CN109354615B

CN109354615B - LEPTO1 and application of encoding protein thereof in rice fertility control

Info

Publication number: CN109354615B
Application number: CN201811452764.9A
Authority: CN
Inventors: 程祝宽; 赵婷婷; 李亚非; 唐丁; 沈懿; 杜桂杰
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2018-11-30
Filing date: 2018-11-30
Publication date: 2020-11-03
Anticipated expiration: 2038-11-30
Also published as: CN109354615A

Abstract

The invention discloses an application of LEPTO1 protein and a coding gene thereof in regulation and control of male fertility of plants. The invention provides the use of a substance which inhibits the activity and/or level of LEPTO1 protein in the cultivation of male sterile plants; or the substance which inhibits or reduces the expression of the gene coding for the LEPTO1 protein in the cultivation of male sterile plants. The inventors of the invention knock out the gene in wild type rice by CRISPR-Cas9 gene editing technology, which can cause the development of pollen mother cells to be arrested in the early thin line stage and lead to chromosome degradation and final pollen abortion. The site-directed mutagenesis of the LEPTO1 protein coding gene by adopting a tissue-specific gene knockout technology can be used for rice fertility control and hybrid seed production, so that the invention has important significance in rice breeding and can provide important biological resources for increasing the rice yield and improving the rice quality.

Description

LEPTO1 and application of encoding protein thereof in rice fertility control

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an application of LEPTO1 and a coded protein thereof in rice fertility control.

Background

Rice is one of the most important food crops in the world, and rice is used as food in nearly half of the world population. The rice is the first large grain crop in China, so that the key problem in agricultural production in China is how to improve the yield of the rice. With the influence of factors such as the increase of the population of the world, the reduction of the cultivated land area, the deterioration of the climatic conditions and the like, the requirement of the mankind on the increase of the rice yield is increasingly highlighted. In two 'green revolution', the yield per unit of rice is increased in a breakthrough way. The first green revolution occurs in the middle of the 20 th century, and is mainly characterized in that high stems of rice are changed into short stems, the yield of the rice is greatly improved along with the popularization of short stem varieties, and the problem of food self-sufficiency in many countries is solved. The second green revolution occurs in the second half of the 20 th century, and hybrid rice in China is an outstanding representative of the second green revolution. The hybrid rice fully utilizes the heterosis of the rice, realizes the dramatic improvement of the rice yield, and creates huge economic benefits all over the world.

Hybrid rice is bred by a three-line breeding method. The three lines include male sterile line, maintainer line and restoring line. Male sterile line refers to rice with male degenerated but normal pistils. The fertilization and fructification can be realized only by foreign pollen. The maintainer line is rice with normal development of both stamen and pistil, and features that its progeny is still sterile after pollination to sterile line with its pollen. The restoring line is also rice with stamens and pistils capable of developing normally, and features that the stamens of hybrid seeds produced after pollination of sterile line with its pollen can develop normally and can be selfed to fruit. The key of the three-line breeding method for breeding hybrid rice is to find a suitable male sterile line. However, male sterile plants in nature are rare and difficult to identify. Therefore, the genetic engineering approach to obtain male sterile lines is an important direction for cross breeding.

Meiosis is a special division pattern of a cell that undergoes two cell divisions once DNA replication when a eukaryote forms a gamete. Gametes with halved chromosome number are produced by meiosis, and chromosome is doubled by fertilization to maintain chromosome number stability. An important event after meiosis initiation is fine line phase morphogenesis. To date, two genes MEL1 and MEL2, which are involved in rice growth in the fine line phase, have been co-cloned in rice.

In recent years, the rapid development of gene editing techniques typified by CRISPR-Cas9 has enabled techniques for site-directed editing of genes. Because of its simple and efficient characteristics, it has been widely used in gene editing of animals and plants.

Disclosure of Invention

It is an object of the present invention to provide the use of a substance which inhibits the activity and/or amount of LEPTO1 protein.

The invention provides the use of a substance which inhibits the activity and/or level of LEPTO1 protein in the cultivation of male sterile plants;

the invention also provides the application of the substance for inhibiting or reducing the expression of the LEPTO1 protein coding gene in breeding male sterile plants;

the LEPTO1 protein is (a) or (b) or (c) as follows:

(a) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

(b) a protein derived from rice, having 98% or more identity to (a), and being associated with male fertility of a plant;

(c) and (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 2 in the sequence table and is related to the male fertility of the plant.

In the application, the substance is a CRISPR-Cas 9system, the system expresses a Cas9 protein gene and a sgRNA gene, and a target sequence of the sgRNA is shown as a sequence 4 in a sequence table. The system can be a vector, and the gene of the Cas9 protein and the gene of the sgRNA can be in the same vector or different vectors.

It is another object of the present invention to provide a method for breeding male sterile plants.

The invention provides a method for cultivating male sterile plants, which comprises the following steps: inhibiting the expression of an LEPTO1 protein coding gene in a target plant to obtain a male sterile plant;

the LEPTO1 protein is (a) or (b) or (c) as follows:

The encoding gene of the LEPTO1 protein is a DNA molecule of 1) or 2) or 3) or 4) or 5) as follows:

1) the coding region is shown as the DNA molecule at the 351-2231 site of the sequence 1 in the sequence table;

2) DNA molecule shown in sequence 1 in the sequence table;

3) DNA molecules which are derived from rice, have more than 98 percent of homology with the DNA sequences limited by the 1) or the 2) and code plant male fertility related proteins;

4) a DNA molecule which is hybridized with the DNA sequence defined in 1) or 2) under strict conditions and encodes a plant male fertility related protein;

5) a DNA molecule which has more than 90 percent of homology with the DNA sequence defined by 1) or 2) and encodes the plant male fertility related protein.

The invention also provides a method for cultivating male sterile plants, which comprises the following steps: reducing or inhibiting the activity and/or content of LEPTO1 protein in a target plant to obtain a male sterile plant;

the LEPTO1 protein is (a) or (b) or (c) as follows:

In the above, reducing or inhibiting the expression or activity of LEPTO1 protein in a plant of interest; or the expression of the LEPTO1 protein coding gene in the target plant is inhibited by adopting CRISPR-Cas9 site-directed mutagenesis LEPTO1 protein coding gene, wherein in the CRISPR-Cas9 site-directed mutagenesis, the target sequence of sgRNA is shown as a sequence 4 in a sequence table.

The CRISPR-Cas9 site-directed mutagenesis LEPTO1 protein encoding gene is realized by introducing a recombinant plasmid into a target plant; the recombinant plasmid has a gene for expressing Cas9 protein and a gene for expressing sgRNA, and the target sequence of the sgRNA is shown as a sequence 4 in a sequence table. In the embodiment of the invention, the recombinant plasmid is pCAMBIA1300-cas9-gRNA, the plasmid is a recombinant plasmid obtained by inserting a DNA molecule shown in a sequence 3 of a sequence table into a multiple cloning site (for example, between BamHI and KpnI enzyme cutting sites) of a pCAMBIA1300-cas9 vector, the plasmid expresses sgRNA, and the target sequence of the sgRNA is shown in a sequence 4 of the sequence table.

The invention also protects a sgRNA, and the target sequence of the sgRNA is shown as a sequence 4 in the sequence table.

The invention also discloses a recombinant plasmid, wherein the recombinant plasmid has a gene for expressing the Cas9 protein and a gene for expressing the sgRNA, and the target sequence of the sgRNA is shown as a sequence 4 in the sequence table. The recombinant plasmid can be specifically a recombinant plasmid pCAMBIA1300-cas 9-gRNA. The recombinant plasmid pCAMBIA1300-cas9-gRNA is: the recombinant plasmid is obtained by inserting a DNA molecule shown in a sequence 3 of a sequence table into a multiple cloning site (for example, between BamHI and KpnI enzyme cutting sites) of a pCAMBIA1300-cas9 vector.

The invention also protects a protein (LEPTO1 protein) which is (a) or (b) or (c) as follows:

Nucleic acid molecules encoding the LEPTO1 protein are also within the scope of the invention, and are in particular DNA molecules of 1) or 2) or 3) or 4) or 5) as follows:

2) DNA molecule shown in sequence 1 in the sequence table;

The invention also protects the application of any one of the methods, the protein, the nucleic acid molecule, the sgRNA or the recombinant plasmid in plant breeding.

Any one of the above male sterility is embodied as complete abortion of all pollen.

Any of the above plants is a monocot or a dicot. The monocotyledon is a gramineous plant. The gramineous plant is a plant of the genus oryza. The Oryza plant is rice. The rice can be specifically No. 8 salt rice.

The invention is provided with⁶⁰A sterile mutant LEPTO1 is obtained from the material of indica rice Guang-Lu-dwarf No. 4 by a Co-gamma radiation mutagenesis method, and a mutant gene LEPTO1 is separated by a map-based cloning method. By combining cell biology and genetics, the LEPTO1 mutation was found to cause a fine line morphogenetic defect, resulting in a pollenless phenotype. The cloning of the gene provides a way for artificially producing a male sterile line. The invention can be used for rice fertility control and hybrid seed production by combining a CRISPR-Cas9 gene editing method and adopting a tissue-specific gene knockout technology to carry out site-directed mutagenesis on the LEPTO1 protein coding gene, so that the invention has important significance in rice breeding and can provide important biological resources for increasing the rice yield and improving the rice quality.

Drawings

FIG. 1 shows that leptin 1 is a pollen-free phenotype mutant.

Fig. 2 shows the expression pattern of LEPTO1 gene.

FIG. 3 shows that meiosis of lepto1 pollen mother cells stagnated in the fine line phase.

FIG. 4 shows phenotypic identification of leptin 1-cas 9.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

The indica rice variety Guang-Lu-dwarf No. 4 is called Guang-Lu-dwarf No. 4 for short. The rice variety saline rice No. 8 is called saline rice No. 8 for short. References to SK-gRNA vectors and pC1300-Cas9 vectors (also known as pCAMBIA1300-Cas 9): wang, C.C., Shen, L.Ful.Y., Yan, C.Wang, K. (2015) A Simple CRISPR/Cas9System for Multiplex genome editing in Rice. journal of Genetics and Genomics 42(2015) 703-706.

Example 1 cloning of the LEPTO1 Gene

1. Phenotypic analysis of leptin 1

The method is carried out on indica rice variety Guang-Lu-dwarf No. 4⁶⁰Performing Co-gamma radiation mutagenesis to obtain a series of mutants.

The results of comparison of the mutant leptin 1 with wild type Guangdong dwarf No. 4 are shown in FIG. 1, (A) wild type (left) and leptin 1 (right) plants; (B) spike comparison of wild type (left) with leptin 1 (right); (C) comparison of floret morphologies of wild type (left) and leptin 1 (right); (D) wild type anther I₂KI dyeing; (E) i of leptin 1 anther₂KI staining. Scale, 10 μm; of these, leptin 1 showed no significant difference from wild type at vegetative growth stage, but appeared to be weak (FIGS. 1A and 1B). However, compared to wild type, the anthers of leptin 1 were small and appeared white (FIG. 1C), I₂KI staining indicated that leptin 1 exhibited a pollen-free phenotype (FIGS. 1D and 1E).

2. Map-based cloning of mutant genes

Crossing the plant capable of producing shape separated progeny (fertile and sterile) with japonica rice variety Wuyujing No. 8, and pairing F₂210 sterile individuals of (1) and F₃450 sterile individuals in the strain are subjected to initial positioning analysis of mutant genes. The STS molecular marker is used to locate the gene in the 120kb interval on the short arm of chromosome 2. Sequencing revealed that the sterile plants have 7 base deletions in the fifth exon of the gene LOC _ Os02g 08500.

TABLE 1 map-based molecular cloning marker

3. Obtaining of full-Length cDNA of LEPTO1 Gene

The cDNA (sequence 1) with 2486bp of the gene full length is obtained by Rapid Amplification of CDNA End (RACE), and the open reading frame of the gene is the 351-2231 th site of the sequence 1; the gene is named as LEPTO1, the protein coded by the gene is named as LEPTO1, and the amino acid sequence of the protein is sequence 2.

Example 2 expression Pattern of the LEPTO1 Gene

1. Real-time quantitative PCR

The expression level of the LEPTO1 gene in roots, internodes, leaves and ears of Guangdong dwarf No. 4 is detected by a real-time quantitative PCR method, and the expression level of the LEPTO1 gene in the young ears of the leptin 1 mutant (LEPTO1) is detected. The Ubiquitin gene serves as an internal reference.

The results are shown in FIG. 2A, R, root; in, internode; l, leaf; p1, 1cm ear; p2, 2cm ear; p3, 3cm ear; p4, 4cm ear; p10, 10cm ear. Ubiquitin as an internal reference, error bars represent standard errors for three biological replicates; the expression of LEPTO1 in different tissues is shown, and the expression level is highest in 1cm long spikes.

2. In situ hybridization

The pollen of Guangdong dwarf No. 4 is taken and subjected to RNA in situ hybridization to analyze the precise space-time expression pattern of the LEPTO1 gene.

The results are shown in FIGS. 2B-2G (2B, two-stage; 2C, three-stage; 2D and 2E, four-stage early; 2F, bold line; 2G, sense probe control (sense probe RNA sequence CCUCUUGAGUCGAGCAAUCAGCAACACCUUAGUCGGGUGCAUUCAUCUUCUGCAGAUCCAUUUAGCACACUUGUUGGUGAGUCUCCCCAGUUUCCUGAUCUUGGAAGAACCACCAAUACUUGGCAAACUGCGGUUCCAUCCAACAUUCAGGAUCGUGGUCACAAUGAUAACAUGUCGCAAGCCACCCUGCAUAUGAAUGGCCCCAAAAUUGAACCUGUCUCAAGCUUCACAUCAUCCAAUCAGAUUCCGCUGCUGGGAAAUGAGAUGCAGGGCCAAGUAGCAUCACUAGCUAGCAAUGUUCCA), scale, 5 μm, indicating that LEPTO1 is highly expressed in anther three-stage and four-stage early and that the expression of LEPTO1 is mainly concentrated in pollen mother cells.

Example 3 cytological phenotypic analysis of leptin 1

To determine the cause of pollen-free mutant leptin 1, chromosomal behavior was observed in pollen mother cells of the Guangdong dwarf No. 4 (wild type) and leptin 1 mutants by DAPI staining of knocked-out floret slides and anther semi-thin resin sections.

The results are shown in FIG. 3, (A) chromosome morphology in wild type and in lepto1 knocked-out floret pollen mother cells; (B) DAPI staining observation of wild type anther semi-thin resin sections; (C) DAPI staining of the semithin resin sections of leptin 1 anthers; scale, 10 μm; it can be seen that, in the wild type, the first period after the onset of meiosis is the anterior thin line period, at which time chromosomes are scattered and partially agglutinated; in the early fine line phase, the chromosomes stretch out. In the fine line phase, chromosomes process into long lines; in the leptin 1, the observation of florets with different sizes shows that the chromosomes are in a state similar to the wild-type chromosome in the early thin line stage in a longer period of pollen mother cell development, which indicates that the development of the leptin 1 pollen mother cell is stagnated in the early thin line stage; eventually, chromosomes are degraded in the lepto1 pollen mother cells.

Example 4 site-directed mutagenesis of the LEPTO1 Gene

Construction of recombinant plasmid

1. Single-stranded DNA molecules LEPTO1-CAS9-F and LEPTO1-CAS9-R were synthesized separately and then annealed together to give double-stranded DNA molecules having sticky ends at both ends.

LEPTO1-CAS9-F:ggcaCCAGTTCCCGGTCGGCATGC

LEPTO1-CAS9-R:aaacGCATGCCGACCGGGAACTGG

2. And (3) carrying out enzyme digestion on the SK-gRNA vector by using a restriction enzyme AarI, and recovering the linearized vector framework.

3. And (3) connecting the double-stranded DNA molecules obtained in the step (1) with the linearized vector skeleton obtained in the step (2) to obtain recombinant plasmids.

4. Taking the recombinant plasmid obtained in the step 3, carrying out double enzyme digestion by using restriction enzymes BamHI and KpnI, and recovering a small fragment.

5. Taking the pCAMBIA1300-cas9 vector, carrying out double enzyme digestion by using restriction enzymes BamHI and KpnI, and recovering a large fragment.

6. And (3) connecting the small fragment obtained in the step (4) with the large fragment obtained in the step (5) to obtain a recombinant plasmid pCAMBIA1300-cas 9-gRNA. According to the sequencing results, the recombinant plasmid pCAMBIA1300-cas9-gRNA was structurally described as follows: a DNA molecule shown in a sequence 3 of a sequence table is inserted between BamHI enzyme cutting sites and KpnI enzyme cutting sites of a pCAMBIA1300-cas9 vector to express sgRNA.

The target sequence of the sgRNA is sequence 4.

II, obtaining mutant strains

And (2) introducing the recombinant plasmid pCAMBIA1300-cas9-gRNA into agrobacterium EHA105 to obtain recombinant agrobacterium, infecting embryonic callus of the No. 8 oryza sativa, and culturing to obtain a plant, namely a T0 generation plant.

Whole genome sequencing was performed on oryza sativa No. 8 plants as a recipient of genetic transformation and on all the T0 generation plants obtained. 3 plants mutated in the LEPTO1 gene and homozygous for the mutation were obtained from 25 plants of the T0 generation by whole genome sequencing. Compared with the rice No. 8 plant which is taken as a genetic transformation receptor, the genome of each of the 3 plants has only one nucleotide difference (namely, an insertion mutation is generated and is homozygotic, and the insertion is positioned between 86 and 87 positions of an open reading frame) (the 86 position of the open reading frame is also the 436 position of the sequence 1), the nucleotide difference causes frame shift, so that the LEPTO1 protein can not be effectively expressed, and the 3 plants are named as a LEPTO1-cas9 mutant strain.

The partial sequencing results of the oryza sativa No. 8 plant as a recipient of genetic transformation and the leptin 1-cas9 mutant are shown in fig. 4A.

Tissue culture is carried out on the leptin 1-cas9 mutant strain to obtain a plurality of expanded propagation strains with consistent genome.

Comparison of phenotypes

Multiple strains of the leptin 1-cas9 mutant strain are propagated until the strains are mature, and the strains show male sterile phenotype. The saline rice No. 8 plant is cultured until the plant is mature, and the plant shows a male fertile phenotype.

DAPI staining of anther resin sections was performed on pollen of multiple propagated strains of the leptin 1-cas9 mutant and the SALT Rice No. 8 strain.

As a result, as shown in FIG. 4B (scale, 100 μm), it was found that the chromosomal morphology of leptin 1-cas9 was similar to that of leptin 1, all the expanded strains of the leptin 1-cas9 mutant strain were not pollen-stained, all the pollen was abortion pollen, and the male sterility was 100%. The pollen of the No. 8 plant of the saline rice is normal.

The above results indicate that the mutation of the LEPTO1 gene is indeed responsible for the sterile phenotype of the mutant.

The result shows that the expression of the LEPTO1 gene (the specific implementation mode is CRISPR-Cas9 gene knockout technology) is the cause of male sterility phenotype, and the sterility degree of the pollen can reach 100 percent (namely the pollen is completely aborted).

Sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

<120> LEPTO1 and application of encoding protein thereof in rice fertility control

<160>4

<170>PatentIn version 3.5

<210>1

<211>2486

<212>DNA

<213> Artificial sequence

<400>1

ggaaaataaa ggcgaggagg gaaataaaaa aaaaaggttt ccacctttgc actgcatatg 60

aaattttttt tttctctttc actccaatcc attccattta cccaatccgc gatccatcca 120

tcatccccta cctctcgctc tctctctcct ctcctctcct cttattatca tcgcatccat 180

cccgcacttc tctctctttg gtggtggtgc tcgctctcgc tcaccctgct ttgacctttg 240

gatttttatt tttaaggatc caagaaagtg ctgtttcttg ggttgcttgg aggtggagga 300

gtttgggaga ttgtttgtgt ttgattgatt ggttgattga ttggaggaag atgacggtgg 360

aggagaggca ggggagggtg ggaggccatg gtgtgagcgg cggcggcggc gggagagacc 420

agttcccggt cggcatgcgg gtgctcgccg tcgacgacga ccccacctgc ctcaagatcc 480

tcgagaacct cctgcttcga tgccagtatc acgtgacaac aactggtcag gcggccacgg 540

ccctgaagct gctcagggag aacaaggacc agtttgacct ggtgatcagc gacgtccaca 600

tgccggacat ggatggcttc aaactccttg agcttgtcgg cctcgagatg gacctcccag 660

tcattatgtt gtctgcgaac ggggaaacac aaactgtcat gaagggtata acccatggtg 720

catgtgacta tcttctgaag ccagtgcgtc ttgagcagct aaggacgata tggcaacatg 780

tgattaggcg taagaattgt gatgctaaga accgtggtaa cgatgatgac gctggtcaga 840

aggcacaggg aatgaacaat gaaggtgaga gtattggtgc taaccgcaac aagaggcagt 900

cacggaaaag tagagatgag aatggagatg atggtgatga ttctgatgag aacagtaatg 960

agaatggaga ctcatcaaca cagaagaagc caagggtcgt gtggtctgtt gagctgcacc 1020

gaaagtttgt ggctgctgtt aaccagcttg gcatcgagaa ggctgttcca aagaaaatat 1080

tggatctcat gaatgtagag aacatcacca gggagaatgt tgctagtcat ttgcagaagt 1140

atcggctgta ccttaaacgg ttgagcactg atgcaagcag gcaggctaac cttgcagctg 1200

catttggagg aaggaaccct gcttacataa acatgaattc atttggaaac tacaacgcat 1260

atggtagata ccgtacagtc ccaactgctg gccataccca ggcaaacaac attcttacta 1320

ggatgaactc cccttctgcg tttggtgttc atggtttgct gcattcacag ccaattcagt 1380

taggacatgc ccaaaataat ctgagcactt cactgaatga tttaggaggg cttaataatg 1440

gtaacatgat cagaggtgca cagatgtcaa caattctaac tggtccttct ggtaactcct 1500

ttccaaacat atcgaatggt gcaccgctgg caactgcaaa cagatcactg caacctcttg 1560

agtcgagcaa tcagcaacac cttagtcggg tgcattcatc ttctgcagat ccatttagca 1620

cacttgttgg tgagtctccc cagtttcctg atcttggaag aaccaccaat acttggcaaa 1680

ctgcggttcc atccaacatt caggatcgtg gtcacaatga taacatgtcg caagccaccc 1740

tgcatatgaa tggccccaaa attgaacctg tctcaagctt cacatcatcc aatcagattc 1800

cgctgctggg aaatgagatg cagggccaag tagcatcact agctagcaat gttccaatag 1860

cattcaatca ggacacatca ccattcaact atggaagcag cacaaactca agagacatgc 1920

taaataacag ccatgtattt agtaactcca gcatcaacac atcgttgccc aaccttagct 1980

tagacaatcc ggctgtacca aggcagacac tggatcgtgg gaatacgggc attgtttctc 2040

ccatgcaaga tggaaggatt catcaccaag ctgttagcaa tcagctaaac tataatgacg 2100

atcttatgcg gacaactggg ctgcaaaggg gtctcagtgg tggtctagat gacattgttg 2160

ttgacatgtt taggccggac cgcgaagacg acggcgttcc ttacatcgat ggggactggg 2220

agctggtcta gccagcctcc atttcaatca ttagtccgcg tacgaggttt ttctgcattc 2280

gcggtgtcgg ctgctgattg gtccatgctc acttgtcagc acaaagtggt gttcatagtg 2340

gctagccttc atcacaagtg catttcacat ttggcttctt ttttcagctt agtgattatt 2400

agttggccag tcagtctgtg aaatttatgt ggagaaacgg ctatgtggtg tgtttttatc 2460

atgacttata ctataataac tatgtt 2486

<210>2

<211>626

<212>PRT

<213> Artificial sequence

<400>2

Met Thr Val Glu Glu Arg Gln Gly Arg Val Gly Gly His Gly Val Ser

1 5 10 15

Gly Gly Gly Gly Gly Arg Asp Gln Phe Pro Val Gly Met Arg Val Leu

20 25 30

Ala Val Asp Asp Asp Pro Thr Cys Leu Lys Ile Leu Glu Asn Leu Leu

35 40 45

Leu Arg Cys Gln Tyr His Val Thr Thr Thr Gly Gln Ala Ala Thr Ala

50 55 60

Leu Lys Leu Leu Arg Glu Asn Lys Asp Gln Phe Asp Leu Val Ile Ser

65 70 75 80

Asp Val His Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Leu Val

85 90 95

Gly Leu Glu Met Asp Leu Pro Val Ile Met Leu Ser Ala Asn Gly Glu

100 105 110

Thr Gln Thr Val Met Lys Gly Ile Thr His Gly Ala Cys Asp Tyr Leu

115 120 125

Leu Lys Pro Val Arg Leu Glu Gln Leu Arg Thr Ile Trp Gln His Val

130 135 140

Ile Arg Arg Lys Asn Cys Asp Ala Lys Asn Arg Gly Asn Asp Asp Asp

145 150 155 160

Ala Gly Gln Lys Ala Gln Gly Met Asn Asn Glu Gly Glu Ser Ile Gly

165 170 175

Ala Asn Arg Asn Lys Arg Gln Ser Arg Lys Ser Arg Asp Glu Asn Gly

180 185 190

Asp Asp Gly Asp Asp Ser Asp Glu Asn Ser Asn Glu Asn Gly Asp Ser

195 200 205

Ser Thr Gln Lys Lys Pro Arg Val Val Trp Ser Val Glu Leu His Arg

210 215 220

Lys Phe Val Ala Ala Val Asn Gln Leu Gly Ile Glu Lys Ala Val Pro

225 230 235 240

Lys Lys Ile Leu Asp Leu Met Asn Val Glu Asn Ile Thr Arg Glu Asn

245 250 255

Val Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Leu Ser

260 265 270

Thr Asp Ala Ser Arg Gln Ala Asn Leu Ala Ala Ala Phe Gly Gly Arg

275 280 285

Asn Pro Ala Tyr Ile Asn Met Asn Ser Phe Gly Asn Tyr Asn Ala Tyr

290 295 300

Gly Arg Tyr Arg Thr Val Pro Thr Ala Gly His Thr Gln Ala Asn Asn

305 310 315 320

Ile Leu Thr Arg Met Asn Ser Pro Ser Ala Phe Gly Val His Gly Leu

325 330 335

Leu His Ser Gln Pro Ile Gln Leu Gly His Ala Gln Asn Asn Leu Ser

340 345 350

Thr Ser Leu Asn Asp Leu Gly Gly Leu Asn Asn Gly Asn Met Ile Arg

355 360 365

Gly Ala Gln Met Ser Thr Ile Leu Thr Gly Pro Ser Gly Asn Ser Phe

370 375 380

Pro Asn Ile Ser Asn Gly Ala Pro Leu Ala Thr Ala Asn Arg Ser Leu

385 390 395 400

Gln Pro Leu Glu Ser Ser Asn Gln Gln His Leu Ser Arg Val His Ser

405 410 415

Ser Ser Ala Asp Pro Phe Ser Thr Leu Val Gly Glu Ser Pro Gln Phe

420 425 430

Pro Asp Leu Gly Arg Thr Thr Asn Thr Trp Gln Thr Ala Val Pro Ser

435 440 445

Asn Ile Gln Asp Arg Gly His Asn Asp Asn Met Ser Gln Ala Thr Leu

450 455 460

His Met Asn Gly Pro Lys Ile Glu Pro Val Ser Ser Phe Thr Ser Ser

465 470 475 480

Asn Gln Ile Pro Leu Leu Gly Asn Glu Met Gln Gly Gln Val Ala Ser

485 490 495

Leu Ala Ser Asn Val Pro Ile Ala Phe Asn Gln Asp Thr Ser Pro Phe

500 505 510

Asn Tyr Gly Ser Ser Thr Asn Ser Arg Asp Met Leu Asn Asn Ser His

515 520 525

Val Phe Ser Asn Ser Ser Ile Asn Thr Ser Leu Pro Asn Leu Ser Leu

530 535 540

Asp Asn Pro Ala Val Pro Arg Gln Thr Leu Asp Arg Gly Asn Thr Gly

545 550 555 560

Ile Val Ser Pro Met Gln Asp Gly Arg Ile His His Gln Ala Val Ser

565 570 575

Asn Gln Leu Asn Tyr Asn Asp Asp Leu Met Arg Thr Thr Gly Leu Gln

580 585 590

Arg Gly Leu Ser Gly Gly Leu Asp Asp Ile Val Val Asp Met Phe Arg

595 600 605

Pro Asp Arg Glu Asp Asp Gly Val Pro Tyr Ile Asp Gly Asp Trp Glu

610 615 620

Leu Val

625

<210>3

<211>530

<212>DNA

<213> Artificial sequence

<400>3

ggatccgtcg acgattaagg aatctttaaa catacgaaca gatcacttaa agttcttctg 60

aagcaactta aagttatcag gcatgcatgg atcttggagg aatcagatgt gcagtcaggg 120

accatagcac aagacaggcg tcttctactg gtgctaccag caaatgctgg aagccgggaa 180

cactgggtac gtcggaaacc acgtgatgtg aagaagtaag ataaactgta ggagaaaagc 240

atttcgtagt gggccatgaa gcctttcagg acatgtattg cagtatgggc cggcccatta 300

cgcaattgga cgacaacaaa gactagtatt agtaccacct cggctatcca catagatcaa 360

agctgattta aaagagttgt gcagatgatc cgtggcacca gttcccggtc ggcatgcgtt 420

ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaacttg aaaaagtggc 480

accgagtcgg tgcttttttt ccacataatc tctagaagat cttcggtacc 530

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

ccagttcccg gtcggcatgc 20

Claims

The application of the LEPTO1 protein or the encoding gene of the LEPTO1 protein in breeding male sterile plants;

the LEPTO1 protein is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table.
2. The use of a substance which inhibits the activity and/or content of LEPTO1 protein in the cultivation of male sterile plants;

or the application of the substance for inhibiting or reducing the expression of the LEPTO1 protein coding gene in the cultivation of male sterile plants;

the LEPTO1 protein is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

the substance is a CRISPR-Cas 9system, the CRISPR-Cas 9system expresses a Cas9 protein gene and a sgRNA gene, and a target sequence of the sgRNA is shown as a sequence 4 in a sequence table.
3. A method of breeding male sterile plants comprising the steps of: reducing or inhibiting the activity and/or content of LEPTO1 protein in a target plant to obtain a male sterile plant;

the LEPTO1 protein is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table.
4. A method of breeding male sterile plants comprising the steps of: inhibiting the expression of the LEPTO1 protein coding gene in the target plant to obtain a male sterile plant:

the LEPTO1 protein is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table.
5. The method of claim 4, wherein: the LEPTO1 protein coding gene is a DNA molecule of the following 1) or 2):

1) the coding region is shown as the DNA molecule at the 351-2231 site of the sequence 1 in the sequence table;

2) DNA molecule shown in sequence 1 in the sequence table.