lin Hongxuan, form and the positioning analysis of Luo Da (2003) Rice Panicle mutant CL.Science Bulletin 48:264-267), except the difference of bearing accuracy, all drop in the narrow section of identical karyomit(e), therefore can infer, domestic several fringe genes that cluster of having located at present are all equipotentials.

Storehouse, the source stream that has profound influence on thremmatology is theoretical, is guiding the breeding practice of crop always.The material link of stream mainly is stipes and branch stalk.The result of rice dwarf volume increase shows, it is mainly to enlarge the optimum result in gonosome storehouse by reducing the nutrition body source, therefore infer that the cladus stalk may be one of main stream link.

Summary of the invention

An object of the present invention is to provide albumen and the encoding gene thereof relevant to plant fringe shape.

The albumen relevant to plant fringe shape provided by the present invention, name is called SPED, derives from paddy rice (Oryza sativa L.), is following (a) or protein (b):

(a) protein that is formed by the aminoacid sequence shown in sequence in sequence table 1;

(b) with the amino acid residue sequence of sequence in sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to plant fringe shape by (a) derivative protein.

Sequence 1 in sequence table is comprised of 530 amino-acid residues.

The replacement of above-mentioned one or several amino-acid residue and/or disappearance and/or interpolation refer to be no more than replacement and/or disappearance and/or the interpolation of 10 amino-acid residues.

Above-mentioned (a) but in SPED albumen synthetic, also can first synthesize its encoding gene, then carry out biological expression and obtain.Above-mentioned (b) but in SPED derived protein synthetic, also can be by lacking and/or increase the codon of one or several amino-acid residue in the DNA sequence dna shown in sequence in sequence table 2, and/or the missense mutation of carrying out one or several base pair obtains encoding gene, then carries out biological expression and obtain.

The encoding gene of the described albumen relevant to plant fringe shape is following 1)-3) in arbitrary described gene:

1) DNA molecular shown in sequence 2 in sequence table;

2) under stringent condition with 1) shown in DNA molecule hybridize and the gene of encoding said proteins;

3) with 1) or 2) gene have homology more than 90% and the gene of encoding said proteins.

Sequence 2 in sequence table is comprised of 1593 Nucleotide, and coding has the SPED albumen of the aminoacid sequence of sequence 1 in sequence table.

Above-mentioned stringent condition can be: (or in the solution of 0.1 * SSC), 0.1%SDS, carry out DNA or RNA hybrid experiment and wash film under 65 ℃ at 0.1 * SSPE.

The expression cassette, recombinant expression vector, transgenic cell line or the recombinant bacterium that contain the encoding gene of the described albumen relevant to plant fringe shape also belong to protection scope of the present invention.

Described recombinant expression vector is to insert the recombinant expression vector that described encoding gene obtains between the multiple clone site of carrier pCAMBIA1301.

The primer pair of described encoding gene total length or its arbitrary fragment of increasing also belongs to protection scope of the present invention, and in described primer pair, a primer sequence is as shown in sequence in sequence table 3, and another primer sequence is as shown in sequence in sequence table 4.

Another object of the present invention is to provide a kind of method of cultivating transgenic plant.

The method of cultivation provided by the present invention transgenic plant is in the encoding gene importing purpose plant with the described albumen relevant to plant fringe shape, obtains comparing with described purpose plant the transgenic plant of fringe shape change.

Described fringe shape change is presented as: compare with described purpose plant, described transgenic plant cob top bennet and terminal inflorescence stalk shorten.

The encoding gene of the described albumen relevant to plant fringe shape is to import in the purpose plant by described recombinant expression vector.

Described purpose plant is dicotyledons or monocotyledons; Described monocotyledons is paddy rice.

The encoding gene SPED of the albumen relevant to plant fringe shape provided by the present invention is the gene of a main regulation and control bennet and end far away 1 to 3 joint peduncle Fiber elongation, but does not affect the differentiation of bennet and end peduncle far away.Bennet shorten be fringe cluster that mutant has stable, heredity on the proterties of complete dominance, and fringe to cluster be the Incomplete dominance proterties that is subject to various factors.Therefore the short bennet mutant of mutant called after (SPED, shortened pedicel and peduncle) clusters our this fringe.Research conclusion of the present invention shows, the SPED gene is the gene of special control bennet Fiber elongation, and the hint bennet is to come to be different from merismatic novel branch stalk meristematic tissue---the bennet meristematic tissue (pedicel meristem, PEDM) of secondary branch stalk; It is the gene that merismatic growth has regulatory function to paddy rice cob branch stalk.Pass through bioinformatic analysis, find that SPED albumen is the typical Alpha-helix albumen with 9-12 PPR (pentatricopeptide repeat) structure, the tertiary structure prediction shows to have nickel (nickel) ion aglucon binding site in functional zone, and an albumen that contains the dnmt rna structural domain in aminoacid sequence and clover has 40% consistence, these features show, SPED albumen may participate in the DNA methylation approach affects vital movement.By clone SPED gene, understand the particularly growth problem of end branch stalk of Rice Panicle morphogenesis in depth, explore the determinative that biological substance is carried to the storehouse by the source, the final deep layer theoretical question that solves " Ideal Plant Morphology " will be expected to guide new direction for high-yield breeding of crops.

Description of drawings

Fig. 1 is fringe section's form heredity of SPED mutant and grows schematic diagram.

Fig. 2 is the Fine Mapping of the initiative of STS mark and SPED gene.

Fig. 3 is SPED gene order and complementary checking and crosses and express the checking section.

Fig. 4 is the pcr analysis of the special STS mark-CSPJ320B of SPED gene.

Fig. 5 is recombinant expression vector p1301::SPED schematic diagram.

Fig. 6 turns SPED trans-genetic hybrid rice T0 for the bennet form of plant and adopts the hygromycin gene mark and the detection of SPED gene STS label.

Embodiment

The experimental technique that uses in following embodiment is ordinary method if no special instructions.

In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.

The acquisition of embodiment 1, the SPED gene relevant to Rice Panicle shape

One, SPED mutant character

Under summer natural condition, the SPED mutant is nourished and grown state without extremely, but fringe section form changes, mainly contain two aspects: the one, from small ear the state of giving birth to, originally be step and be distributed in the grain (grain husk flower) that a secondary branch obstructs, cluster into one in the part at top, generally have 3 to 5 to cluster, and a secondary branch stalk upper from the top down the small ear at several 3 to 5 following positions still by certain tonsure distance give birth on the branch stalk; The 2nd, from end branch stalk proterties, all bennets that directly connect small ear all extremely shorten to 1.0 millimeter, every grade of peduncle is counted from top to bottom and is had 1 to 3 joint to shorten in addition, wherein shortening 1 joint peduncle shows as small ear and is 3 and clusters, shortening 2 joints has 4 to cluster, can have at most 3 joint peduncles shortenings to cause 5 and cluster, and all secondary branch stalks all show as shortening (A in Fig. 1).In Fig. 1, B is the fringe type of wild-type plant.

The F1 that produces with SPED and 9311 hybridization for the material self propagated after, in statistics F2, each Honoka stalk length of mutant plant is analyzed, find that the mutant plant only has the super mutant parent of 1 to 2 millimeter to change at the 1st fringe and the 6th fringe, other bennets at different levels are all at 1 millimeter (C and D in Fig. 1).And except bennet shortened, other peduncles did not shorten.Can conclude thus the development models that obtains SPED mutant inflorescence branch stalk: the Fiber elongation strongly inhibited of bennet and top peduncle, seed present more than 3 seriously clusters, as SPED mutant parent; Or only having bennet seriously to shorten, top peduncle Fiber elongation is not suppressed, and clusters thereby make inflorescence seed form present 2, as the phenotype in 9311 genetic backgrounds (Fig. 1 C divides the middle and upper part).

Two, genetic analysis and the Primary Location of the gene SPED relevant to plant fringe shape

At Beijing field experiment, take mutant SPED as male parent, respectively with 9311, R498, R549, R527, Balila, K1/Pita, 7 mixing breeds such as anti-extensive 527, obtain to be seeded in Lingshui, Hainan self propagated after F1, obtain F2 for seed, get part F2 seed and plant in Beijing, and the separation of investigation mutant character, statistic data.Cross combination and genetic analysis result such as table 1.

Table 1 cross combination that genetic analysis is adopted and analytical results

Result shows, the SPED mutant character is by the dominant control heredity of single-gene.Carry out the phenotype evaluation from the degree of clustering, SPED presents situation in different genetic background have difference; Estimate from the phenotype that bennet shortens, SPED all presents complete dominance in all genetic background.And then take mutant SPED as male parent and 9311 hybridization, its F1 seed is in Lingshui, Hainan self propagated, obtain F2 and plant in Beijing for seed, set up a total individual plant number and be 5298 strain F2 for colony, wherein 1318 strain phenotypes are that the individual plant of wild-type is used to carry out mapping analysis.

Primary Location step: gather F2 for the single-strain blade of wild-type phenotype in colony, respectively DNA extraction.Respectively get 6 strain wild-types and mutant phenotype F2 for individual plant DNA, respectively balanced mix consists of wild-type DNA pond and mutant DNA pond.110 SSR marks evenly choosing on http://www.gramene.org/microsat/ssr.html and http://ricelab.plbr.cornell.edu/publications/2005/IRGSP/supplem entaltable18.xls website on 12 karyomit(e)s of paddy rice carry out SSR mark linkage analysis to parent and wild-type DNA pond and mutant DNA pond.Arrive the consistent SSR primer of polymorphism to all increasing in parent and wild-type DNA pond and mutant DNA pond, then enlarge colony and verify.Carry out preliminary identification interval to determine Primary Location.Through the microcommunity linkage analysis of 98 wild-type individual plants, the SPED gene is limited between paddy rice two SSR molecule marker RM5957 of No. 6 karyomit(e) underarm and RM3827, is about 2.5Mbp (A in Fig. 2) between positioning area.These two marks detect respectively 6 strains and 4 strains exchange individual plant.

Three, the Fine Mapping of the initiative of STS mark and SPED gene

Choose the SSR mark between RM5957 and RM3827 mark (seeing Table 2) in above-mentioned paddy rice SSR registration database, the exchange individual plant that screens in 98 strain Primary Location colonies is screened.Polymorphic primer used is respectively RM275, RM20384, RM20297, RM20303, RM20311, RM20315, RM1340 (seeing Table 2).Wherein RM275 and RM1340 detect 3 strains and 1 strain exchange strain respectively from RM5957 and RM3827 are labeled as the individual plant of exchange.Adopt these two marks to filter out the exchange strain respectively from 1318 strain wild-type target groups.By location retrieval, (http://www.gramene.org/Oryza_sativa/Location/) from selecting more SSR primer between above-mentioned mark zone, carries out chromosome walking to the exchange strain that screens in the gramene site databases.when marker chromosomes step moves on to zone distance and is about 300K, by the NCBI website compare this interval in the sequence of indica and japonica, to sequences Design STS (the sequence tagged sites) primer that has each other the disappearance more than 10bp, obtain altogether 6 couples of STS mark (CSP1 that polymorphism is good, CSP4, CSP7, CSP8, CSP25 and CSP30) (seeing Table 2), their amplified fragments is that 100bp does not wait to 500bp, target interval focuses on the 19.2Kb scope interior (B and C in Fig. 2) between CSP30 and CSP25 mark the most at last.

Mark and the primer formulated in table 2 process of the present invention

Four, the initiative of SPED predictive genes and STS label C SPJ320B thereof

With Genescan software ( Http:// genes.mit.edu/GENSCAN.html) sequence of 19.2kb between positioning area is carried out predictive genes, find 1 obvious open reading frame (ORF), be the candidate gene (C in Fig. 2 of SPED; C: the structure of candidate gene, thick line represents exon).This gene intronless, 530 amino acid of encoding have the non-translational region (in Fig. 3, Pro775bp-SPED contains for the SPED from mutant the structure iron that endogenesis promoter starts the SPED gene) of 567bp in its terminator codon downstream.According to the primers of this gene in database, the amplification rear clone order-checking take SPED mutant and 9311 parent DNA as the template High fidelity PCR, sequence alignment finds that the promoter region of ATG upstream 775bp has the disappearance of a 69bp, there is the point mutation of 3 places in expressed sequence, respectively+209 by A become C ,+1240 by A become C ,+1341 become A (Fig. 3) by C.The cloning and sequencing result shows, the deoxyribonucleotide sequence of the full length cDNA sequence of SPED gene is as shown in sequence in sequence table 2.In sequence table, sequence 2 is by 1593 based compositions, and coding has the protein of the amino acid residue sequence shown in sequence 1 in sequence table, and in sequence table, sequence 1 is comprised of 530 amino-acid residues, with this protein called after SPED.

According to two mutational sites of SPED gene inside, designed the STS mark CSPJ320B (primer sequence of this mark sees Table 2) of the special differentiation of energy SPED gene, grope through the PCR condition, at 94 ℃ of 2min; 94 ℃ of 45s, 64 ℃ of 45s, 72 ℃ of 20s, 35cycle; Under the thermal cycle conditions of 72 ℃ of 5min, use magnificent Taq polymerase buffer formulated reaction system, take SPED mutant, wild-type 9311 and wild-type TP309 genomic dna as template, carry out pcr amplification respectively.Amplification is seen Fig. 4, as seen from Figure 4, can obtain the specific amplified band of 140bp in the SPED mutant, and in wild-type 9311 and wild-type TP309 without this specific amplified band.

Five, the structural analysis of SPED proteins encoded

The full length amino acid sequence analysis coded to gene SPED finds that it is made of 12 PPR degeneracy amino acid motif tumor-necrosis factor glycoproteinss the most nearly, and these degeneracys PPR sequence each unit is that 31 or 35 amino acid form.

Embodiment 2, turn the fringe conformal analysis of SPED trans-genetic hybrid rice plant

The SPED gene design primer that 1 amplification obtains according to above-described embodiment adds EcoRI and HindIII restriction enzyme site, and primer sequence is as follows:

SPED-F:GC GAATTCGGCTGACCTCAGCTTGAGTT (underscore is the EcoRI site) (in sequence table, sequence 3),

SPED-R:GC AAGCTTGTTGGTCCAGTCAAACTAATG (underscore is the HindIII site) (in sequence table, sequence 4),

SPED gene shown in sequence 2 as template, carries out pcr amplification in the sequence table of synthetic, and amplification obtains the double-stranded cDNA product of total length of the SPED gene of 1176bp, respectively adds EcoRI and HindIII restriction enzyme site at this gene order two ends.Product after EcoRI and HindIII double digestion, is connected between the EcoRI and HindIII restriction enzyme site of expression vector pCAMBIA1301 (available from CAMBIA company), obtains the purpose plasmid.The purpose plasmid is changed in intestinal bacteria, resistance screening, the picking positive colony, positive colony is carried out liquid culture, extract the positive colony plasmid and carry out sequence verification, sequencing result shows inserted the SPED gene fragment shown in sequence 2 in the sequence table between the EcoRI of carrier pCAMBIA1301 and HindIII restriction enzyme site, prove that recombinant expression vector builds correctly, with this recombinant expression vector called after p1301::SPED, building process as shown in Figure 5.(public can obtain with developmental biology institute from Chinese Academy of Sciences heredity to change the expression vector p1301::SPED of restructuring over to paddy rice TP309 by agriculture bacillus mediated method, the non-patent literature of putting down in writing this material is: A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21.Song WY et al.Science.1995,270 (5243): 1804-6), obtain 3 paddy rice T0 that turn the SPED gene for strain.The transgenosis concrete grammar is seen Plant Molecular Biology, 2003,52:957-966.

The contrast take paddy rice TP309 plant as wild-type.Empty carrier pCAMBIA1301 is transformed the TP309 rice plant, obtain 5 T0 that turn empty carrier for strain.3 that obtain turn SPED trans-genetic hybrid rice T0 and compare with wild-type adjoining tree (TP309) for plant (T0-1), and cob top part bennet and terminal inflorescence stalk shorten, and form two also (A in Fig. 6) together.The T0 that turns empty carrier does not have obvious difference for phenotype and the wild-type contrast TP309 of plant.

Respectively take turn SPED trans-genetic hybrid rice T0 for the genomic dna of plant and wild-type adjoining tree as template, carry out pcr amplification with hygromycin gene labeled primer (HYG-F and HYG-R) and special STS mark CSPJ320B (CSPJ320B-F and CSPJ320B-R) and detect, primer sequence is as follows:

HYG-F：5’-ttctacacagccatcggtcc-3’，

HYG-R：5’-caaactgtgatggacgacacc-3’；

CSPJ320B-F：5’-caatgagggaggtttatcagc-3’，

CSPJ320B-R：5’-ccaaacagtggcatagcatccttt-3’。

The pcr amplification detected result is as shown in B in Fig. 6, turn SPED trans-genetic hybrid rice T0 at 3 and the hygromycin gene fragment of 500bp can be detected in for plant (TP309-T0-1, TP309-T0-2 and TP309-T0-3 in Fig. 6), and can't detect this band in wild-type adjoining tree (TP309 in Fig. 6); Simultaneously, special STS mark CSPJ320B turns SPED trans-genetic hybrid rice T0 SPED mutant and 3 all can detect the band of 140bp in for plant, and can't detect this band in wild-type TP309.

Claims (10)

1. albumen is following (a) or protein (b):

(a) protein that is formed by the aminoacid sequence shown in sequence in sequence table 1;

(b) with the amino acid residue sequence of sequence in sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to plant fringe shape by (a) derivative protein.

2. the encoding gene of the described albumen of claim 1.

3. encoding gene according to claim 2, it is characterized in that: the encoding gene of described albumen is following 1)-3) in arbitrary described gene:

1) DNA molecular shown in sequence 2 in sequence table;

2) under stringent condition with 1) shown in DNA molecule hybridize and the gene of encoding said proteins;

3) with 1) or 2) gene have homology more than 90% and the gene of encoding said proteins.

4. the expression cassette, recombinant expression vector, transgenic cell line or the recombinant bacterium that contain claim 2 or 3 described encoding genes.

5. recombinant expression vector according to claim 4 is characterized in that: described recombinant expression vector is to insert the recombinant expression vector that described encoding gene obtains between the multiple clone site of carrier pCAMBIA1301.

6. the primer pair of the described encoding gene total length of claim 2 or 3 or its arbitrary fragment of increasing, in described primer pair, a primer sequence is as shown in sequence in sequence table 3, and another primer sequence is as shown in sequence in sequence table 4.

7. a method of cultivating transgenic plant, be that the described encoding gene of claim 2 or 3 is imported in the purpose plant, obtains comparing with described purpose plant the transgenic plant that fringe shape changes.

8. method according to claim 7 is characterized in that: described fringe shape changes and is presented as: compare with described purpose plant, described transgenic plant cob top bennet and terminal inflorescence stalk shorten.

9. according to claim 7 or 8 described methods is characterized in that: the described encoding gene of claim 2 or 3 is to import in the purpose plant by the described recombinant expression vector of claim 4 or 5.

10. arbitrary described method according to claim 7-9, it is characterized in that: described purpose plant is dicotyledons or monocotyledons; Described monocotyledons is paddy rice.

Images