CN113151295A

CN113151295A - Rice temperature-sensitive male sterile gene OsFMS1 and application thereof

Info

Publication number: CN113151295A
Application number: CN202110237714.4A
Authority: CN
Inventors: 汪得凯; 裘霖琳; 刘窍; 庞礴; 翟玉凤
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2021-03-04
Filing date: 2021-03-04
Publication date: 2021-07-23
Anticipated expiration: 2041-03-04
Also published as: CN113151295B

Abstract

The invention relates to the field of plant genetic engineering, in particular to a rice temperature-sensitive male sterile gene OsFMS1 and application thereof. Particularly, no pollen is formed under the condition of high temperature (about higher than 22 ℃); whereas, under the condition of low temperature (about less than 22 ℃), the pollen was all fertile, and the strain was named as fullmale-sterile (fms 1). The rice fertility gene OsFMS1 can cause the abortion of rice anthers after overexpression or induced specific expression, can be used for cultivating a new temperature-sensitive male sterile line, can be applied to the creation of a sterile line and the seed production of hybrid rice, and has important application value.

Description

Rice temperature-sensitive male sterile gene OsFMS1 and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a rice temperature-sensitive male sterile gene OsFMS1 and application thereof.

Background

Rice (Oryza sativa L.) is an important food crop, a staple food for half of the world's population, and also an important monocot model plant. The successful creation of the three-line method and the two-line method hybrid rice solves the problem of seed production and seed reproduction of the large-scale utilization of the heterosis of the plants, provides technical support for the large-scale popularization and application of the hybrid rice, and makes important contribution to the world grain safety. Compared with the three-line hybrid rice, the two-line hybrid rice has the advantages of wide restoring line, simpler seed production process and more important position in hybrid rice production. Successful popularization of two-line hybrid rice benefits from the effective utilization of photo-thermo-sensitive male nuclear sterility genes.

At present, several important photo-thermo-sensitive male sterile genes, such as P/TMS12(Zhou et al,2012) have been cloned in rice; PMS3(Ding et al 2012); CSA (Zhang et al, 2013); TMS2 (Chuesairii et al 2014); TMS5(Zhou et al 2014); TMS9-1(Qi et al 2014), PMS1(Zhou et al 2014; Fan et al 2016) and the like, but the genes cannot completely meet the practical requirements of breeding production, and new temperature-sensitive genic male sterile genes still need to be continuously discovered, the action mechanism of the genes needs to be deeply researched, the genes are beneficial to quickly creating excellent sterile lines, and hybrid seed production and breeding of rice are promoted, so that the yield of the rice is improved.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The present disclosure encompasses the following embodiments:

an isolated nucleic acid having a nucleotide sequence set forth in SEQ ID NO: 1 is shown.

The resulting isolated protein is expressed from the nucleic acid as described above.

A recombinant DNA construct comprising a nucleic acid as described above operably linked to at least one heterologous regulatory sequence.

A host cell comprising a nucleic acid as described above, or a protein as described above, or transformed with a recombinant DNA construct as described above.

A method for producing transgenic rice comprising introducing into a plant of the genus oryza a recombinant DNA construct as described above;

wherein expression of said nucleic acid in rice constitutes temperature sensitive male sterility.

Use of a transgenic oryza plant produced by a method as described above for the production of oryza sativa propagation material, wherein the propagation material is suitable for sexual reproduction, vegetal reproduction or tissue culture of regenerable cells.

The invention discovers a male sterile mutant in a T-DNA insertion mutant library of a flower 11(ZH11) in a rice variety, which can not generate mature pollen grains, belongs to pollen-free male sterility, has fertility regulated by temperature, and is specifically characterized in that no pollen is formed under the condition of high temperature (about higher than 22 ℃); while the pollen was fully fertile at low temperatures (about less than 22 ℃), the strain was named full male-stable (fms 1). The rice fertility gene OsFMS1 can cause the abortion of rice anthers after overexpression or induced specific expression, can be used for cultivating a new temperature-sensitive male sterile line, can be applied to the creation of a sterile line and the seed production of hybrid rice, and has important application value.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic diagram showing pollen fertility under high temperature conditions of the ZH11 and Osfms1 mutants in example 1; panel A Wild Type (WT), hybrid (WT/osfms1) and homozygous mutant (osfms1/osfms 1); b is the young ear of Wild Type (WT), heterozygote (WT/osfms1) and homozygous mutant (osfms1/osfms 1); C. d is flowers of wild type and homozygous mutants; E. f is pollen I2/KI staining of wild type and homozygous mutant.

FIG. 2 is a photo-thermal characterization of osfms1 in example 2; middle flower 11(ZH11 as wild type control), 10h and 14h are 10h and 14h light, respectively; pollen I₂KI staining.

FIG. 3 is a graph showing the gene mapping and cloning results of the thermo-sensitive male sterile gene OsFMS1 in example 3; a is OsFMS1 gene location; b is T-DNA insertion coseparation analysis, wherein A1-A5 is wild type, B1-B14 is heterozygote, and C1-C9 is homozygous mutant; c is a schematic diagram of a T-DNA insertion site; d is the expression of the upstream and downstream genes of the T-DNA insertion site identified by semi-quantitative PCR; e is qPCR to identify the expression of the genes upstream and downstream of the T-DNA insertion site.

FIG. 4 shows overexpression of OsFMS1 gene in one example; wherein, A is OsFMS1 transgenic overexpression plant; b is a floret of an OsFMS1 transgenic overexpression plant; c is OsFMS1 transgenic overexpression plant pollen I₂KI staining.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

Noun definitions

Before setting forth the details of the invention, it should be understood that several terms used in the specification are used.

The "Oryza" or "rice" is a genus of the poaceae family (Oryza), which preferably includes o.sativa species, further including indica o.s. indica, japonica o.s.japonica or tropical japonica o.s.japonica subspecies.

"agronomically elite," as used herein, refers to a genotype that has a preferred or optimal performance of a number of discernible traits that allow a producer to harvest a product of commercial importance. Including but not limited to seed yield, germination vigour, vegetative vigour, disease resistance, greenness, growth rate, total biomass or cumulative rate, fresh weight at maturity, dry weight at maturity, fruit yield, grain yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear length, salt tolerance, number of tillers, panicle size, early seedling vigour, and emergence under low temperature stress, among others.

"phenotype" means a detectable characteristic of a cell or organism.

The mating of two parental plants is "crossed".

"nucleic acid," "polynucleotide," "nucleic acid sequence," "nucleotide sequence," and "nucleic acid fragment" are used interchangeably and refer to a polymer of RNA and/or DNA that is either single-or double-stranded, optionally containing synthetic, non-natural, or altered nucleotide bases. Nucleotides (usually present in their 5' -monophosphate form) are referred to by the following one-letter code: "a" represents an adenylic acid or a deoxyadenylic acid, "C" represents a cytidylic acid or a deoxycytidylic acid, and "G" represents a guanylic acid or a deoxyguanylic acid, corresponding to RNA or DNA, respectively; "U" means uridylic acid; "T" represents deoxythymidylate; "R" represents purine (A or G); "Y" represents a pyrimidine (C or T); "K" represents G or T; "H" represents A or C or T; "I" means inosine; and "N" represents any nucleotide.

By "isolated" is meant a substance, such as a nucleic acid molecule and/or protein, that is substantially free of, or is otherwise removed from, components with which it normally accompanies or interacts in a naturally occurring environment. Isolated polynucleotides may be purified from the host cell in which they naturally occur. Conventional nucleic acid purification methods known to the skilled artisan can be used to obtain the isolated polynucleotide. The term also encompasses recombinant polynucleotides and chemically synthesized polynucleotides.

"polypeptide," "peptide," "amino acid sequence," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modifications including, but not limited to: glycosylation, lipid attachment and sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

"recombinant" refers to the artificial combination of two otherwise isolated sequence segments, for example, by chemical synthesis or by manipulating the isolated nucleic acid segments using genetic engineering techniques. "recombinant" also includes reference to a cell or vector that has been modified by the introduction of a heterologous nucleic acid, or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those that occur without deliberate human intervention.

"recombinant DNA construct" refers to a combination of nucleic acid fragments that do not normally occur together in nature. Thus, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. In some embodiments, the recombinant DNA construct is a plasmid or a virus. In some embodiments, regulatory elements commonly used in genetic engineering, such as enhancers, promoters, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.) are included in the recombinant DNA constructs of the present invention.

The present invention relates to an isolated nucleic acid having a nucleotide sequence as set forth in SEQ ID NO: 1 is shown.

The nucleic acid fragment gene claimed by the invention also comprises a nucleotide sequence SEQ ID NO: 1 and has the same highly homologous equivalent sequence for regulating the temperature sensitive male sterility function.

The highly homologous functionally equivalent sequences include sequences capable of hybridizing under stringent conditions to sequences having the sequence of SEQ ID NO: 1, or a DNA sequence which hybridizes to the DNA of the sequence shown in 1. "stringent conditions" used in the present invention are known, and include, for example, hybridization at 60 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH6.4) and 1mM EDTA, followed by washing with a washing solution containing 0.1% SDS and 0.1% SSC at 65 ℃ for 15 to 60 minutes.

Functional equivalent sequences also include sequences corresponding to SEQ ID NO: 1 has at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity, and has the same gene sequence for regulating and controlling temperature sensitive male sterility, and can be separated from any plant. The percentage of sequence identity can be obtained by well-known Bioinformatics algorithms, including the Myers and Miller algorithms (Bioinformatics, 4 (1): 11-17, 1988), Needleman-Wunsch global alignment (J.mol.biol., 48 (3): 443-53, 1970), Smith-Waterman local alignment (J.mol.biol., 147: 195-197, 1981), Pearson and Lipman similarity search (PNAS, 85 (8): 2444: (2448, 1988), Karlin and Altschul algorithms (Altschul et al, J.mol.biol., 215 (3): 403: 410, 1990; PNAS, 90: 5873-5877, 1993). This is familiar to the person skilled in the art.

The nucleic acid can regulate and control the temperature-sensitive male sterility function of rice, and particularly, no pollen is formed under the condition of high temperature (about higher than 22 ℃); whereas at low temperatures (less than about 22 ℃), the pollen is fully fertile. The rice fertility gene OsFMS1 can cause the abortion of rice anthers after overexpression or induced specific expression, can be used for cultivating a new temperature-sensitive male sterile line, can be applied to the creation of a sterile line and the seed production of hybrid rice, and has important application value.

The invention also relates to an isolated protein expressed from the nucleic acid as described above.

The present invention also relates to a recombinant DNA construct comprising a nucleic acid as described above operably linked to at least one heterologous regulatory sequence.

The invention also relates to a host cell containing a nucleic acid as described above, or a protein as described above, or transformed with a recombinant DNA construct as described above.

The nucleic acid fragments provided by the present invention may be inserted into plasmids, cosmids, yeast artificial chromosomes, bacterial artificial chromosomes or any other vector suitable for transformation into a host cell. Preferred host cells are bacterial cells, in particular for cloning or storing polynucleotides, or for transforming plant cells, such as E.coli, Agrobacterium tumefaciens and Agrobacterium rhizogenes.

The present invention also relates to a method for producing transgenic rice comprising introducing into a plant of the genus oryza a recombinant DNA construct as described above;

In some embodiments, the recombinant DNA construct is introduced into rice by a host cell as described above.

The methods of the invention may also be used to directly introduce the nucleic acids into plants to produce transgenic rice, using transformation methods known to those skilled in the art of plant biotechnology. Any method can be used to transform the recombinant expression vector into a plant cell to produce a transgenic plant of the invention. The transformation methods may include direct and indirect transformation methods. Suitable direct methods include liposome-mediated transformation, introduction using a gene gun, electroporation, and the pollen tube channel method, among others.

In some embodiments, the recombinant DNA construct is introduced into rice by means of hybridization.

In some embodiments, the method comprises:

1) determining whether the first rice plant has the amino acid sequence of SEQ ID NO: 1;

2) optionally verifying a temperature sensitive male sterile phenotype of the first oryza plant;

3) crossing the first rice plant with a second rice plant to produce a progeny plant;

4) optionally repeating steps 1) -3)2-10 times using the progeny plant described in step 3) as a starting material to produce further progeny plants.

In some embodiments, the second rice plant is an agronomically elite variety.

The invention also relates to the use of transgenic plants of the genus oryza produced by the method as described above for the production of oryza sativa propagation material, wherein the propagation material is suitable for sexual propagation, vegetal propagation or tissue culture of regenerable cells;

in some embodiments, the propagation material suitable for sexual propagation is selected from the group consisting of microspores, pollen, ovaries, ovules, embryo sacs and egg cells.

In some embodiments, the propagation material suitable for vegetative propagation is selected from cuttings, roots, stems, cells, protoplasts.

In some embodiments, the propagation material suitable for tissue culture of regenerable cells is selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, anthers, flowers, seeds and stems.

Embodiments of the present invention will be described in detail with reference to examples.

The rice variety used in the examples had flower 11 as a standard variety.

Example 1 phenotypic identification and genetic typing of fms1 mutants

The OsFMS1 mutant was found in the T1 generation of the middle flower 11T-DNA insertion mutant pool. Homozygous mutants appeared as half-dwarf, dark green leaves, half-coated panicle necks (FIG. 1A, B), and no fertile seeds at maturity. The hybrid plant setting rate is 31.1 +/-8.4%, and is obviously reduced (85.4 +/-7.2%) compared with the wild type. The florets were observed under a dissecting mirror, the mutant florets had normal development, the number and structure of floral organs were normal, but the filaments were slender, and the anthers shriveled and whitened (FIG. 1C, D). The pre-anthesis florets were stained with 1% I2/KI and the mutant anthers were found to have no mature pollen grains (FIG. 1E, F).

In the T1 generation strain, wild type: half-sterile: complete sterile plants are 5: 14: 9, in accordance with 1: 2: 1 (X)² _c＝0.43<χ² _0.053.84). Harvesting plants showing wild type and semi-sterile plants, planting T2 generation, and no separation of the wild type; the separation of wild type, semi-sterile and complete sterile can occur to the semi-sterile plant, and the separation ratio is in accordance with 1: 2: 1 in a separated relation.

TABLE 1 plant segregation

The homozygous mutants are used as parents to be crossed with the flowers 11 in the original parents. When the homozygous mutant is used as a male parent, no seeds are formed; when the homozygous mutant is used as a female parent, seeds can be normally obtained, F1 shows half sterility, F2 generation wild type: half-sterile: complete sterile plants 15: 32: 12, in accordance with 1: 2: 1 (X)² _c＝0.46<χ² _0.053.84).

Combining the phenotype and genetic analysis results, the OsFMS1 mutant is determined to be pollen-free male sterile and controlled by a pair of incomplete dominant nuclear genes.

Example 2 light temperature characterization of fms1 mutant

Under the condition of high temperature in Hangzhou summer (about 8 months and 10 days for ear emergence and long day high temperature), the fms1 mutant shows no pollen male sterility and no mature seed generation, the mature ear part is subtracted before and after 10 months and 1 days (low temperature and short day), the newly extracted young ear can be normally fruited, the rice stump of the OsFMS1 homozygous plant and the harvested seed are sent to Hainan for planting, the fertility of the OsFMS1 mutant of the ear emergence is recovered to be normal after 3 months and 10 days (short day and low temperature), and the normal fruition can be realized, so that the possibility of light receiving period or temperature control of the mutant is prompted. Set up 4 temperature and illumination combinations with the illumination incubator, the cultivation condition is respectively: and (3) high-temperature long-day: illumination is carried out at 28 ℃ for +14 h; high temperature short day illumination at 28 deg.C +10 h; low temperature and long day at 22 deg.C +14 h; the low temperature is 22 ℃ in day +10h for illumination. Investigating plant spikelet pollen fertility: ZH11 pollen was normally fertile in all treatments, whereas OsFMS1 showed normal pollen fertility only at low temperature of 22 ℃ and a pollenless phenotype at high temperature (figure 2). The pollen fertility of the OsFMS1 mutant is mainly regulated and controlled by temperature, and the OsFMS1 is a temperature-sensitive genic male sterile mutant.

Example 3 mapping and cloning of OsFMS1 Gene

And (3) preparing a positioning population by using the OsFMS1 mutant as a female parent and using the indica rice variety Longtefu B as a male parent, and taking an individual with an extremely recessive phenotype as the positioning population for gene positioning. 192 pairs of SSR primers with polymorphism covering 12 rice chromosomes are used for carrying out primary positioning on mutant genes, the mutant genes are positioned on the 4 th chromosome, and then the candidate genes are further positioned in the range with the physical distance of 103kb by using the SSR primers and newly designed STS markers (figure 3A).

The SSR primers and the STS primers are as follows:

name of label	F(5’-3’)	R(5’-3’)
			RM3288	CAATCTGGAGGCACTGTCACG	AGTGACAAGATGAAGCCAACAGC
RM6089	CGATGGCCAGCGTGATCTCC	CCACCGAATCGAATAACCACAAGC
			RM3474	ACCTCACCTTTCCCTCGATTGG	GTTGGTTGCTTCCTCCCATACG
RM3276	ACAGGTCGATCTCGATGAACTCC	CTCTTCTCCGTCTCGACTCTTCC
			RM3836	CGGAATCACCAATTTCTCTCTCAGC	CGCAAGAAACGGAAACGAAACC
4-1	AGTGCTGTCAGAGAGAAAGCAATCC	GGAGCCATCGAGTGTCATCACC
			4-4	ACTTTGCTCTGAACTTGCAGTGG	GCTAGCTGCTATCAGGATTCACG
4-11	TTGGAAGCCAACTCAAGTTACCC	GAAGCAGGGATGTGAGAGATGG
			4-15	AGACCATAATGCCACAATCC	TTGATTTGTGCTCTTCCCAG
4-18	CAGAAGAACAAACTCCACAG	AAATCGATCCTCTGCAGTGC

Also, to determine whether the mutant phenotype cosegregated with T-DNA, i.e., whether the mutant was an insertion mutation. All individuals of T1 generation are selected, and PCR amplification is carried out by using HPT gene in T-DNA, and it is found that both heterozygote and homozygous mutant can amplify target bands, while wild type has no amplification product. In the T2 generation, all strains expressing wild type had no amplification product, and in the strains which continued to segregate, the wild type had no amplification product, and both heterozygote and homozygous mutant could amplify the target band (FIG. 3B). Indicating that the T-DNA cosegregated with the mutant phenotype, the mutant was most likely caused by T-DNA insertion.

The flanking sequences of the T-DNA insertion site were isolated by TAIL-PCR technique, and after sequencing, the insertion of T-DNA into the above-mentioned finely positioned 103kb interval, between two genes which are identical in orientation, was found by analysis of the Rice genome annotation databases TIGR (http:// rice. plant biology. msu.edu /) and RiceGAAS (http:// RiceGAAS. DNA. affrc. go. jp/rgadb /) (FIG. 3C)

And combining the results of gene positioning, and respectively selecting 2 genes on the upstream and downstream of the T-DNA insertion site to perform expression quantity analysis. Selecting young ear cDNA from III stage to V stage of development to make semi-quantitative PCR. Analysis of the experimental results revealed that the expression level of ORF1 gene (LOC _ Os04g50030) located downstream of the T-DNA insertion site was significantly increased, while the expression levels of the other 3 candidate genes were not significantly different (FIG. 3D). The change in the expression level of OsFMS1 gene at each stage was further examined by qRT-PCR, and it was found that the expression level of OsFMS1 gene was significantly increased at each stage (FIG. 3E). ORF1 gene (LOC _ Os04g50030) was shown to be a candidate gene for OsFMS 1. Sequencing analysis of amplified full-length ORF products, and database comparison analysis shows that the OsFMS1 gene has no intron and encodes an AT-HOOK transcription factor, and no report on gene cloning and function research exists AT present.

The primer sequences used in the RT-PCR are as follows:

example 4 overexpression of the OsFMS1 Gene

Constructing an OsFMS1 gene overexpression vector driven by a UBI promoter to transform a wild type middle flower 11 plant, wherein amplification primers are as follows: OsFMS1-BamHI (5'-TGCTGGATCCGTACATGAGCTAGTGGAG-3'); OsFMS1-KpnI (3 '-CCAGGTACCCTTGCGATGTCTCCTTTC-5'), and the amplification primer contains BamHI and KpnI enzyme cutting sites for connecting to pCAMBIA1301-Ubi/Nos vector. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 7 min; 94 ℃/1min, 60 ℃/30s, 72 ℃/3min, 35 cycles; extension at 72 ℃ for 7 min. The PCR reaction system is as follows:

and identifying and recovering the amplified product, carrying out double enzyme digestion by using BamHI and KpnI, connecting the product to a pCAMBIA1301-Ubi/Nos vector which is also subjected to double enzyme digestion by using BamHI and KpnI to construct a pCAMBIA1301-Ubi-OsFMS1 vector, and transforming the wild type plant of the Zhonghua 11 by using an agrobacterium-mediated method. And identifying the obtained transgenic seedling.

Transformed plants were normally fertile under low temperature conditions, high temperature conditions, transformed plants showed a phenotype similar to OsFMS1 (FIG. 4A), anther characteristics and pollen fertility were also similar to that of OsFMS1 (FIG. 4B), and pre-anthesis florets were stained with 1% I2/KI and no mature pollen grains were formed in the anthers of the over-expressed plants (FIG. 4C). Therefore, LOC _ Os04g50030 is determined to be OsFMS1 gene.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> Zhejiang university of science and engineering

<120> paddy rice thermo-sensitive male sterility gene OsFMS1 and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 978

<212> DNA

<213> Oryza sativa

<400> 1

atggcaggtc tcgacctcgg caccgccgcg acgcgctacg tccaccagct ccaccacctc 60

caccccgacc tccagctgca gcacagctac gccaagcagc acgagccgtc cgacgacgac 120

cccaacggca gcggcggcgg cggcaacagc aacggcgggc cgtacgggga ccatgacggc 180

gggtcctcgt cgtcaggtcc tgccaccgac ggcgcggtcg gcgggcccgg cgacgtggtg 240

gcgcgccggc cgcgggggcg cccgcctggc tccaagaaca agccgaagcc gccggtgatc 300

gcgcgccggc cgcgggggcg cccgcctggc tccaagaaca agccgaagcc gccggtgatc 360

atcacgcggg agagcgccaa cacgctgcgc gcccacatcc tggaggtcgg gagcggctgc 420

gacgtgttcg agtgcgtctc cacgtacgcg cgccggcggc agcgcggcgt gtgcgtgctg 480

agcggcagcg gcgtggtcac caacgtgacg ctgcgtcagc cgtcggcgcc cgcgggcgcc 540

gtcgtgtcgc tgcacgggag gttcgagatc ctgtcgctct cgggctcctt cctcccgccg 600

ccggctcccc ccggcgccac cagcctcacc atcttcctcg ccgggggcca gggacaggtc 660

gtcggcggca acgtcgtcgg cgcgctctac gccgcgggcc cggtcatcgt catcgcggcg 720

tccttcgcca acgtcgccta cgagcgcctc ccactggagg aggaggaggc gccgccgccg 780

caggccggcc tgcagatgca gcagcccggc ggcggcgccg atgctggtgg catgggtggc 840

gcgttcccgc cggacccgtc tgccgccggc ctcccgttct tcaacctgcc gctcaacaac 900

atgcccggtg gcggcggctc acagctccct cccggcgccg acggccatgg ctgggccggc 960

gcacggccac cgttctga 978

<210> 2

<211> 305

<212> PRT

<213> Oryza sativa

<400> 2

Met Ala Gly Leu Asp Leu Gly Thr Ala Ala Thr Arg Tyr Val His Gln

1 5 10 15

Leu His His Leu His Pro Asp Leu Gln Leu Gln His Ser Tyr Ala Lys

20 25 30

Gln His Glu Pro Ser Asp Asp Asp Pro Asn Gly Ser Gly Gly Gly Gly

35 40 45

Asn Ser Asn Gly Gly Pro Tyr Gly Asp His Asp Gly Gly Ser Ser Ser

50 55 60

Ser Gly Pro Ala Thr Asp Gly Ala Val Gly Gly Pro Gly Asp Val Val

65 70 75 80

Ala Arg Arg Pro Arg Gly Arg Pro Pro Gly Ser Lys Asn Lys Pro Lys

85 90 95

Pro Pro Val Ile Ile Thr Arg Glu Ser Ala Asn Thr Leu Arg Ala His

100 105 110

Ile Leu Glu Val Gly Ser Gly Cys Asp Val Phe Glu Cys Val Ser Thr

115 120 125

Tyr Ala Arg Arg Arg Gln Arg Gly Val Cys Val Leu Ser Gly Ser Gly

130 135 140

Val Val Thr Asn Val Thr Leu Arg Gln Pro Ser Ala Pro Ala Gly Ala

145 150 155 160

Val Val Ser Leu His Gly Arg Phe Glu Ile Leu Ser Leu Ser Gly Ser

165 170 175

Phe Leu Pro Pro Pro Ala Pro Pro Gly Ala Thr Ser Leu Thr Ile Phe

180 185 190

Leu Ala Gly Gly Gln Gly Gln Val Val Gly Gly Asn Val Val Gly Ala

195 200 205

Leu Tyr Ala Ala Gly Pro Val Ile Val Ile Ala Ala Ser Phe Ala Asn

210 215 220

Val Ala Tyr Glu Arg Leu Pro Leu Glu Glu Glu Glu Ala Pro Pro Pro

225 230 235 240

Gln Ala Gly Leu Gln Met Gln Gln Pro Gly Gly Gly Ala Asp Ala Gly

245 250 255

Gly Met Gly Gly Ala Phe Pro Pro Asp Pro Ser Ala Ala Gly Leu Pro

260 265 270

Phe Phe Asn Leu Pro Leu Asn Asn Met Pro Gly Gly Gly Gly Ser Gln

275 280 285

Leu Pro Pro Gly Ala Asp Gly His Gly Trp Ala Gly Ala Arg Pro Pro

290 295 300

Phe

305

Claims

1. An isolated nucleic acid having a nucleotide sequence set forth in SEQ ID NO: 1 is shown.

2. An isolated protein expressed from the nucleic acid of claim 1.

3. A recombinant DNA construct comprising the nucleic acid of claim 1 operably linked to at least one heterologous regulatory sequence.

4. A host cell comprising the nucleic acid of claim 1, or the protein of claim 2, or transformed with the recombinant DNA construct of claim 3.

5. The host cell of claim 4, which is Agrobacterium.

6. A method of producing transgenic rice comprising introducing into a plant of the genus oryza the recombinant DNA construct of claim 3;

7. The method according to claim 6, wherein said recombinant DNA construct is introduced into Oryza sativa by the host cell of claim 4 or 5.

8. The method according to claim 6, wherein the recombinant DNA construct is introduced into rice by a particle gun-mediated transformation method, a pollen tube channel method or a liposome transformation method.

9. The method according to claim 6, wherein said recombinant DNA construct is introduced into rice by means of hybridization;

preferably comprising:

4) repeating steps 1) -3)2-10 times, optionally using the progeny plant described in step 3) as a starting material, to produce further progeny plants;

preferably, the second rice plant is an agronomically elite variety.

10. Use of a transgenic rice plant produced by the method of any one of claims 6 to 9 for producing rice propagation material, wherein the propagation material is suitable for sexual reproduction, vegetative reproduction or tissue culture of regenerable cells;

optionally, said propagation material suitable for sexual propagation is selected from the group consisting of microspores, pollen, ovaries, ovules, embryo sacs and egg cells;

optionally, said propagation material suitable for vegetative propagation is selected from cuttings, roots, stems, cells, protoplasts;

optionally, the propagation material suitable for tissue culture of regenerable cells is selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, anthers, flowers, seeds and stems.