CN109897858A - A method of male sterible series of rice is obtained using fertile gene S44 - Google Patents

Abstract

Fertile gene is utilized the invention discloses a kind ofS44The method for obtaining male sterible series of rice, belongs to field of biotechnology.Specifically, the present invention obtains the malesterile mutants controlled by single recessive nuclear gene by EMS mutagenesis rice, and utilizes Mutmap method positional mutation trait related gene, obtains rice fertility controlling geneS44。S44The mutation of gene can lead to rice and generate male sterility phenotype, the controllable plant fertility of expression by adjusting the gene, to obtain male sterility line of plants and regulate and control the method for plant fertility, it is of great significance for the anther development mechanism and paddy rice cross breeding breeding work of studying plant.

Description

A method of male sterible series of rice is obtained using fertile gene S44

Technical field

The invention belongs to field of biotechnology, and in particular to plant hybridization breeding method, including sterile line propagation and hybridization Seed preparation, relates more specifically to a fertile gene S44 and its mutant and its application in crossbreeding.

Technical background

Crossbreeding is to improve the important method of crop yield and its quality, and cenospecies usually has than conventional kind obvious Yield, resistance and adapt to sexual clorminance, the breeding of cenospecies generally also than the conventional kind breeding period be short, quick.Hybridization at present Breeding has become the main breeding method of many crops.

The breeding of crop male sterile line is the key link of crossbreeding.Male sterile line be male gametophyte development defect, The normotrophic plant individual of oogamete receives the pollen from male parent as female parent.The breeding of male sterile line needs to consider Several factors: 1, hybridize combo: sterile line combines the filial generation for generating and having merit with corresponding paternal plant；2, no Educate the breeding for being: sterile line, which can restore under certain condition fertility, makes it be maintained；3, sterile line self-reproduction and hybridization Seed production efficiency: good sterile line must be susceptible to breed, and hybrid seed production yields are high.Male currently used for paddy rice cross breeding breeding Sterile line includes cytoplasmic male sterile line and cell line with genic sterile.Cytoplasmic male sterility crossbreeding system is related to male sterility System, restorer and holding system, i.e., it is so-called " three line method ".Triple crossing method needs specific restorer and keeps system, not only Production of hybrid seeds process is complicated, also greatly limits utilization of the hybrid vigour to different cultivars resource." two systems corresponding with " three line method " The characteristics of method " restores fertility using the sterile line and the sterile line of karyogene control under particular growth environmental condition, makes to restore System and holding system are combined into one.Compared with " three line method ", " two line method " has apparent advantage, both eliminates holding system and simplifies The production routine of hybrid seed, and the range of choice of male parent is greatly expanded, various merits can be combined to hybridization In offspring.

Double-hybrid rice strains is basic material cultivation using photo-thermo-sensitive genetic male sterile line rice.Hybridize water with two line method Rice breeding technique, China successively realize Super rice breeding plan first phase per mu yield respectively at, in 2000 in 2004 in 2012 700 kilograms, the breeding objective of 800 kilograms of second phase per mu yield, 900 kilograms of third phase per mu yield, realize super hybridized rice Super-high-yielding, Of fine quality, resistance the combination of rice, currently power-assisted impacts 1000 kilograms of fourth phase per mu yield of breeding objective.Double-line hybrid Rice, rice quality is excellent, has richer nutrition, rice faint scent is palatable, and nutritive value is higher.Infertility for double-line hybrid The key characteristic of system is: sterile line keeps sterility under certain conditions, can be used for hybrid seeding；And infertility when condition change System can restore fertility self-reproduction, achieve the purpose that keep the sterile line.On January 10th, 2014,2013 annual national science skills Art reward conference is held in Beijing Great Hall of the People, and " the double-hybrid rice strains technical research and application " that Yuan Longping leads obtain state Family's progress prize in science and technology special award.

The successful application of double-line hybrid technology in rice is made to improve yield, improving quality, increase resistance and adaptability Gone out significant contribution, in plant breeding have important application value, but at present " double-line hybrid method " there are still problems: light temperature The fertility of quick material is influenced vulnerable to outside environmental elements, and low temperature can induce sterile line self-fertility that hybrid seed purity is caused not reach Mark, and most photoperiod-temperature sensitive genic male sterilities system self-fruitful rate is low, reproductive output is unstable.Therefore, how at " three line method " and On the basis of " two line method ", develop, hybrid seeding high to resource utilization safely, be easier to cultivate high yield, be high-quality, resist more it is miscellaneous The new technology of rice is handed over to have become an urgent demand of hybrid rice development.Also, male sterility is the technology of crossbreeding process Core, but the molecular mechanism of most genes relevant to Rice Anther and microspore development and the regulated and control network of complexity are still unclear Chu, from the mechanism of the multi-level common research anther development such as science of heredity, cytology, molecular biology and Physiology and biochemistry, favorably This process is comprehensively understood in more detailed, promotes application of the paddy rice cross breeding technology in breeding work.

The present invention obtains one by single recessive nuclear gene control by EMS mutagenesis rice rice variety " Huang Huazhan ", screening The malesterile mutants of system are identified by carrying out phenotypic evaluation, genetic analysis and genetic background to it, and utilize the side Mutmap Method, high-resolution melting curve analysis (High-Resolution Melting Curve Analysis, HRM) technology and gene Sequence analysis successfully positions and has cloned a fertility adjusting gene S44, and the mutation of the gene can lead to rice and generate male not Phenotype is educated, the controllable plant fertility of the expression by adjusting the gene, to obtain male sterility line of plants and regulation plant The method of fertility.The present invention for study plant anther development mechanism and paddy rice cross breeding breeding work have great importance and Application value.And since this gene can cause the deformation of interior lemma, it is more convenient to distinguish kind used in hybrid seed and self-reproduction Son increases another road insurance for the seed separation in later period.

Summary of the invention

All bibliography being mentioned herein all are incorporated herein by reference.

Unless there are indicating on the contrary, all technical and scientific terms used herein all have common with fields of the present invention The identical meaning that technical staff is generally understood.Unless there are indicating on the contrary, technology that is used herein or mentioning is ability Standard technique well known to the those of ordinary skill of domain.Material, method and example are only used as to illustrate, rather than limit.

The present invention provides a fertility to adjust gene S44, and the point mutation of the gene can influence it to male plant The regulation of allelotaxis, nucleotide sequence are selected from following group of one of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80% (preferably at least 85%) sequence similarity with (a)-(c) sequence, and there is fertility tune Control the DNA sequence dna of function；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

Those skilled in the art should know that it further includes the nucleosides with S44 gene that fertility of the present invention, which adjusts gene, Acid sequence or protein sequence very high homology, and there is the function equivalence body of the very high homology of same regulation plant fertility function Sequence.The function equivalence body sequence of the very high homology be included under high stringency conditions can with SEQ ID NO:1,2,4,5, 20, the DNA sequence dna of the DNA hybridization of sequence shown in 21,23 or 24 or its coding amino acid sequence and SEQ ID NO:3,6, Protein amino acid sequence shown in 22 or 25 has the nucleotide sequence of 85% or more similitude." rigorous item used herein Part " be it is well known, including such as hybridizing in the hybridization solution of NaCl containing 400mM, 40mM PIPES (pH6.4) and 1mM EDTA, The temperature of the hybridization is preferably 53 DEG C -60 DEG C, and hybridization time is preferably 12-16 hours, then with containing 0.5 × SSC and The cleaning solution of 0.1%SDS washs, and wash temperature is preferably 62 DEG C -68 DEG C, and wash time is 15-60 minutes.

Function equivalence body sequence further include have at least 80% with sequence shown in S44 gene disclosed in this invention, 85%, 90%, 95%, 98% or 99% sequence similarity, and there is the DNA sequence dna of regulation plant fertility function, it can be from any plant It separates and obtains in object.Wherein, the percentage of sequence similarity can be obtained by well known bioinformatics, including Myers and Miller algorithm, Needleman-Wunsch overall comparison method, Smith-Waterman Local Alignment method, Pearson With the algorithm of Lipman similarity-searching, Karlin and Altschul, this is well known to the skilled artisan.

Gene order of the present invention can be separated from any plant and be obtained, including but not limited to Btassica, corn, Wheat, sorghum, two section shepherd's purse categories, sinapsis alba, castor bean, sesame, cottonseed, linseed, soybean, Arabidopsis, Phaseolus, peanut, lucerne Mu, oat, rapeseed, barley, oat, rye (Rye), grain, chinese sorghum, triticale, einkorn, Si Peierte wheat (Spelt), emmer, flax, gramagrass (Gramma grass), friction standing grain, false chinese sorghum, fescue grass, perennial ryegrass, sweet Sugarcane, crowberry, papaya, banana, safflower, oil palm, muskmelon, apple, cucumber, dendrobium nobile, gladiolus, chrysanthemum, Liliaceae, cotton, Eucalyptus, sunflower, rape, beet, coffee, ornamental plant and conifer etc..Preferably, plant include corn and soybean, safflower, leaf mustard, Wheat, barley, rye, rice, cotton and sorghum.Specifically, genomic dna sequence of the fertile gene s44 in long-grained nonglutinous rice Huang Hua Zhanzhong As shown in SEQ ID NO:1, code area DNA sequence dna is as shown in SEQ ID NO:2, and amino acid sequence is as shown in SEQ ID NO:3； In the genomic dna sequence in japonica rice OryzasativaLcv.Nipponbare as shown in SEQ ID NO:4, code area DNA sequence dna such as SEQ ID NO:5 institute Show, amino acid sequence is as shown in SEQ ID NO:6.

The present invention also provides a kind of expression cassette, the expression cassette contains fertility disclosed in this invention and adjusts gene S44 DNA sequence dna, the nucleotide sequence that the fertility adjusts gene is selected from following group of one of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80% (preferably at least 85%) sequence similarity with (a)-(c) sequence, and have fertility extensive The DNA sequence dna of multiple function；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

Specifically, the sterility changing gene also operability in above-mentioned expression cassette be connected with one can drive its express open Mover, the promoter include but is not limited to composition type expression promoter, inducible promoter, organizing specific expression promoter, Space-time specific expression promoter etc..The gene expression of constitutive promoter of the present invention does not have tissue and the time is special Property, the exogenous gene expression that extraneous factor starts constitutive promoter has little effect.The constitutive promoter includes But it is not limited to CaMV35S, FMV35S, rice actin (Actin1) promoter, maize ubiquitin (Ubiquitin) promoter Deng.Tissue-specific promoter of the present invention in addition to comprising due general promoter element, also have enhancer and The advantages of characteristic of silencer, such promoter be can promotor gene in the expression at specific plant tissues position, avoid external source The unnecessary expression of gene, to save the overall power consumption of plant.Inducible promoter of the present invention refers to Under certain specific physically or chemically stimulations of signal, the promoter of the transcriptional level of gene can be significantly increased, at present Separated inducible promoter includes but is not limited to adverse circumstance inducing expression promoter, photoinduction expression promoter, thermal induction It expresses promoter, wound-inducible expression promoter, fungal induction and expresses promoter and symbiotic bacteria inducing expression promoter etc..This The invention tissue-specific promoter includes but is not limited to LTP2 Seeds oil-body-specific promoter, END2 seed specific expression Promoter, aleurone specific expression promoter etc..More specifically, promoter of the present invention is a pollen-specific expression starting Son, it is preferable that the nucleotide sequence of the pollen-specific expression promoter is as shown in SEQ ID NO:9.

The above-mentioned expression cassette of the present invention, also further includes a pollen inactivated gene, and the pollen inactivated gene can be with Interfere the function or formation of the male gamete containing the pollen inactivated gene in plant.The pollen inactivated gene includes but unlimited In barnase gene, amylase gene, DAM methylase etc., more specifically, the pollen inactivated gene is corn alpha amylase Gene Zm-AA.

The above-mentioned expression cassette of the present invention, also further may include a screening-gene, the screening-gene can be used for Plant containing the expression cassette, plant tissue cell or vector selection are come out.The screening-gene includes but is not limited to antibiosis Plain resistant gene anti-herbicide gene or fluorescence protein gene etc..Specifically, the screening-gene includes but unlimited In: chloramphenicol resistance gene, hygromycin gene, streptomycin resistance gene, miramycin resistant gene, sulfamido resistance base Cause, glyphosate gene, glufosinate-resistant gene, bar gene, red fluorescent gene DsRED, mCherry gene, cyan are glimmering Aequorin, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene etc..

The present invention also provides it is a kind of regulate and control plant fertility method, i.e., by influence S44 gene nucleotide sequence or Person regulates and controls the transcriptional expression of S44 gene to regulate and control the fertility of plant.The plant fertility that influences refers to through regulation S44 gene Expression, to make the fertility of the plant change, as led to plant male sterility or leading corresponding S44 gene mutation The malesterile mutants of cause revert to fertile.Specifically, concrete application demand is depended on, can be influenced by a variety of methods S44 gene is in the intracorporal expression of plant, to achieve the effect that regulate and control plant male fertile.More specifically, regulation S44 gene The progress of tool obtained by many those of ordinary skill in the art can be used in expression, for example, passing through mutation, mutagenesis, antisense base Being transferred to of cause, co-suppression or introducing of hairpin structure etc. may be used to the normal expression for destroying S44 gene, to obtain hero Property infertility plant.On the other hand, the invention also includes planted by the way that the nucleotide sequence of wild type S44 gene is introduced mutant Strain restores the male fertility of the plant that S44 gene expression is destroyed.

The present invention also provides a kind of method for obtaining s44 malesterile mutants material, the method passes through mutant plant Endogenous sterility changing gene S44, or the nucleotide sequence of mutation and the gene of its very high homology, make the plant lose male The process of fertility.The nucleotide sequence of the sterility changing gene S44 is as shown in SEQ ID NO:1 or 2, the sterility changing base Because the amino acid sequence of S44 is as shown in SEQ ID NO:3." mutation " includes but is not limited to following methods, such as with physics or Gene mutation caused by the method for chemistry, chemical method include that caused mutagenesis, the mutation are handled with mutagens such as EMS It can also be point mutation, be also possible to DNA missing or insertion mutation, be also possible to through the gene silencings such as RNAi means or lead to The method for crossing site-directed point mutation, the method for the site-directed point mutation include but is not limited to ZFN directed mutagenesis method, TALEN The gene editings method such as directed mutagenesis method, and/or CRISPR/Cas9.

The present invention also provides a kind of application methods of s44 malesterile mutants material, it is characterised in that the mutation It is male sterile that material is that plant caused by the mutation as the nucleotide sequence of S44 gene, containing saltant type S44 gene has Phenotype, wherein the nucleotide sequence is the nucleotide sequence of S44 gene, preferably as shown in SEQ ID NO:1 or 2.Specifically, It is prominent that a single base occurs in rice male sterility mutant provided by the present invention, on the 9th exon of S44 gene Become, i.e., guanine (G) becomes cytimidine (T), and the 354th amino acids of corresponding protein product become bright ammonia from glycine (Gly) Sour (Leu) (see Fig. 5), the transcript caused change with protein product, to make plant lose fertility, after mutation Nucleotide sequence as shown in SEQ ID NO:7, amino acid sequence is as shown in SEQ ID NO:8.The mutant material is answered With, application including but not limited in crossbreeding, more specifically refer to using s44 mutant plants as sterile line female parent, Hybridize with restorer, produces hybrid seed.

The application of the above-mentioned mutant material of the present invention further includes above-mentioned DNA sequence dna or mutant material following (a) extremely Any one of (d) application in:

(a) plant variety or strain are cultivated；

(b) plant variety or strain of the enhancing of Pollination Fertilization ability are cultivated；

(c) plant variety or strain that Pollination Fertilization ability slackens are cultivated；

(d) male sterile plants kind or strain are cultivated.

The invention also discloses a kind of keeping method of male sterile line, the method is conversion with s44 Mutants homozygous Acceptor material converts 3 target genes of close linkage into the sterile mutant recipient plant.3 target genes It is sterility changing gene S44, pollen inactivated gene and riddled basins respectively.Wherein, sterility changing gene S44 can make infertility Transformation receptor fertility restorer, pollen inactivated gene can make containing conversion foreign gene pollen inactivation, that is, lose insemination energy Power, screening-gene can be used for the sorting of transgenic seed or tissue and non-transgenic seed or tissue, and what is sorted out non-turns base Because seed be used as sterile line produce cenospecies, transgenic seed be used as keep system come continuously, steadily produce sterile line.

In the keeping method of above-mentioned male sterile line, the pollen inactivated gene include but is not limited to barnase gene, Amylase gene, DAM methylase etc..More specifically, the pollen inactivated gene is corn alpha amylase gene Zm-AA.It is described Pollen inactivated gene is connected with the promoter for preferring to male gamete expression.More specifically, described prefer to male gamete expression Promoter include but is not limited to PG47 promoter, Zm13 promoter etc..The screening-gene can be used for that the expression will be contained The plant of box or vector selection come out.The screening-gene includes but is not limited to antibiotics resistance gene or antiweed base Cause or fluorescence protein gene etc..Specifically, the screening-gene includes but is not limited to: chloramphenicol resistance gene, hygromycin are anti- Property gene, streptomycin resistance gene, miramycin resistant gene, sulfamido resistant gene, glyphosate gene, glufosinate-resistant Gene, bar gene, red fluorescent gene DsRED, mCherry gene, cyan fluorescent protein gene, yellow fluorescent protein gene, Luciferase gene, green fluorescence protein gene etc..

More specifically, the described method comprises the following steps the invention also discloses a kind of propagation method of male sterile line:

(a) following carriers are transferred to, into s44 male sterile line to obtain the holding system for containing following carriers, the carrier Include: sterility changing gene S44, the sterility changing gene S44 can restore the male fertility of s44 male sterile line；With Pollen inactivated gene can interfere the male gamete containing the pollen inactivated gene in plant when the pollen inactivated gene is expressed Function or formation so that the active male gamete generated in the plant is free of the carrier；And screening Gene, the screening-gene can be used for the sorting of transgenic seed or tissue and non-transgenic seed or tissue.

(b) maintainer plant formed after above-mentioned carrier will be transferred to be selfed, while generates carrier-free s44 male sterility System and the maintainer seed containing carrier；Or rush to the pollen of maintainer plant on s44 male sterile line plant, keep s44 male Property sterile line pollination breed the seed of carrier-free s44 male sterile line.

In the propagation method of above-mentioned male sterile line, the pollen inactivated gene include but is not limited to barnase gene, Amylase gene, DAM methylase etc..More specifically, the pollen inactivated gene is corn alpha amylase gene Zm-AA.It is described Pollen inactivated gene is connected with the promoter for preferring to male gamete expression.More specifically, described prefer to male gamete expression Promoter include but is not limited to PG47 promoter, Zm13 promoter etc..

The screening-gene can be used for coming out the plant containing the expression cassette or vector selection.The screening-gene packet Include but be not limited to antibiotics resistance gene anti-herbicide gene or fluorescence protein gene etc..Specifically, the screening Gene includes but is not limited to: chloramphenicol resistance gene, hygromycin gene, streptomycin resistance gene, miramycin resistant gene, Sulfamido resistant gene, glyphosate gene, glufosinate-resistant gene, bar gene, red fluorescent gene DsRED, MCherry gene, cyan fluorescent protein gene, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene Deng.

The invention also discloses a kind of production methods for keeping system, the described method comprises the following steps: to s44 male sterility It is transferred to following carriers in system, that is, obtains the holding system of s44 male sterile line, the carrier includes: sterility changing gene S44, The sterility changing gene S44 can restore the male fertility of s44 male sterile line；With pollen inactivated gene, the pollen When inactivated gene is expressed, the function or formation of the male gamete containing the pollen inactivated gene in plant can be interfered, so that The fertile males gamete generated in the plant is all free from the carrier；And screening-gene, the screening-gene can be used In the sorting of transgenic seed and non-transgenic seed.

In the production method of above-mentioned holding system, the pollen inactivated gene includes but is not limited to barnase gene, starch Enzyme gene, DAM methylase etc., more specifically, the pollen inactivated gene are corn a amylase gene Zm-AA.The pollen Inactivated gene is connected with the promoter for preferring to male gamete expression.More specifically, described prefer to opening for male gamete expression Mover includes but is not limited to PG47 promoter, Zm13 promoter etc..The screening-gene can be used for will be containing the expression cassette Plant or vector selection come out.The screening-gene include but is not limited to antibiotics resistance gene or anti-herbicide gene or It is fluorescence protein gene etc..Specifically, the screening-gene includes but is not limited to: chloramphenicol resistance gene, hygromycin resistance base Cause, streptomycin resistance gene, miramycin resistant gene, sulfamido resistant gene, glyphosate gene, glufosinate-resistant base It is cause, bar gene, red fluorescent gene DsRED, mCherry gene, cyan fluorescent protein gene, yellow fluorescent protein gene, glimmering Light element enzyme gene, green fluorescence protein gene etc..

The invention also discloses a kind of propagation methods for keeping system, the described method comprises the following steps:

(a) it is transferred to following carriers into s44 male sterile line, that is, obtains the holding system of s44 male sterile line, the load Body includes: sterility changing gene S44, the sterility changing gene S44 can restore the male fertility of s44 male sterile line； The male containing the pollen inactivated gene in plant can be interfered to match when the pollen inactivated gene is expressed with pollen inactivated gene The function or formation of son, so that the fertile males gamete generated in the plant is all free from the carrier；And screening Gene, the screening-gene can be used for the sorting of transgenic seed and non-transgenic seed；With

(b) maintainer plant formed after above-mentioned carrier will be transferred to be selfed, i.e., obtained in the ratio breeding of 1:1 without load The s44 male sterile line seed of body and maintainer seed containing carrier.

The invention also discloses a kind of production methods of seed, which comprises

(a) following carriers are introduced into s44 male sterile line, obtain the holding system of s44 male sterile line, the carrier packet Contain: sterility changing gene S44, the sterility changing gene S44 can restore the male fertility of s44 male sterile line；And flower Powder inactivated gene can interfere the male gamete containing the pollen inactivated gene in plant when the pollen inactivated gene is expressed Function or formation, so that the fertile males gamete generated in the plant is all free from the carrier.

(b) maintainer plant after above-mentioned carrier will be transferred to be selfed；With

(c) maintainer seed containing the carrier and carrier-free s44 male sterile line are obtained after being selfed.

The breeding of the above-mentioned male sterile line of the present invention or keeping method, the production method or propagation method, kind that keep system In production method of son etc., wherein step (a), which is also possible to introduce into common plant, contains sterility changing gene S44, flower The carrier of powder inactivated gene and screening-gene, after obtaining the transgenic plant containing the carrier, then it is miscellaneous with S44 male sterile line It hands over, by directive breeding, obtaining background is s44 male sterile line and the maintainer plant for containing the carrier.

The propagation method or keeping method of the above-mentioned male sterile line of the present invention, the production method for keeping system or breeding side In method, production method of seed etc., wherein the nucleotide sequence of the sterility changing gene is selected from following group of one of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80% (preferably at least 85%) sequence similarity with (a)-(c) sequence, and have fertility extensive The DNA sequence dna of multiple function；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

The promoter for being connected with the expression of a pollen-specific of above-mentioned sterility changing gene S44 also operability, can drive Expression of the S44 gene in plant pollen.The promoter of pollen-specific expression be selected from by MS26, NP1, MSP1, PAIR1, PAIR2、ZEP1、MELL、PSS1、TDR、UDT1、GAMYB4、PTC1、API5、WDA1、CYP704B2、MS26、MS22、DPW、 One of the group that the promoter of the sterility changings gene such as MADS3, OSC6, RIP1, CSA, AID1,5126 or Ms45 is constituted.More specifically , the nucleotide sequence of the pollen-specific expression promoter is as shown in SEQ ID NO:9.

Above-mentioned sterility changing gene S44 also operability is connected with a terminator, and the terminator can be public The terminator for any one gene opened.

The breeding of the above-mentioned male sterile line of the present invention or keeping method, the production method or propagation method, kind that keep system In production method of son etc., the pollen inactivated gene includes but is not limited to barnase gene, amylase gene, DAM methyl Change enzyme etc..More specifically, the pollen inactivated gene is corn a amylase gene Zm-AA.The pollen inactivated gene and preference It is connected in the promoter of male gamete expression.More specifically, the promoter for preferring to male gamete expression includes but unlimited In PG47 promoter, Zm13 promoter etc..

The breeding of the above-mentioned male sterile line of the present invention or keeping method, the production method or propagation method, kind that keep system In production method of son etc., wherein the screening-gene includes but is not limited to antibiotics resistance gene, herbicide resistance gene Or fluorogene.Specifically, the screening-gene includes but is not limited to: chloramphenicol resistance gene, hygromycin gene, strepto- Plain resistant gene, miramycin resistant gene, sulfamido resistant gene, glyphosate gene, glufosinate-resistant gene, bar base Cause, red fluorescent gene DsRED, mCherry gene, cyan fluorescent protein gene, yellow fluorescent protein gene, luciferase base Cause, green fluorescence protein gene etc..

The present invention also provides a kind of anther specific expression promoter, the sequence of corresponding promoter be S44 gene from ATG to The sequence of upstream about 2500bp nucleotide composition, more specifically, in rice, the nucleotides sequence of the S44 gene promoter Column are as shown in SEQ ID NO:9.SEQ ID NO:9 is connected with Reporter gene GUS, plant is converted, to transgenic positive plant Root, stem, leaf and the positions such as spend to carry out GUS staining analysis, the promoter of discovery S44 gene can drive GUS special in pollen Expression illustrates that S44 gene promoter is pollen-specific type promoter.

Plant anther specific expression promoter provided by the present invention contains in ordered list as shown in SEQ ID NO:9 Nucleotide sequence, or the nucleotide sequence comprising having 90% or more similitude with listed nucleotide sequence in SEQ ID NO:9, Or comprising 500 and 500 or more the continuous nucleotide fragments in the SEQ ID NO:9 sequence, and can drive with The nucleotides sequence that the promoter is operatively connected is listed in the expression in plant pollen.Expression vector containing above-mentioned sequence turns base Because cell line and host strain etc. all belong to the scope of protection of the present invention.Expand SEQ ID NO:9 starting disclosed in this invention The primer pair of any nucleotide fragments of son is also within protection scope of the present invention.

Promoter nucleotide sequence provided by the present invention can also be used to separate from other plants other than rice corresponding Sequence especially carries out homologous clone from other monocotyledons.According to promoter sequence listed by these corresponding sequences and this paper Sequence homology between column, or the homology with this promoter gene are identified using the technologies such as such as PCR, hybridization and separate these Corresponding sequence.Therefore, the sequence phase between SEQ ID NO:9 promoter sequence (or its segment) listed by according to them with the present invention Like property, isolated respective segments, are also included in embodiment.

" promoter " of the present invention refers to a kind of DNA regulatory region, generally comprises energy guide RNA polymerase II and exists The TATA box of the suitable transcription initiation site starting RNA synthesis of specific coding sequence.Promoter also may include other identification sequences, These identification sequences are usually located at the upstream or 5 ' ends of TATA box, commonly known as upstream promoter element, play regulatory transcription effect The effect of rate.Those skilled in the art should know, although having identified the core for promoter region disclosed by the invention Nucleotide sequence, but separate and identify other tune of the TATA box upstream region for the specific promoter region identified in the present invention It is also within the scope of the invention to control element.Therefore, promoter region disclosed herein is usually further defined as comprising upstream Controlling element, such as those of tissue expression for regulating and controlling coded sequence and temporal expressions function element, enhancer etc..With Identical mode can be identified, isolate the promoter member for making it possible to be expressed in destination organization (such as male tissue) It is used together by part with other core promoters, to verify the preferential expression of male tissue.

Minimal sequence needed for core promoter refers to starting transcription, such as the sequence of referred to as TATA box, this is What the promoter of the gene of coding protein usually all had.Therefore, optionally, the upstream promoter of S44 gene can be with it certainly Body or from other sources core promoter associations use.Core promoter can be the starting of core known to any one Son, such as cauliflower mosaic virus 35S or 19S promoter (United States Patent (USP) No.5,352,605), ubiquitin promoter (United States Patent (USP) No.5,510,474), IN2 core promoter (United States Patent (USP) No.5,364,780) or figwort mosaic virus promoter.

The function of the gene promoter can be analyzed by the following method: can by promoter sequence and reporter gene It is operatively connected, forms transformable carrier, then the carrier is transferred in plant, in obtaining transgenic progeny, pass through observation Expression of the reporter gene in each histoorgan of plant confirms its expression characterization；Or above-mentioned carrier is subcloned into For the expression vector of transient expression experiment, promoter or the function of its control region are detected by transient expression experiment.

Host will be depended on and by the table for the selection of test starting or the appropriate expression vector of regulatory region function The method for introducing host up to carrier, such methods are well known to those of ordinary skill in the art.For eucaryote, in carrier In region include control transcription initiation and control processing region.These regions are operably connected to reporter gene, institute Stating reporter gene includes YFP, UidA, gus gene or luciferase.Table comprising the presumption control region being located in genomic fragment It can be introduced into complete tissue, such as interim pollen up to carrier, or introduce callus, to carry out functional verification.

In addition, promoter of the invention can also be connected with the nucleotide sequence of not S44 gene, to express other heterologous cores Nucleotide sequence.Promoter nucleotide sequence of the invention and its segment and variant can be assembled in one together with heterologous nucleotide sequence In a expression cassette, for being expressed in purpose plant, more specifically, being expressed in the male organs of the plant.The expression cassette There is suitable restriction enzyme site, for being inserted into the promoter and heterologous nucleotide sequence.These expression cassettes can be used for pair Any plant carries out genetic manipulation, to obtain desired corresponding phenotype.

S44 gene promoter disclosed in this invention, can be used for driving the expression of following heterologous nucleotide sequence, so as to turn The plant of change obtains male sterile phenotype, and the heterologous nucleotide sequence codified promotes the enzyme of carbohydrate degradation or repairs Adorn enzyme, amylase, debranching enzyme and pectase, more specifically as barnase gene, corn alpha amylase gene, growth plain gene, Rot B, cytotoxin gene, diphtheria toxin, DAM methylase or dominant male sterility gene.

In some embodiments, the core mentioned in the present invention for being operatively connected to promoter downstream of the present invention Nucleotide sequence, wherein " nucleotide sequence " can be the structure being operatively connected to after promoter disclosed herein Gene, adjust gene, structural gene antisense gene, adjust gene antisense gene or can interfere with endogenous gene expression Tiny RNA.

More specifically, sterility changing genes of SEQ ID NO:1 or 2 provided by the present invention can be building up to promoter The downstream of SEQ ID NO:9, to drive the specifically expressing of the sterility changing gene in pollen, or the technology for passing through RNAi Principle, building by SEQ ID NO:9 start can be with the RNAi carrier of silencing SEQ ID NO:1 gene, to obtain SEQ ID The malesterile mutants of NO:1 gene.

Promoter sequence provided by the present invention is isolated from any plant, including but not limited to Btassica, corn, small Wheat, sorghum, two section shepherd's purse categories, sinapsis alba, castor bean, sesame, cottonseed, linseed, soybean, Arabidopsis, Phaseolus, peanut, clover, Oat, rapeseed, barley, oat, rye (Rye), grain, chinese sorghum, triticale, einkorn, Si Peierte wheat (Spelt), Emmer, flax, gramagrass (Gramma grass), friction standing grain, false chinese sorghum, fescue grass, perennial ryegrass, sugarcane, the red certain kind of berries Tongue fur, papaya, banana, safflower, oil palm, muskmelon, apple, cucumber, dendrobium nobile, gladiolus, chrysanthemum, Liliaceae, cotton, eucalyptus, Xiang Certain herbaceous plants with big flowers, rape, beet, coffee, ornamental plant and conifer etc..Preferably, plant include corn and soybean, it is safflower, leaf mustard, wheat, big Wheat, rye, rice, cotton and sorghum.

The present invention also provides a kind of expression cassette, carrier or engineered strain, wrapped in the expression cassette, carrier or engineered strain S44 gene provided by the present invention and/or its promoter are contained.Promoter in the expression cassette, carrier or engineered strain can To be natural promoter or substituted promoter, connected nucleotides sequence will be driven to be listed in the expression in plant.In construct Promoter can be inducible promoter.When the nucleotide sequence of S44 gene is connected with another promoter, preferably It is that the promoter sufficiently drives the expression of the sequence in pollen development early stage, such as can be in the stage9 phase spy of pollen development Opposite sex expression.Specifically, the type of workable promoter includes composing type viral promotors, such as cauliflower mosaic virus (CaMV) 19S and 35S promoter or radix scrophulariae mosaic virus 35 S promoter or ubiquitin promoter.More specifically, this can be sent out The nucleotide sequence of sterility changing gene S44 provided by bright is building up to promoter SEQ ID NO:9's provided by the present invention Downstream, to drive expression of the fertile gene in transformation receptor plant.

Organizing specific expression promoter can be used for targeting enhancing transcription and/or expression in specific plant tissue.Promoter It can express and also be expressed in other plant tissues in targeted tissue, it can strong expression and than other tissues in targeted tissue The much lower expression of degree, or highly preferred can express in targeted tissue.In one embodiment, promoter is preference The specifically expressed type in the male of plant or female tissue.The present invention necessarily uses any specific male in method Type of priority promoter is organized, any in many such promoters well known by persons skilled in the art can use.It retouches herein The natural S44 gene promoter stated is an example of workable promoter.Another such promoter is 5126 startings Son, MS45 promoter, MS26 promoter, BS92-7 promoter, SGB6 controlling element and TA29 promoter etc., prefer to instruct Its expression of gene connected in male plant tissue.It can also include that gamete tissue priority expression starts in certain constructs Son.Male gamete priority expression promoter includes PG47 promoter and ZM13 promoter.

It may also include other components in above-mentioned construct, this depends primarily on the purpose and purposes of vector construction, such as can It further comprise selectable marker gene, targeting or regulating and controlling sequence, critical sequences or boot sequence, introne etc..Expression cassette will also It is included in plant at 3 ' ends of desired heterologous nucleotide sequence and has functional transcription and translation terminator.Terminator can be Itself terminator of S44 gene, is also possible to the terminator from external source, such as nopaline synthase or octopine synthase terminator Domain etc..

It is desirable that guiding the expression product of heterologous nucleotide sequence into specific cells device, such as plastid, amyloplast, Huo Zheyin To endoplasmic reticulum, or in the case where cell surface or cell exocrine, expression cassette also may include the nucleosides for encoding transit peptides Acid sequence.Such transit peptides be it is known in the art, its include but is not limited to the small subunit of Rubisco, plant EPSP synthase, Corn Brittle-1 chloroplast transit peptides etc..

During preparing expression cassette, a variety of DNA fragmentations can be operated, be in proper orientation to provide, or DNA sequence dna in correct reading frame.To reach this purpose, adapter or connector can be used, DNA fragmentation is linked up, or Person further comprises other operations, to provide convenient restriction enzyme site etc..

Further, it may also include selectable marker gene in construct provided by the present invention, it is transformed for selecting Cell or tissue.The selectable marker gene includes assigning antibiotic resistance or the gene to Herbicid resistant.Suitable selection Marker gene includes but is not limited to: chloramphenicol resistance gene, hygromycin gene, streptomycin resistance gene, miramycin resistance Gene, sulfamido resistant gene, glyphosate gene, the careless bony resistant gene of fourth.The selectable marker gene can also be red Color fluorogene, cyan fluorescent protein gene, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene, flower The genes such as green glucoside p1.

Expression cassette or carrier provided by the present invention can be inserted into plasmid, clay, yeast artificial chromosome, bacteria artificial dye Colour solid or other be suitble to be transformed into any carrier in host cell.Preferred host cell is bacterial cell, is especially used In cloning or storage polynucleotides or bacterial cell for converting plant cell, for example, Escherichia coli, Agrobacterium tumdfaciens and Agrobacterium rhizogenes.When host cell is plant cell, expression cassette or carrier can be inserted into the base for the plant cell being converted Because in group.Insertion can be positioning or random insertion.Preferably, such as homologous recombination is inserted through to realize.In addition, table It is positively retained at outside chromosome up to box or carrier.Expression cassette or carrier of the invention may be present in the core, chloroplaset, line of plant cell In plastochondria and/or plastid.Preferably, expression cassette of the invention or carrier are inserted into the chromosomal DNA of plant nucleolus.

It is specific expressed in pollen that pollen-specific provided by the present invention expression promoter can be used for foreign gene, from And foreign gene continuous expression adverse effect in its hetero-organization of plant is avoided, it is raw to can be also used for plant pollen The functional analysis and identification of long development related gene；It can be used for male sterile line and keep the breeding and holding of system；And it can apply In pollen abortion experiment, so that brought bio-safety problem of being escaped by plant transgene drift or pollen is avoided, to plant The creation of object male sterile line and holding system is of great significance.

The nucleotide sequence and promoter sequence or expression cassette of S44 gene provided by the present invention can be inserted into carrier, matter Grain, yeast artificial chromosome, bacterial artificial chromosome or other be suitble to be transformed into any carrier in host cell.Preferably Host cell is bacterial cell, in particular for cloning or storing polynucleotides or the bacterial cell for converting plant cell, Such as Escherichia coli, Agrobacterium tumdfaciens and Agrobacterium rhizogenes.When host cell is plant cell, expression cassette or carrier can It is inserted into the genome for the plant cell being converted.Insertion can be positioning or random insertion.

It is of the present invention that nucleotide sequence, carrier or expression cassette are transferred to plant or introduces plant or plant is turned Change, refers both to that nucleotide sequence, carrier or expression cassette are transferred to recipient cell or recipient plant by conventional transgenic method In.Any transgenic method known to plant biotechnology field technical staff can be used to for recombinant expression carrier being transformed into In plant cell, to generate genetically modified plants of the invention.Method for transformation may include method for transformation directly or indirectly.Suitably Direct method include polyethylene glycol induction DNA intake, liposome-mediated conversion, using particle gun importing, electroporation and Microinjection.The method for transformation also includes the methods for plant transformation etc. of mediated by agriculture bacillus.

The present invention also provides a kind of production methods of plant comprising:

(a) expression cassette provided by the present invention is constructed；

(b) expression cassette for obtaining step (a) imports plant cell；

(c) genetically modified plants are regenerated；With

(d) genetically modified plants are selected；And

(e) optionally, the plant that amplification step (d) obtains is to obtain offspring.

Genetically modified plants of the invention are prepared using method for transformation known to plant biotechnology field technical staff.It is any Method can be used for for recombinant expression carrier being transformed into plant cell, to generate genetically modified plants of the invention.Method for transformation It may include method for transformation directly or indirectly.Suitable direct method includes that the DNA of polyethylene glycol induction takes in, is liposome-mediated Conversion, use particle gun to import, electroporation and microinjection etc..In a specific embodiment of the invention, the present invention makes With the transformation technology based on agrobacterium (reference can be made to Horsch RB etc. (1985) Science 225:1229；White FF, Vectors for Gene Transfer in Higher Plants, Transgenic Plants, volume 1, Engineering and Utilization, Academic Press, 1993, pp.15-38；The .Techniques such as Jenes B For Gene Transfer, Transgenic Plants, volume 1, Engineering and Utilization, Academic Press, 1993, pp.128-143, etc.).Agrobacterium bacterial strain (such as Agrobacterium tumdfaciens or hair root soil bar Bacterium) it include plasmid (Ti or Ri plasmid) and T-DNA element, the plasmid and element are transferred to plant after with Agrobacterium transfection Object, and T-DNA is integrated into the genome of plant cell.T-DNA can be located on Ri- plasmid or Ti- plasmid, or independently wrap It is contained in so-called binary vector.Agrobacterium-mediated method for transformation is described in for example.Agrobacterium-mediated conversion is most It is suitble to dicotyledon, but is also suitble to monocotyledon.Agrobacterium is described in for example the conversion of plant.Conversion can be led Cause instantaneous or stable conversion and expression.Although nucleotide sequence of the invention, which can be inserted into, falls into appointing in these broad varieties In what plant and plant cell, but it is particularly suitable for crop plants cell.

Compared with prior art, the present invention is with following the utility model has the advantages that the present invention provides a kind of pollen developments Gene and its promoter, and based on male sterile line caused by the gene mutation, the stable fertility of the sterile line, not by ring Border condition influences, can be restored by wild-type transgenic.The sterile line that the gene and the gene mutation generate is building third Necessary element is provided for crossbreeding system, the male sterile line which generates is right for producing hybrid seed In breaking through and improve existing " three systems " and " two systems " hybridization technique is significant.And hybrid seed and sterile line self When breeding, the seed shape generated in low temperature with restoring gene is normal and sterile line in the seed shape that high temperature is selfed is in Existing sickle shaped further ensures the pure of male-sterile seed so that being easy to identify hybrid seed when sterile line is from breeding Degree.

Detailed description of the invention

Fig. 1 is that wild type Huang Huazhan (left side) and mutant s44 (right side) small floral shape compares.

Fig. 2 is wild type Huang Huazhan (left side) and mutant s44 (right side) anther form compares.

Fig. 3 is wild type Huang Huazhan (left side) and mutant s44 (right side) pollen staining compares.

Fig. 4 is wild type Huang Huazhan (left side) and mutant s44 (right side) female organ (including ovary, style and column cap) form pair Than.

Fig. 5 is the amino acid alignment result of the S44 albumen of Huang Huazhan (HHZ), mutant s44 and OryzasativaLcv.Nipponbare (Nip).

Fig. 6 is expression of the S44 gene in rice different tissues organ.

Fig. 7 is the building schematic diagram of S44 gene promoter expression vector.

Fig. 8 is the GUS staining analysis for turning the transgenic rice plant of S44 gene promoter.

Fig. 9 is the building schematic diagram of the carrier that has complementary functions of S44 gene.

Figure 10 is the building schematic diagram of the CRISPR knockout carrier of S44 gene.

Specific embodiment

It elaborates below to the embodiment of the present invention, the present embodiment carries out under the premise of the technical scheme of the present invention Implement, the detailed implementation method and specific operation process are given, but protection scope of the present invention is not limited to following implementation Example.

The screening of embodiment 1, rice male sterility mutant s44

The mutant is obtained by EMS mutagenesis long-grained nonglutinous rice Huang Huazhan seed (M₀) method, wherein EMS mutagenesis concentration and Mutation time is respectively 0.7% and 12 hours, will come from M₀For the solid rear mixed receipts of plant of seed, mutant library (M is obtained₁).Come From M₁It is used to screen in seed maturity for the plant of seed, passes through Phenotypic Observation, obtain sterile plant.Sterile plant cuts rice stub again Raw, regeneration strain uses I in reproduction period₂- KI dyeing detection pollen development and staining reaction, it is found that one of mutant shows as nothing The allusion quotation of pollen grain loses type infertility (lodine loss), is named as s44 mutant.

The genetic analysis of embodiment 2, rice male sterility mutant s44

S44 mutant is accounted for wild type Huang China to be hybridized, F₁It is all shown as plant fertile.Again by F₁In generation, is selfed, The F of acquisition₂For can significantly divide into fertile plant and two groups of sterile plant in plant, and point of fertile plant and sterile plant From than showing that the sterile mutant character of s44 mutant is controlled by single recessive nuclear gene close to 3:1 (being shown in Table 1).

1 rice male sterility mutant s44 of table hybridizes F₂For segregation ratio

The reproductive organs phenotypic analysis of embodiment 3, rice male sterility mutant s44

Compared with wild type Huang China accounts for, s44 mutant plants growth and development is normal, and it is slower to ear, flower glume shape and open country Raw type has notable difference, shows as the flower glume of mutant in crescent shape, entire width narrows, and length variation is unobvious (see figure 1), and the anther of mutant is modest, white slightly transparent (see Fig. 2).Further use I₂- KI solution to the pollen of mutant into Row dyeing detection, it is found that the pollen staining of wild type is normal, and mutant shows as no pollen grain, i.e., presentation allusion quotation lose state (see Fig. 3).It has furthermore been found that the female organ (including ovary, style and column cap) of mutant is more bigger than wild type (see Fig. 4), column cap Exposing ratio is up to 85% or more, and the column cap of wild type is then seldom exposed, and the trichome on the blade and glumelle of mutant becomes more And become smaller.

The clone of embodiment 4, rice male sterility mutant gene S44

Mutant gene clone takes Mutmap method, i.e., constructs F using the raw parents of mutant and open country₂Group, By to F₂The method that sequence carries out the assignment of genes gene mapping is resurveyed by group.Specifically, sterile mutant s44 is accounted for wild type Huang China and is hybridized Obtain F₁Individual, F₁Selfing obtains F₂Segregating population plants F₂Group, and in F₂30 are chosen in group has male sterility phenotype Plant, take blade to extract genomic DNA, high throughput genome sequencing be used for after mixed in equal amounts, obtains about 18.5Gb gene altogether Data unit sequence, overburden depth are 43X (being shown in Table 2), and the genome sequence of sequencing data and wild type Huang Huazhan is compared, Difference SNP site is looked for, finally using the LOC_Os03g44150 allele on the 3rd chromosome of rice as mutant s44's Candidate Mutant gene.

The heavy sequencing data of 2 rice male sterility mutant s44 of table

Wild type Huang Hua Zhanzhong, S44 gene nucleotide sequence as shown in SEQ ID NO:1, code area overall length 1401bp, for nucleotide sequence as shown in SEQ ID NO:2, the albumen of gene coding contains 466 amino acid, amino acid sequence As shown in SEQ ID NO:3.And in rice male sterility mutant provided by the present invention, the 9th of the S44 gene after mutation the 1 single base mutation occurs on a exon, i.e. guanine (G) becomes cytimidine (T), and the of the protein product of CDS coding 354 amino acids are become leucine (Leu) (see Fig. 5) from glycine (Gly), that is, the coding region nucleotide sequence after being mutated is such as Shown in SEQ ID NO:7, amino acid sequence is as shown in SEQ ID NO:8.

Using high-resolution melting method (High Resolution Melt, HRM) to above-mentioned 775 plants of F₂It is carried out for group Genotyping, all sterile plants carry the homozygous mutant site of S44 gene as the result is shown, and fertile plant then carries The pure and mild wild type site of S44 gene or heterozygous site (being shown in Table 3).Plant selfing offspring containing wild pure and mild type site is whole It is fertile, and the plant selfing Posterity phenotype in the site containing heterozygous is the trait segregation of fertile plant and sterile plant close to 3:1.It is real It tests result to further demonstrate that, the mutation of recessive nuclear gene S44 can cause rice holandry sterile.

The HRM genotyping result of 3 mutated gene S44 of table

Utilize OryzasativaLcv.Nipponbare disclosed in International Rice genome plan (Typical Japonica Genome donor) genome sequencing number According to extracting sequence of the gene in OryzasativaLcv.Nipponbare, discovery S44 coding region sequence is accounted in wild type Huang China to be existed between OryzasativaLcv.Nipponbare Multiple SNP sites, and S44 albumen contains 466 amino acid in OryzasativaLcv.Nipponbare, 7 amino more than albumen more corresponding than long-grained nonglutinous rice Huang Hua Zhanzhong Acid.Different amino acids are in particular in that the Ala (GCG) of OryzasativaLcv.Nipponbare becomes Huang Hua and accounts for Val (GTG), and Gly (GGC) becomes Ser (AGC), Gly (GGG) becomes Ala (GCG), and Tyr (TAC) becomes Tyr (TAT), and Glu (GAG) becomes Asp (GAT), Ala (GCA) Becoming Ala (GCG), Thr (ACA) becomes Thr (ACT), and Gly (GGG) becomes Gly (GGA), and Thr (ACT) becomes ATT (Ile), Asp (GAT) becomes Glu (GAG), and Asp (GAT) becomes Asp (GAC), and Ser (TCA) becomes Ser (TCG), and Leu (TTA) becomes Leu(TTG).Specifically, in OryzasativaLcv.Nipponbare the genome nucleotide sequence of S44 gene as shown in SEQ ID NO:4, code area Nucleotide sequence is as shown in SEQ ID NO:5, and the amino acid sequence of coding is as shown in SEQ ID NO:6.

The expression analysis of embodiment 5, S44 gene in each organ of rice

According to the cDNA sequence design primer of S44 gene, upstream primer YW3:5 '-GATCAGGCAGAAAGGCTCACAC TG-3 ' (SEQ ID NO:10), downstream primer YW2:5 '-GATGTTGCCGATGAATACTGGAGC-3 ' (SEQ ID NO: 11), while using rice Actin gene as internal reference control design primer, 5 '-GCTATGTACGTCGCCATCCA of upstream primer - 3 ' (SEQ ID NO:12), downstream primer 5 '-GGACAGTGTGGCTGACACCAT-3 ' (SEQ ID NO:13).It mentions respectively It takes the total serum IgE of the different tissues of wild type Huang Huazhan rice material and synthesizes cDNA template, then take real time quantitative PCR method, Analyze S44 gene the root of rice, stem, leaf, gynoecium, glumelle, lemma, lepicena and young fringe grain husk flower primordium idiophase (stage6), Young fringe pollen mother cell Meiosis (stage7) and tetrad shaping age (stage8), monokaryon pollen early stage (stage9), monokaryon pollen middle and advanced stage (stage10), double-core pollen period (stage 11) and mature pollen phase (stage12) Express spectra.As a result as shown in fig. 6, S44 gene is in monokaryon pollen early stage (stage9) specifically expressing and expression quantity height, in monokaryon flower Powder middle and advanced stage (stage10) expression quantity starts to reduce, and also has relatively high table in root, gynoecium, flower glume and lepicena It reaches.Experiment shows that the expression of S44 gene is closely connected with rice fertility.

The promoter expression vector building and functional analysis of embodiment 6, S44 gene

The building of the promoter expression vector (see Fig. 7) of S44 gene: I-F of primer NGUS-BamH is used (TACCGAGCTCGGATCCGAGTGTGGCTTGGATTTTGATGGC, SEQ ID NO:14) and I-R of NGUS-EcoR (ACTGCAGTGGGAATTCTCGTGACGCGCCCCCACGCC, SEQ ID NO:15) amplifying rice genome, obtains 2545bp S44 promoter gene fragment (SEQ ID NO:9), amplified production is connected into carrier pHPG using In-Fusion method, is obtained PHPG-S44 carrier.It is converted by the method for mediated by agriculture bacillus to wild type force in the callus for transporting round-grained rice rice, screening regeneration Obtain transgenic plant.By the expression mould for analyzing the activity analysis S44 promoter of transgenic rice plant beta galactosidase Formula (see Fig. 8), find S44 gene promoter it is higher in flower development early expression amount, can be identified with colouring method come.

The function complementation experiment of embodiment 7, rice male sterility mutant s44

The building (see Fig. 9) of complementing vector: I-F (CCATGATTACGAATTCGAGTGTGGCTTG of primer NCom-EcoR is used GATTTTGATGGC, SEQ ID NO:16) and III-R (GGCCAGTGCCAAGCTTCATCAAGACCTAAGACAGC of NCom-Hind ATCCG, SEQ ID NO:17) genome of wild type Huang Huazhan rice is expanded, it obtains and contains S44 gene initiation codon 2545bp of the sub- upstream ATG or so arrives full-length genome sequence fragment (the SEQ ID of the 2110bp in the downstream terminator codon TGA NO:1), amplified production is connected into complementary expression vector pCAMBIA-1300 by In-Fusion method, obtains complementing vector pCAMBIA-1300-S44.Being cured to the Seed inducement of the pure and mild mutant of Huang Huazhan s44 is converted by the method for mediated by agriculture bacillus In injured tissue, screening regeneration obtains transgenic plant.All transgenic positive plant obtained are analyzed, it is found that all performance can It educates.The results show paddy gene S44 participates in pollen development regulation, which can lead to allusion quotation and lose phenotype.

Embodiment 8, S44 gene CRISPR knockout carrier transgenic line acquisition and phenotypic analysis

The building of the CRISPR knockout carrier (see Figure 10) of S44 gene: synthetic primer NCRISPR-S44-1 (ggcaGGAAAACATACGACCTGATG, SEQ ID NO:18) and NCRISPR-S44-2 (aaacCATCAGGTCGTATGTTTT CC, SEQ ID NO:19), use ddH₂O is diluted to 100 μM, and 2 μ L and 10XM buffer is respectively taken to be configured to 20 μ L systems, and 95 DEG C mixed Then system is put into natural cooling in boiling water by even heating 3min, form oligo.The CRISPR- that will be recycled with I digestion of Aar OsU3 carrier, the oligo formed with annealing are connect, and construct CRISPR-S44 carrier.It is converted by the method for mediated by agriculture bacillus military The callus of round-grained rice is transported, screening regeneration obtains transgenic plant.The transgenic positive plant of all acquisitions is analyzed, finds all turns Gene masculine plant shows infertility.Experimental result further proves that paddy gene S44 participates in pollen development regulation, and the gene is prominent Change can lead to allusion quotation and lose phenotype.

Sequence table

<110>Shenzhen Crop Molecular Design Breeding Institute

<120>a kind of method for obtaining male sterible series of rice using fertile gene S44

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8496

<212> DNA

<213>long-grained nonglutinous rice (Oryza sativa Indica)

<400> 1

gagtgtggct tggattttga tggcctcacc tttggcaagt ttagctaata aagtatggta 60

tgtctaggta atgttagtat gtgaaccaaa cagctgctta aacagactaa aacagcatag 120

gccaataaga cgctggggga ggaggttata cggtctaaaa acctatagca gagtggtccc 180

aaccctatca tgtcgctctc gctctcactt cactctctct cctgtactac tcgactactt 240

cgctctcccc atccggcgca agctcacgcc gccgccgacg ccgccgtgca cgagctcccg 300

cggccgccgc cgacgccgcg cgcgagctca cgcggcctgc cgccgacgcc gtgcgcgagc 360

tcacgtggcc gccgccgccg cgtgcgacct cacgcggccg ccgcctccgc cgcgtgcgag 420

ctcactccgc caccgccgtg cgcaagctca cgccgctacc ccacgctagc tgcctcagcc 480

aagcttcctc aggccatgga ggatctggtg cgggctacca ttttagtcct atttagtcat 540

ttcaaccaaa caggctaggg ctaaaaaggc cattttagtc ctattaagtc atttcaacca 600

aacaggctag gacttaaaaa ggactaatgt tttagttttg gggctaaact ttagtcatag 660

gactaatgta tcaaaacacc acctaagtac tactctattt ggcccacaca gacaaggccc 720

aaacaagagc acagatggac cgttgataag caccaggccg aaacaaattc ctccttcccg 780

gcctcggacg agggatatcc ttcgtcgttt gcatgttatt gaaatggtta tgaaaaaaat 840

ttaaaaaatt aagaagatgt attaacatat gatatatcac ttcgtaaaca tgtaagttca 900

aattcaactt ttacatctcg caacgaaaaa aacaaatttg acagtgaata tacgttaagt 960

agctgcagtt taatttgttt ttttcgttac gaggtgtaga agttgaattc gaacttgcat 1020

gtgttgtgga gtgttatatc acatgttaat acatattctt atttttttaa aattttttaa 1080

taactatttg agtgatatgc aaataacgag gggctcttcc ctcgagggat caaaatagtt 1140

cccccttccc ctcatccttt atatattttg gtactctcag aaaagtgctt tcggtggagc 1200

acatggactg ttggagctgg aattaacccc tcgatcagtt gtaacctttg tagtagatgg 1260

tgctccaagg actttttaga ttgatgttat tttaaatcat ataatttttt tgaaaaaatt 1320

gataaacatg tgaatatatt tagtctatta ctaaatattg tatagaattt cggcaacagc 1380

atatttagca tattgtacaa aaatttggta atattgctaa tttatcaaaa ttttagtatt 1440

attaaatttt aaaagtattt attttatgag taatatgaac agatcacaaa ttgatgacac 1500

cacgttacaa tttcagatgc tttgtgtttc tcctctacga ttgtccggaa aactttggtt 1560

gccatcgtcg tagagagcgt cgctgtgggg cacacggacc aaccaaagca catggcttcg 1620

gctgccacga gggccgacgg caaccgaaca ggcaggcagc gagctggggt ctgattgaca 1680

tacatgatta attactacag aactatccat taacatgtgg ttaattaagt attttttttt 1740

aaaatactcc ctcctttcct tgctcgacgc cgttgacttt ttaaaacatg tttaaccatt 1800

tatcttatta aaaactttta tgaaatgtgt aaaactatat gtatacataa aaacatattt 1860

aacaatatat caaatgatat aaacgaacgg tcaaacatat ttttaaaaaa ttcaactacg 1920

tcaaacactt taggatggag ggagtagaat aatataattt tttaaattaa ctttcgtata 1980

gaaaaacttt ttagaaaata caccgtttat gaagagcgtg cgtgcgtaaa aagacttgaa 2040

acgcagctcg ctcacagcgt cccgtgatcc taccgttcgc gtcgcgttgt ggtgtgggcg 2100

cgacgagcag gcgccgcaaa cgcgcaagcg gcgtgtggaa ggagaacaag tgggcccaga 2160

aagccagcag cgagagggag agccccagca agtcagtgag tgggccccac caccgagagt 2220

agggtaagag tgagagtccc acacgcacac gcccacggcc cacggcggcg acggcgctcg 2280

ctgcttccgt ggcaaaaacg gcagctatcg cccgacccga ggttagatta gatagactga 2340

gttaaacccc catttcatcc catcccgttc cattccgttg cgaaaatttt gcgagctcgc 2400

gacgcgaacc cctacgccgc agccgcaggc ttcctcttca tctcctcctc ctcctcctcc 2460

agacctccac gcgagcgtgc cccgggggtg gaagcggagg cggcggcggc tcgagcgcaa 2520

tctggtggcg tgggggcgcg tcacgatggc ggcggcgctg gtgaggcgga gcggcgcggg 2580

gctggcgcgg gggaggggga tgtgctcggc cacggcggca gagcgcgcgg cgctgacgtc 2640

cgaggagctc atgcggatgg agcgcgagcg cagcgcgcac aagtacggtt tgcccctcga 2700

tctcccctcc tcgctctctt gtgctgcgat ctctctcacc ggtttagtcc ccgactcgct 2760

ggtccggggt atcgtactcg gatcgcgttt cagactggga attccgcgct cgtgatcgat 2820

ttttcttgct caggaatttc cctttcttcg gttggtcctc tgtttatcta tgcagcatag 2880

ggccgtggaa gtggaaccag cagatcgtat gatattactt cctcgaatcg gggatgtaca 2940

actagtgtac aactgattct tgtacgcgtg ggagagggag actggactca actcactctc 3000

gaatgttgtt tatatcaagg actcggccac ttctggatac tgaccgagtg ttgtttaatg 3060

tttatcacta agtaccatgt cagcgacatt gttgatgact ccgatatgtc ccagggatag 3120

tactgctgtt gcatttggtt gcgataaaga cgtctctact acttgccttg tctcattggc 3180

tggaaattct gaggttctac taagcataga gcaattgaac ctctgggttt atttttcaca 3240

aattatgcaa caagttatat gaagcttatg tatatgtctg ggacaaaagg aactttcacc 3300

tgtcactgca agccttttat tttgatattc tagttgcttc ctaacttata gtttgaacat 3360

tcacttcctg cagctatcat ccaattccgg tggtgttctc caagggagaa ggttcacata 3420

tattggatcc tgaaggcaac aaatacattg atttcctgtc tgcttattct gcagtcaatc 3480

aggtgatttt tttttcctgg tttgttacat cttgtaattg aatgtgtttt ggtcaaagca 3540

cacattagaa ggcaaaaatg ttggtatcca ttgtttcaac cagcttatat catttttcat 3600

aattgatgta gtttttgcaa ttgttgtagg gccattgcca tccaaaagtc ctgagagcgt 3660

tgaaagatca ggcagaaagg ctcacactga gttctagagc tttctacaat gacaaattcc 3720

caatctttgc ggaatacctg actagcatgt ttggatatga aatgatgttg ccgatgaata 3780

ctggagctga aggagtggaa acagctatca aattggtgag gaaatggggt tatgagaaga 3840

aaaagatacc aaaaaatgag gtatgagtcc caaaagctac atgtttcatt tcaacctggc 3900

aatatttctc tccacctggc cctttgtgtt gccatgaagg tgcagaaaaa tccgagtaag 3960

ctttggctag atgatgttgt atttgtcagg gatagcatat ccatattcct tgctttgcat 4020

aatgctgctg ctcttaatat tttgctcatt agttggatat cattaaagat atcgttatct 4080

ttatcacttt atgtaaatga aagcagagtt aaatggaaaa gcaaaacaat tcacagagtt 4140

gcctactgtt ttccttattc ttaactgttt gattgctggt gtacaatata actatataat 4200

atctatgata gtccatattt tggaaaatgt atcacttaac agctttgaaa ttagagattc 4260

attggtacct gttttttgtg aaatgttcgg tcttctgcag gctttgattg tctcttgctg 4320

tggatgtttt catggtcgga cattaggtgt catctctatg agttgtgata atgatgcaac 4380

tcgtggtttt ggcccattgg ttcctggcca tcttaaagtt gattttggag acattgatgg 4440

gttggagaaa atctttaaag gtaagctcat ctgtttattt gtagcaacca tattctacac 4500

tatttttgag tatttgcatg ttcatgaacg ctatttgatt cagagcatgg cgagaggata 4560

tgtggttttt tgtttgaacc aatccaagga gaagctgggg tatgtatttt ttaagttact 4620

ttgtatttat ttttcaaaaa gttactagat cgaactcttg ctagttctgt attgtgttgt 4680

ataataatat actaattctg atatactacc gtataaagtt ataaatctct aatacaattt 4740

aaacaaaatt agttgactgg aagaccttcc caaccctgca ttatagtcaa tttcttgact 4800

ccacaactaa gggtattact aacaaatggt acacatggtt tggcacctgt tccagcctaa 4860

ttaccatgat atgcttttaa gccatttaca gatactggta atttgattag ttcaattaag 4920

aaacatggat agagattggt tctaaagcac ttttcaagtt aaagtggtaa aactagaatg 4980

gggctatatt gataactaaa gcatgtgctg taaactctag ccattgtgct acttgtatcc 5040

atattttttg ttattctcat cagcttgtga tatcctcgtg ttaaaaattc cacaaaccta 5100

ctgctcacag gtaataatcc caccagacgg ctatttgaaa gctgtcagag atttgtgttc 5160

aaggcacaac attctgatga ttgcagatga gatccaaaca ggcatagcta gaactggcaa 5220

aatgctggca tgcgattggg aaaacatacg acctgatgtg gtggtaagtt tctattttct 5280

gctcatagaa aaaaaaatgt ttctgctaca ctgtttaacc tcttctcact gcacaacgac 5340

acwagtatct atccgctggg agtttttatt tgctggagca tattcagcta caatgttgat 5400

caagtatctc cactgttcag attctaggca aggcccttgg tgctggagta gttcctgtca 5460

gtgcggttct tgcagataag gatattatgc tgtgtatcaa accaggagaa catggaaggt 5520

atgggccatt ttcaatcctt ctgttttggt tcattccaac acggagttaa attatgaact 5580

aattcagttc tttaatcatg aattaatgtc tgtgcaatac cccaagtttt tttccagtgt 5640

ataacatttt tgctactttt agataaacaa gtttttgctt tccccccctt ttgatcagtc 5700

ttatgtttga tcactggcag tacatttggt gggaacccat tggcaagtgc tgtggcagtt 5760

gcatcgctga aagtagttac agatgaaggt ctcgttgaaa ggtacattgt tttgttgcaa 5820

gagaaataag ttatttccta taacatcagc tgtttcatga ttcagttgta tgattgttca 5880

tgagtactct tctaaacatt tactgaacta cagggctgca aagttaggac aagagttcag 5940

agatcagcta cagaaggttc aacagagatt cccgcaaatc ataagggaag tacgtgggag 6000

gggtttgctt aatgcagtgg atctaagcaa cgaagctttg tcccctgctt ctgcttacga 6060

catctgcatc aagctgaagg agagaggcgt tctggcaaag cccacacatg acaccataat 6120

cagattagcg cctccgctgt caatcaggta tgtcctttgc tcttatgtct ttatggttgt 6180

attagcatca tatgtttaat aaagttttct tttgggtaat ggctaaaaat cctcttaatt 6240

tcagtcctga ggagcttgca gaagcatcga aggcgttcag cgatgtgctt gagcatgacc 6300

tgccacagct gcagaagcag atcaagaaga cagaatccgc ggcagaaaaa caatcctgtg 6360

acagatgcgg cagagacttg tactgatgag tgattcctcc atccgagcaa atagacgaga 6420

cgatgaaacg tttccagagg cacccgtttc gcccaaataa aatagcagaa cacaccttcg 6480

cgaattcatg gctcattgta gtagtagagt agtatatata cacctccttg ttgcgatgtc 6540

tgggacatat ggtccaggga tttgtcgcct aatcgagctg gttgcaaaca aatggggtag 6600

cattattcta gtctaatcat attatgcaga agaatcttga actggatgaa atcggtcgat 6660

tttatctaca tcttcgttat ttgcattata tagaagtact atatttttgg catctgtttg 6720

tacatggttg tttctgtgag tgacatccac cgccgcgcaa gctgcggtga cgaagatccc 6780

ggcgacgatc gttggctgaa ctggacctgc aaaacaagat gagctggccg gtgccggtat 6840

agcatcaaca tccgcgacca gctgctgtgg agcacgccgc gtcggtgtac catcagttgg 6900

ccgtcgtcgt cgcgtcgttc accgggcgtc cgcttggcca cgaccacgaa tccacgatgc 6960

ttcggctgcg cgacttgcat gtgggcatat agctagcaag tttagttatt gaaacatact 7020

cgatccctcc gggcattaat aggagtagga tgcaattgac actgctggct ttgggcattc 7080

tcattggagt tttgttttga agaaagcata tgtttcgatc aagccaatca ggcaaaacag 7140

tgcgaattgt tgatgtgcca aactgccaaa attgttgatt ccgttttact attacttcct 7200

atttgtttcc aaattctttg tttcaaagat tttttttttc cgatttacat gaatacgtgc 7260

atatacttag gtactctgta tttggttgga tccaaagggg aagcagtttg ccaaatttta 7320

cggagcaaac tcaaattcct tttggctaat gcaaaccaag ttaaaataca agtcagttgg 7380

aggaaaacca cttcccgccc actgcaccgt cgccgaggtt gcataaaaga aagcacaaca 7440

aagaggaaga agaggagaag ccgagcaaga aatagagcca agaaagagag agaaaccgca 7500

cccaaaatct ccccaactct ctctacgcaa ttccactctt caaaaccacc catcaacaaa 7560

accaaatcca agaatcgatc cagcgatcga tggagtcgtc gtcgtcgtcg gtcatcttcc 7620

tgggcaccgg ctgctccggc gcgctccccg acgcccggtg cctcatccac ccgtccacgc 7680

cgccgtgccc cgtctgctcc cagtccctct ccctcccgcc ggagcgaaac cccaattaca 7740

ggtgtgctct ttgctcgccg ccgctgcagt ccagtcaacc gccccatctt tacatgattt 7800

cgttcctttc ttctttttct ttctctcgtt ccgtcagacg atgccgttac agaagaattg 7860

ctcgtttgca aatagtgaaa tttctcctga attgaccgac aatttatcgt taaatgttgt 7920

attagaattc agagcattct ttcagtgctg ttcaagtgtt cagtagtccg tgctgtaatg 7980

acctcctctc tgaactctga agtgtctatt taccattgtt acgcggtgct acagtgtgct 8040

gtttatctac gatgaaaatt tgaccaatcc agtaatgctg ttggtatgac ttgaaatatg 8100

attccaaagt agttactgca tcaaaaagta caatggaaaa ttgcattaca aattagttgt 8160

catctctata tgtaaacaat gccttcatac agcaacactc ttgtctgctt ttaggtgtaa 8220

cacctccctc ttgatagatt actgccaaca tgatggaatc cataagtaca ttctaatcga 8280

tgtcggcaag acgtttaggg aacaagtcct tcggtggttt tctcaccaca agattcctta 8340

tgttgattcg gtgagatctc acttactgca ctgtccattt tcaatctatt acaaatgatg 8400

atgatcaatt catatagatg gcatgactga taaggttcag tgcattgcag attattctca 8460

ctcatgaaca cgcggatgct gtcttaggtc ttgatg 8496

<210> 2

<211> 1401

<212> DNA

<213>long-grained nonglutinous rice (Oryza sativa Indica)

<400> 2

atggcggcgg cgctggtgag gcggagcggc gcggggctgg cgcgggggag ggggatgtgc 60

tcggccacgg cggcagagcg cgcggcgctg acgtccgagg agctcatgcg gatggagcgc 120

gagcgcagcg cgcacaacta tcatccaatt ccggtggtgt tctccaaggg agaaggttca 180

catatattgg atcctgaagg caacaaatac attgatttcc tgtctgctta ttctgcagtc 240

aatcagggcc attgccatcc aaaagtcctg agagcgttga aagatcaggc agaaaggctc 300

acactgagtt ctagagcttt ctacaatgac aaattcccaa tctttgcgga atacctgact 360

agcatgtttg gatatgaaat gatgttgccg atgaatactg gagctgaagg agtggaaaca 420

gctatcaaat tggtgaggaa atggggttat gagaagaaaa agataccaaa aaatgaggct 480

ttgattgtct cttgctgtgg atgttttcat ggtcggacat taggtgtcat ctctatgagt 540

tgtgataatg atgcaactcg tggttttggc ccattggttc ctggccatct taaagttgat 600

tttggagaca ttgatgggtt ggagaaaatc tttaaagagc atggcgagag gatatgtggt 660

tttttgtttg aaccaatcca aggagaagct ggggtaataa tcccaccaga cggctatttg 720

aaagctgtca gagatttgtg ttcaaggcac aacattctga tgattgcaga tgagatccaa 780

acaggcatag ctagaactgg caaaatgctg gcatgcgatt gggaaaacat acgacctgat 840

gtggtgattc taggcaaggc ccttggtgct ggagtagttc ctgtcagtgc ggttcttgca 900

gataaggata ttatgctgtg tatcaaacca ggagaacatg gaagtacatt tggtgggaac 960

ccattggcaa gtgctgtggc agttgcatcg ctgaaagtag ttacagatga aggtctcgtt 1020

gaaagggctg caaagttagg acaagagttc agagatcagc tacagaaggt tcaacagaga 1080

ttcccgcaaa tcataaggga agtacgtggg aggggtttgc ttaatgcagt ggatctaagc 1140

aacgaagctt tgtcccctgc ttctgcttac gacatctgca tcaagctgaa ggagagaggc 1200

gttctggcaa agcccacaca tgacaccata atcagattag cgcctccgct gtcaatcagt 1260

cctgaggagc ttgcagaagc atcgaaggcg ttcagcgatg tgcttgagca tgacctgcca 1320

cagctgcaga agcagatcaa gaagacagaa tccgcggcag aaaaacaatc ctgtgacaga 1380

tgcggcagag acttgtactg a 1401

<210> 3

<211> 466

<212> PRT

<213>long-grained nonglutinous rice (Oryza sativa Indica)

<400> 3

Met Ala Ala Ala Leu Val Arg Arg Ser Gly Ala Gly Leu Ala Arg Gly

1 5 10 15

Arg Gly Met Cys Ser Ala Thr Ala Ala Glu Arg Ala Ala Leu Thr Ser

20 25 30

Glu Glu Leu Met Arg Met Glu Arg Glu Arg Ser Ala His Asn Tyr His

35 40 45

Pro Ile Pro Val Val Phe Ser Lys Gly Glu Gly Ser His Ile Leu Asp

50 55 60

Pro Glu Gly Asn Lys Tyr Ile Asp Phe Leu Ser Ala Tyr Ser Ala Val

65 70 75 80

Asn Gln Gly His Cys His Pro Lys Val Leu Arg Ala Leu Lys Asp Gln

85 90 95

Ala Glu Arg Leu Thr Leu Ser Ser Arg Ala Phe Tyr Asn Asp Lys Phe

100 105 110

Pro Ile Phe Ala Glu Tyr Leu Thr Ser Met Phe Gly Tyr Glu Met Met

115 120 125

Leu Pro Met Asn Thr Gly Ala Glu Gly Val Glu Thr Ala Ile Lys Leu

130 135 140

Val Arg Lys Trp Gly Tyr Glu Lys Lys Lys Ile Pro Lys Asn Glu Ala

145 150 155 160

Leu Ile Val Ser Cys Cys Gly Cys Phe His Gly Arg Thr Leu Gly Val

165 170 175

Ile Ser Met Ser Cys Asp Asn Asp Ala Thr Arg Gly Phe Gly Pro Leu

180 185 190

Val Pro Gly His Leu Lys Val Asp Phe Gly Asp Ile Asp Gly Leu Glu

195 200 205

Lys Ile Phe Lys Glu His Gly Glu Arg Ile Cys Gly Phe Leu Phe Glu

210 215 220

Pro Ile Gln Gly Glu Ala Gly Val Ile Ile Pro Pro Asp Gly Tyr Leu

225 230 235 240

Lys Ala Val Arg Asp Leu Cys Ser Arg His Asn Ile Leu Met Ile Ala

245 250 255

Asp Glu Ile Gln Thr Gly Ile Ala Arg Thr Gly Lys Met Leu Ala Cys

260 265 270

Asp Trp Glu Asn Ile Arg Pro Asp Val Val Ile Leu Gly Lys Ala Leu

275 280 285

Gly Ala Gly Val Val Pro Val Ser Ala Val Leu Ala Asp Lys Asp Ile

290 295 300

Met Leu Cys Ile Lys Pro Gly Glu His Gly Ser Thr Phe Gly Gly Asn

305 310 315 320

Pro Leu Ala Ser Ala Val Ala Val Ala Ser Leu Lys Val Val Thr Asp

325 330 335

Glu Gly Leu Val Glu Arg Ala Ala Lys Leu Gly Gln Glu Phe Arg Asp

340 345 350

Gln Leu Gln Lys Val Gln Gln Arg Phe Pro Gln Ile Ile Arg Glu Val

355 360 365

Arg Gly Arg Gly Leu Leu Asn Ala Val Asp Leu Ser Asn Glu Ala Leu

370 375 380

Ser Pro Ala Ser Ala Tyr Asp Ile Cys Ile Lys Leu Lys Glu Arg Gly

385 390 395 400

Val Leu Ala Lys Pro Thr His Asp Thr Ile Ile Arg Leu Ala Pro Pro

405 410 415

Leu Ser Ile Ser Pro Glu Glu Leu Ala Glu Ala Ser Lys Ala Phe Ser

420 425 430

Asp Val Leu Glu His Asp Leu Pro Gln Leu Gln Lys Gln Ile Lys Lys

435 440 445

Thr Glu Ser Ala Ala Glu Lys Gln Ser Cys Asp Arg Cys Gly Arg Asp

450 455 460

Leu Tyr

465

<210> 4

<211> 11845

<212> DNA

<213>japonica rice (Oryza sativa Japonica)

<400> 4

caaccttgag tgtctcgagt gggactcagg atttatcagc cggcctcccc ttccccctcc 60

tccacaggaa gctgtcgccg ccgctgccgc atgcggtgga gaagagcgtc gcttccgctg 120

ctcgtggtgg gggaggtcgc tgacgccgca tgcaaggaga gaggaagaga aagaagaaag 180

aaagcaagga tagatgatca tatatcttgc gccggggaat gacgacctcc accgcggctc 240

ctagctccac cagccacggc gtcagcggct atggcgggca agctggccgg aggcggaggc 300

tgtgtgagtg gagagcgaga tggggaaatt ttgggtaaaa gagagcgcct gcaagcagag 360

agcggagaga gagagagaga gtgaggggta aaccgcgtcc gcacggggcc cgagctattt 420

tttgccaaat tcgctggtat ggactcccaa atgccaaatg ccaacttggc caaatttaca 480

tagatccaaa acggtaaaaa agtgctaaaa aaagacacaa cttttgttat tttgaaggat 540

gtaaacatgc ccatagtgca ggtaggtcaa aaaggtgttg cagtacaact ctaacaaaaa 600

aaaatgatac taactccgtt tcaggttata agatgtttga cttaggctat atttataata 660

ccaaattaat ttcattaaat caataattga atatattttc ataataaatt tgtcttgggt 720

tgaaaatgtt attatttttt tctacaaact tagtcaaact tgaaacagtt tgactttgat 780

caaagtcaaa acgttttata acctgaaaca gaggtagcag catattttgg tactcttaga 840

aaagtgcttt cggtggagca catggactgt tggagctgga attaaccctt gatcagttgt 900

agcctttgta gtcgatggtg ctccaaggac ttgtttagat gtgtcttatt ttaaaccata 960

ttaatttttt ttaaattggt aaacacgtga atatatttag cttgttacca aacattagta 1020

tagaatttcg gcaacaacaa atttagcata ttgtaccaaa atttagtaat gttgctaatt 1080

tattaaaatt ttagcaatat taaattttaa aagtatttat tttatcagta atatgaacag 1140

gtcccaagcc tagccgaaca aattgatggc accacatttc aatttcagat gctttgtgtt 1200

tcttctgtac gattgtccgg aaaacattgg tgccaccgta cagagcgtcg ctgtgggggc 1260

acacggacca accaaagcag atggcttcgg ctgccacgag ggcccacggc aaccgaacag 1320

gcaggcagcg agcgggggtc tgttcggaac ctgtgttccc aactttccct tttctttttc 1380

cgagcgcacg ctttttaaac ggttaagtag tgtatttttt taaaaatttt tttatactgt 1440

ttaaaaaatt atattgatct atttttttaa aaaatagcaa atacttaatt aatcatgtgg 1500

taatatagac cgcacttttt tccgtgctaa ctacttgtgt tcagaacaca atgttccgaa 1560

tacagttatt aatacgtgat taattaagta cccattaata catgattaat taagtaccat 1620

taatacgtga ttaattaagt atcaattttt ttaaaaataa aataaaataa ttttttaagt 1680

aactttggta tagaaaactt tttagaaaat acaccgctta tgaagagcgt gcgtgcgtac 1740

gtaaaaagac ttcaaacgca gctcgctcag cgtcccgtga tcccgttcgc gtcgtgtaaa 1800

aagactttta actatttgcc actcttacga gcggtgctta acaatttgct attataatca 1860

tatatcatag ataaatatat gagagctcac atgttataga tacgatgtga caaatcgtta 1920

attgagtggc aaatagttaa atttccccgc tgggcgcgac gagcaggcgc cgcaaacgcg 1980

cagcgacgtg tggaaggaga acaagtgggc ccagaaagcc agcagcgaga gggagagccc 2040

cagcaagtca gtgagtgggc cccaccaccg agagtagggt aagagtgaga gtcccacacg 2100

cacacgccca cgcccacgcc cacgcccacg gcccacggcg ctcgctgctt ccgtggcaaa 2160

aacggcagct atcgcccgac ccgaggttag ttagatagga gtagagttaa accccatttc 2220

atcccatccc attccgttgc gaaatttttg cgagctcgcg acgcgaaccc cctacgccgc 2280

agccgcaggc ttcctcttca tctcctcctc ctccagacct ccacgcgagc gtgccccggg 2340

gtggaagcgg aggcggcggc ggctcgagcg caatctggtg gcgtgggggc gcgtcacgat 2400

ggcggcggcg ctggcgaggc gtggcggtgg ggggctggcg cgcgccctgg cgcgggggag 2460

ggggatgtgc tcggccacgg cggcggagcg cgccgccggg gcggcgctga cgtccgagga 2520

gctcatgcgg atggagcgcg agcgcagcgc gcacaagtac ggtttgcccc tcgatctccc 2580

cctccccttt tccttccttc ctcgctctct tgtgctgcga tctctctcac cgtgagtgcc 2640

tgcctgaatg ctcccccctc ctccacggtt cagtccccga ctcgctggtc cggcggatcg 2700

tactcggatc gcgtttcaga ctgagaattc cgcgctcgtg atcgattttt ttcttgctca 2760

ggaattcccc ctttcttcgg ttagtcctct gtttatcttg catagtgccg tgggagaggg 2820

agatcgtatg attacttcct cgaattgggg atgtagaagt agtgtacaac tgatacttgt 2880

acgcgtggga gagggagact gggctcaact cactctcgaa tgttgtttat atcaaggact 2940

aggccacttc tggatactga ccgagtgttg tttaatgttt atcactaagt accatgtcag 3000

cgacattgat ggtgactctg atatgtccca gggagttagt actgctgttg catttggttg 3060

cgataaagac gtctctacta cttgccttgt ctcattggct ggaaattctg aggttctagt 3120

taataagcat agagcaattg aacctctggt tttatttttc acaaattatg caacaagtta 3180

tatgaagctt atgcatatgt ctgggacaaa aggaactttc acctgtcact gcaagccttt 3240

tattttgata ttctagttgc ttcctaacag agcttgaaca ttcacttcct gcagctacca 3300

tccaattccg gtggtgttct ccaagggaga aggttcacat atattggatc ctgaaggcaa 3360

caaatacatt gatttcctgt ctgcttattc tgcagtcaat caggtgattt tttttcctgg 3420

tttgttacat cttgtaattg aatgtctttt ggtcaaaaag cacatattag aaggcaaaca 3480

tgttggtatc cattgtttca gccagcttat atcatttttc ataattgatg tagtttttgc 3540

aattgttgta gggccattgc catccaaaag tcctgagagc gttgaaagag caggcagaaa 3600

ggctcacact gagttctaga gctttctaca atgacaaatt cccaatcttt gcagaatacc 3660

tgacaagcat gtttgggtat gaaatgatgt tgccgatgaa tactggagct gaaggagtgg 3720

aaacagctat caaattggtg aggaaatggg gttatgagaa gaaaaagata ccaaaaaatg 3780

aggtatgatt tcccaaaagc tacatgtttc atttcaacct ggcaatattt ctctccatct 3840

ggccctttgt gttgccatga aggtgcagaa aaatccgagt aagctttgac tagatgatat 3900

ccatattcct tgctttgcat aatgctgctg ctcttaatat tttgctcatt agttggatat 3960

cgttaaagat atcattatct ttatgtaaat ggaagcagaa ttaaatgaaa tagcaaaaca 4020

attcacaaga gttgcctact gtttttcctt actcttaact gtttgattgc tggtgtacaa 4080

tataactata taatatctat gatagtccat attttggcaa atgtatcact taacggcttt 4140

gaaattagag attcattggt acctgttttt tgtgaaatgt tcggtcgtct gcaggctttg 4200

attgtctctt gctgtggatg ttttcatggt cggacattag gtgtcatctc tatgagttgt 4260

gataatgatg caactcgtgg ttttggccca ttggttcctg gccatcttaa agttgatttt 4320

ggagacactg atgggttgga gaaaatcttt aaaggttagc tcatatgttt atttgtagca 4380

accatattct acactatttt tgagtatttg catgttcatg aacgctattt gattcagatc 4440

atggcgagag gatatgtggt tttttgtttg aaccaatcca aggagaagct ggggtatgta 4500

ttttttaagt tactctgtat ttatttttca aaaagttcta gatcgaattc ttgctagttt 4560

tgtattgtgt tgtatagtga tatactgatt ctgatatact actgtataaa gttataaatc 4620

tctaatacaa tttaaaaaaa aaatagttga ctggaagact ttccaaaccc tgcatgatag 4680

tcaatttctt gacttcacat ctaagggtat tactaacaaa tggtatacat ggtttgacac 4740

ctgttccagc ctaatttcca tgatatgttt ttaagccatt tacagatact caggtaattt 4800

gattaattca atttagaaac atggaactag agattggtcc taaagcactt ttcaagttaa 4860

ggtggtaaac tagaatgggg ctatattgat aactaaagca tgtgctgtat actctagcca 4920

ttgtgctact tgtatccata ttttttgtta ttctcatcag cttgtgatat cctcgtgtta 4980

aaaattccac aaacctactg ctcacaggta ataatcccac cagatggcta tttgaaagct 5040

gtcagagatt tgtgttcaag gcacaacatt ctgatgattg cagatgagat ccaaacaggc 5100

atagctagaa ctggcaaaat gctggcatgc gattgggaaa acatacgacc tgatgtggtg 5160

gtaagtttct agtttctgct acactgttta acctcttctt actgcacaac gacactagta 5220

tctatccgct gggagttttt atttgctgga gaatattcag ctacaatgtt gatcaagtat 5280

ctccactgtt cagattctag gcaaggccct tggtgctgga gtagttcctg tcagtgcggt 5340

tcttgcagat aaggatatta tgctgtgtat caaaccagga gaacatggaa ggtatgggcc 5400

attttcaatc cttctctttt ggttcactcc aacaaggagt taaattgtga actaattcag 5460

ttctttaatc aagcattaat gtctgtgcaa tgccctagtt tttcttttcc agtgtataac 5520

atttttgcta cttttagata agcaagtttt ttgcttcccc ccccctcttt cttgatcagt 5580

cttatgtttg atccctgtca gtacatttgg tgggaaccca ttggcaagtg ctgtggcagt 5640

tgcatcactg aaagtagtta cagatgaagg tctcgttgaa aggtacattg ttttgttgca 5700

agagaaatat tgttatttcc tataacatca gctgtttcat gattcagctg tatgattgtt 5760

tatgagtatc tttcttctaa acatttactg aactacaggg ctgcaaagtt aggacaagag 5820

ttcagagatc agctacagaa ggttcaacag agattcccgc aaatcataag ggaagtacgt 5880

gggaggggtt tgcttaatgc agtggatcta agcaacgaag ctttatcccc tgcttctgct 5940

tacgacatct gcatcaagct gaaggagaga ggcgttctgg caaagcccac acatgacacc 6000

ataatcagat tagcgcctcc gctgtcaatc aggtatgtcc tttgctgtta tgtctttatg 6060

gttgtgttag tatcattttt ttagataacg ggcagcgccc ggcctctgca tcataaggtg 6120

aatgcacacg gccaaacaaa gtacaaatag gtacatagac cccggagttt taacaaaatg 6180

atggcacagc caacctaagg attacatcca aataagcaag tttcaaacac gcaagagagg 6240

aaaccaaagt ctacgcttgt aatcttcctc taaaattcca tccctgcttg gaaaagaaat 6300

ccatcacatt ggcttctagc aacatgcatc ctttcttcac catgattcca tcttcttcat 6360

taagcaacaa ggcccattgc ctcgcccagt gtgttcctct gaatattacc tgcataaaag 6420

aattaatttt ggtaccatga aatacctcat catttcggca taaccataac gcccaacata 6480

gcgccccaat acaccccaga aagtgacatc ttagcttagg atgcaaacca ttaagccaac 6540

taccgaaaag atgcgcaaca ctattaggcg gtggaatacc aaaggtaata tgtatagcac 6600

tccaaatata ccttacaata cgacattcaa ggaaaaggtg atgtatgttc tcgttagagc 6660

tacaaaaaca acacttagtg ctacctttcc actttctttt cgccatatta tcttttgtta 6720

acataacgcc cttttgcatg taccacaaga aaatctttat tttcagtgga attctaagtt 6780

tccaaatcaa agatttcctt ggtataatat cttgatacat aatcgccttg tacatagaat 6840

ttaccgaaaa ggttccatct cctttcaacc tccacttgaa cgagtcactt tgttccgaga 6900

ggttaaaaga acagactttt gccactaatt ggtaccaata tcttcggtta tcccctatca 6960

atgccctcct gaacgacaca tttaaaggca gcgtgcttag cacccctgct acacttacat 7020

tccttctcct aaccaacgaa taaagtgtgg ggaaaacttt gtcgaaagac gtatccccac 7080

accaacagtc ctcccaaaac cttacttgtg tcccatcatg aactacccaa gatctgaaag 7140

aaaggaagtc cctcttaacc tccatgagtc ctccccaaaa gtgtgagtct cctggactcc 7200

tttctacctg ggttatagtc ttatttgaca agtatttcct tctaagcaag gtttgccaca 7260

ccccttcctc gtttatcaat tggaacaacc atttgcttag caaacatcta ttctgtgttt 7320

ccaagttttg gattccgagg ccaccacact ccttagggct acataaaaca ctccatttgg 7380

ccaacctata cttcttctta ttctcatcac actgccaaaa gaacctggac ctataatagt 7440

ctagcttctt aagtataccc ttaggtatct caaaaaaaga gagcatgaac atggccaaac 7500

tactcaaaac cgaattaatc aagaccaacc tccctcctac cgacaagtgt ttccctttcc 7560

agctacttag ttttttctgg aatctatcct caatagcctg ccaatccttg tttgagattc 7620

tcttatgatg cattgggata cctagatatt taaatggata ctttcccata tcacacccaa 7680

aattctttac gtaatccatc atcacttcat ttgccttacc aaaacaaaaa agctcacttt 7740

tatgaaagtt gatcttaagc ccagataatt tctcaaaggt gcttagcact aacttgagat 7800

tcctggcctc ctctagatca tgctccataa agaggatagt atcatctgcg tactgcagaa 7860

ttgagagccc atcgtctaca agatatggaa cgagtccacg aattttcttt tgctcattcg 7920

ccctgtgcat tagcaatgct aacatatcag ccactaggtt aaagagtatt ggagacaacg 7980

gatccccttg tctaagccct tcttttgttt gaaaaaagtt ttccatatcc tcgttcacct 8040

tcacagctac actccctcct ctcacaatca tatcaatcca ttcacaccac tttggagaga 8100

agcctttcat cttcaaagtt tgttgcagaa acctccaatc aactttatca tacgccttct 8160

caaaatctag tttcaagata actccgtctc ttcttttcct atggatctca tgaattgttt 8220

catgtaaaat tactacccct tccataatgt ttctccctgg caagaaggct gtctgtgatg 8280

gtctaataac cttttgagct actagagcta ctctattggc tatgacctta gtaaaaatct 8340

taaaactcac attcaaaaga caaattggtc tatattgttg aatctttctt gcttcctctt 8400

gcttcggtaa cagagtgatg atgccaaagt ttaggctatg aaggggtaac ttcatatcat 8460

gaaagtcatg aaacatagcc atgagatcat ccttaattac atgccagaac acttgataga 8520

actctgccgg aaaaccatct ggtcccggcg ccttattatg tccatttgaa agatggcctc 8580

ttttacttcg tcatctgaaa aactttttgt taacacttca ttttcttctt ccgaaacctg 8640

aggaatgtcc tctctttgcg attccatcaa ggaaaagtta tttcccactg gagccccaaa 8700

caggtcttta taaaatttgg tgatatactt cttaatttgt acatcccctc tgattactcc 8760

ttcctcctgt tccagctgaa aaatcctagt cttcctatgc tttccatttg ctatcaaatg 8820

gtagtatttc gtgtttcgat ccccttctaa gattcgcttt gtttttgccc tttgaagcca 8880

cttaatttcc tcttccctca gcaaaaaaga tagcctctgt ttcacataat tttttaggtc 8940

caactcctgt ctagacagta attgagactc cgccttctta tctagctctt ccactttcgc 9000

gattagaata gccttttcct ttttataagc tccattaatg ttcttagccc atcctctcaa 9060

aaactgtctc aacctcctaa tcttattttg ccatttctct aacttggtcg accctctact 9120

ttcctttctc caaacctctg tgaccaattc tagaaaacct tctcttaaca accaccctag 9180

ctcaaactta aaaagcggtt gtttatttcc ttgagtcccc gatccagtat ccaacaaaag 9240

tggcgtgtga tcagagaact ctctattcag tgctctaaca gtagcaagtg gaaatcttag 9300

ttcccattct gtactggtaa gcaccctatc taatttttca aatgttggat tttgcataga 9360

gcttgcccaa gtgaacttgc gaccagatag ttctaactct ctcaagttaa cactgtcaat 9420

gaccacatta aataaaaatg gccacttgtc attgtaccta tcattatttt tctcactagg 9480

atttctaatg atattgaaat cccctcccac caacaatgga cacggttctt tattacatgc 9540

attcaccaac tccactaaga agtcctcttt gaattcctcc tgagcagctc catagactgc 9600

cacaagaatc cactgaaagc catcctcctt atttctcaca tgaaacttga cataaaactc 9660

tccctcatca attgaagcca cctccataac ctctaagtta attcctaaga gaatcccatc 9720

agacctacct ctcggtatgt tcaataaagt tttgttttgt tttttttgtt ttgttttttt 9780

tgcggtaatg gctaaaaatc ctcttaattt cagtcctgag gagcttgcag aagcatcgaa 9840

ggcgttcagc gatgtgcttg agcatgacct gccacagctg cagaagcaga tcaagaagac 9900

agaatccgcg gcagaaaaac aatcctgtga cagatgcggc agagacttgt actgatgagt 9960

gatagacgag acaatgaaac gtttccagag gcacccgttt cgcccaaata aaatagcaga 10020

acacacctcg cgaattcata gctcattgta gtagtagagt aggatatata cacctccttg 10080

ttgcgatgtc tgggacatat ggtccaggga tttgtcgcct aatcgagctg gttgcaaaca 10140

aatggggtag cattattcta gtctatcata tcatgcagaa gaatcttgaa ttggatgaaa 10200

tcggtcgatt ttatctacat cttcgttatt tgcattatat atatatatat atatatatat 10260

atatatatat atatatatat atattccttt ttcattttgg catctgtttg cacatagtag 10320

ttgtttctgt tagtgagatc caccgccgcg caaagctgcg gtgacgaaga tcccggcgac 10380

gaacgctagc tgtactggac ctgcaaaaca agatgagccg gccggtgccg gaatagcatc 10440

aacatccgcg accagctgct gcggagcacg ccgcatcggt gtgtaagatg cgaatattag 10500

ggaatgatct aatatcaaat gattaggaga agtgaggttt tagaatccag gttatctagt 10560

ccatcatctt gcgcagctag ctggaaaacc taagggcgtt tctcgaaggg ctaatttgca 10620

atggcatgga tcaaattaac cctttctcaa accgcgtcgg tgtgcctcca gttggccatc 10680

atcgtcgacg acaccacaca ccggcgtcgc gtcgttcacc ggccgggcgt tcgcctggcc 10740

acgaccacga atccacgatg cttcggctgc gtgacttgca tgtgggcata tagctagcaa 10800

gtttagttat tgaaacatac ttgatccctc cgggcattaa taggagtacg atgcaattga 10860

cactgctggc ttcgggcatt ctcgttggag ttatgttctg aagaaagcat atgtttcgat 10920

caagccaatc aggcaaaaca gtgcgaattg ttgatgcgga aatgctactg agcgagatcg 10980

ccctcgctcg cccagggcga tcgattcccc ccctcctccc cctccctgcc tccacctagt 11040

tccctttttt tggcaccgta ttacttttct attttagtaa atttatgcac ctaaagttta 11100

taaacctcaa ctttatacat ctaaagttta gagactaaaa gtttataagt gaaaagttta 11160

tatttccgat tcaaatttga atttgaattt aaatattttt tatatatagt atttctatac 11220

atctaaagtt tatacaccta aagtttatag acctaaagtt tatatatccg attcaaattt 11280

gaatttgaat tcaaatattt ttcatatata gtatttctat acatttaaag ttgatacacc 11340

taaagtttat agacctaaag tttatatacc cgattcaaat ttgaatttga attatatccg 11400

atttaaattt gaatttgaat tcaaatattt tatatatata gtatttctat acatctaaag 11460

tttatagatc caaagtttat aagtcaaaag tttacatacc tgattcaaat ttgaatttga 11520

attcaaattt tttatacata aatttttcta actttttgtt ttttttaaat tttttttgtg 11580

gtgtattgta atagaaagag aagaagaaga ggaggaaggg gagaagtggg aggagtgcct 11640

atagggggag cagggggccg gatccgatcg cccattaggc cccccttgtt gatgtgccaa 11700

actgccaatg ttgcatacga ggaaaggtgt ccttttgcaa ggtatttggt tgatttcgtt 11760

ttaccactac ttcctatcct atttggtaaa atctaattcg cgcgcgctct ctattttgcc 11820

ttatcacgca acacgctcat cggcc 11845

<210> 5

<211> 1422

<212> DNA

<213>japonica rice (Oryza sativa Japonica)

<400> 5

atggcggcgg cgctggcgag gcgtggcggt ggggggctgg cgcgcgccct ggcgcggggg 60

agggggatgt gctcggccac ggcggcggag cgcgccgccg gggcggcgct gacgtccgag 120

gagctcatgc ggatggagcg cgagcgcagc gcgcacaact accatccaat tccggtggtg 180

ttctccaagg gagaaggttc acatatattg gatcctgaag gcaacaaata cattgatttc 240

ctgtctgctt attctgcagt caatcagggc cattgccatc caaaagtcct gagagcgttg 300

aaagagcagg cagaaaggct cacactgagt tctagagctt tctacaatga caaattccca 360

atctttgcag aatacctgac aagcatgttt gggtatgaaa tgatgttgcc gatgaatact 420

ggagctgaag gagtggaaac agctatcaaa ttggtgagga aatggggtta tgagaagaaa 480

aagataccaa aaaatgaggc tttgattgtc tcttgctgtg gatgttttca tggtcggaca 540

ttaggtgtca tctctatgag ttgtgataat gatgcaactc gtggttttgg cccattggtt 600

cctggccatc ttaaagttga ttttggagac actgatgggt tggagaaaat ctttaaagat 660

catggcgaga ggatatgtgg ttttttgttt gaaccaatcc aaggagaagc tggggtaata 720

atcccaccag atggctattt gaaagctgtc agagatttgt gttcaaggca caacattctg 780

atgattgcag atgagatcca aacaggcata gctagaactg gcaaaatgct ggcatgcgat 840

tgggaaaaca tacgacctga tgtggtgatt ctaggcaagg cccttggtgc tggagtagtt 900

cctgtcagtg cggttcttgc agataaggat attatgctgt gtatcaaacc aggagaacat 960

ggaagtacat ttggtgggaa cccattggca agtgctgtgg cagttgcatc actgaaagta 1020

gttacagatg aaggtctcgt tgaaagggct gcaaagttag gacaagagtt cagagatcag 1080

ctacagaagg ttcaacagag attcccgcaa atcataaggg aagtacgtgg gaggggtttg 1140

cttaatgcag tggatctaag caacgaagct ttatcccctg cttctgctta cgacatctgc 1200

atcaagctga aggagagagg cgttctggca aagcccacac atgacaccat aatcagatta 1260

gcgcctccgc tgtcaatcag tcctgaggag cttgcagaag catcgaaggc gttcagcgat 1320

gtgcttgagc atgacctgcc acagctgcag aagcagatca agaagacaga atccgcggca 1380

gaaaaacaat cctgtgacag atgcggcaga gacttgtact ga 1422

<210> 6

<211> 473

<212> PRT

<213>japonica rice (Oryza sativa Japonica)

<400> 6

Met Ala Ala Ala Leu Ala Arg Arg Gly Gly Gly Gly Leu Ala Arg Ala

1 5 10 15

Leu Ala Arg Gly Arg Gly Met Cys Ser Ala Thr Ala Ala Glu Arg Ala

20 25 30

Ala Gly Ala Ala Leu Thr Ser Glu Glu Leu Met Arg Met Glu Arg Glu

35 40 45

Arg Ser Ala His Asn Tyr His Pro Ile Pro Val Val Phe Ser Lys Gly

50 55 60

Glu Gly Ser His Ile Leu Asp Pro Glu Gly Asn Lys Tyr Ile Asp Phe

65 70 75 80

Leu Ser Ala Tyr Ser Ala Val Asn Gln Gly His Cys His Pro Lys Val

85 90 95

Leu Arg Ala Leu Lys Glu Gln Ala Glu Arg Leu Thr Leu Ser Ser Arg

100 105 110

Ala Phe Tyr Asn Asp Lys Phe Pro Ile Phe Ala Glu Tyr Leu Thr Ser

115 120 125

Met Phe Gly Tyr Glu Met Met Leu Pro Met Asn Thr Gly Ala Glu Gly

130 135 140

Val Glu Thr Ala Ile Lys Leu Val Arg Lys Trp Gly Tyr Glu Lys Lys

145 150 155 160

Lys Ile Pro Lys Asn Glu Ala Leu Ile Val Ser Cys Cys Gly Cys Phe

165 170 175

His Gly Arg Thr Leu Gly Val Ile Ser Met Ser Cys Asp Asn Asp Ala

180 185 190

Thr Arg Gly Phe Gly Pro Leu Val Pro Gly His Leu Lys Val Asp Phe

195 200 205

Gly Asp Thr Asp Gly Leu Glu Lys Ile Phe Lys Asp His Gly Glu Arg

210 215 220

Ile Cys Gly Phe Leu Phe Glu Pro Ile Gln Gly Glu Ala Gly Val Ile

225 230 235 240

Ile Pro Pro Asp Gly Tyr Leu Lys Ala Val Arg Asp Leu Cys Ser Arg

245 250 255

His Asn Ile Leu Met Ile Ala Asp Glu Ile Gln Thr Gly Ile Ala Arg

260 265 270

Thr Gly Lys Met Leu Ala Cys Asp Trp Glu Asn Ile Arg Pro Asp Val

275 280 285

Val Ile Leu Gly Lys Ala Leu Gly Ala Gly Val Val Pro Val Ser Ala

290 295 300

Val Leu Ala Asp Lys Asp Ile Met Leu Cys Ile Lys Pro Gly Glu His

305 310 315 320

Gly Ser Thr Phe Gly Gly Asn Pro Leu Ala Ser Ala Val Ala Val Ala

325 330 335

Ser Leu Lys Val Val Thr Asp Glu Gly Leu Val Glu Arg Ala Ala Lys

340 345 350

Leu Gly Gln Glu Phe Arg Asp Gln Leu Gln Lys Val Gln Gln Arg Phe

355 360 365

Pro Gln Ile Ile Arg Glu Val Arg Gly Arg Gly Leu Leu Asn Ala Val

370 375 380

Asp Leu Ser Asn Glu Ala Leu Ser Pro Ala Ser Ala Tyr Asp Ile Cys

385 390 395 400

Ile Lys Leu Lys Glu Arg Gly Val Leu Ala Lys Pro Thr His Asp Thr

405 410 415

Ile Ile Arg Leu Ala Pro Pro Leu Ser Ile Ser Pro Glu Glu Leu Ala

420 425 430

Glu Ala Ser Lys Ala Phe Ser Asp Val Leu Glu His Asp Leu Pro Gln

435 440 445

Leu Gln Lys Gln Ile Lys Lys Thr Glu Ser Ala Ala Glu Lys Gln Ser

450 455 460

Cys Asp Arg Cys Gly Arg Asp Leu Tyr

465 470

<210> 7

<211> 1401

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 7

atggcggcgg cgctggtgag gcggagcggc gcggggctgg cgcgggggag ggggatgtgc 60

tcggccacgg cggcagagcg cgcggcgctg acgtccgagg agctcatgcg gatggagcgc 120

gagcgcagcg cgcacaacta tcatccaatt ccggtggtgt tctccaaggg agaaggttca 180

catatattgg atcctgaagg caacaaatac attgatttcc tgtctgctta ttctgcagtc 240

aatcagggcc attgccatcc aaaagtcctg agagcgttga aagatcaggc agaaaggctc 300

acactgagtt ctagagcttt ctacaatgac aaattcccaa tctttgcgga atacctgact 360

agcatgtttg gatatgaaat gatgttgccg atgaatactg gagctgaagg agtggaaaca 420

gctatcaaat tggtgaggaa atggggttat gagaagaaaa agataccaaa aaatgaggct 480

ttgattgtct cttgctgtgg atgttttcat ggtcggacat taggtgtcat ctctatgagt 540

tgtgataatg atgcaactcg tggttttggc ccattggttc ctggccatct taaagttgat 600

tttggagaca ttgatgggtt ggagaaaatc tttaaagagc atggcgagag gatatgtggt 660

tttttgtttg aaccaatcca aggagaagct ggggtaataa tcccaccaga cggctatttg 720

aaagctgtca gagatttgtg ttcaaggcac aacattctga tgattgcaga tgagatccaa 780

acaggcatag ctagaactgg caaaatgctg gcatgcgatt gggaaaacat acgacctgat 840

gtggtgattc taggcaaggc ccttggtgct ggagtagttc ctgtcagtgc ggttcttgca 900

gataaggata ttatgctgtg tatcaaacca ggagaacatg gaagtacatt tggtgggaac 960

ccattggcaa gtgctgtggc agttgcatcg ctgaaagtag ttacagatga aggtctcgtt 1020

gaaagggctg caaagttagt acaagagttc agagatcagc tacagaaggt tcaacagaga 1080

ttcccgcaaa tcataaggga agtacgtggg aggggtttgc ttaatgcagt ggatctaagc 1140

aacgaagctt tgtcccctgc ttctgcttac gacatctgca tcaagctgaa ggagagaggc 1200

gttctggcaa agcccacaca tgacaccata atcagattag cgcctccgct gtcaatcagt 1260

cctgaggagc ttgcagaagc atcgaaggcg ttcagcgatg tgcttgagca tgacctgcca 1320

cagctgcaga agcagatcaa gaagacagaa tccgcggcag aaaaacaatc ctgtgacaga 1380

tgcggcagag acttgtactg a 1401

<210> 8

<211> 466

<212> PRT

<213>artificial synthesized (artificial synthesis)

<400> 8

Met Ala Ala Ala Leu Val Arg Arg Ser Gly Ala Gly Leu Ala Arg Gly

1 5 10 15

Arg Gly Met Cys Ser Ala Thr Ala Ala Glu Arg Ala Ala Leu Thr Ser

20 25 30

Glu Glu Leu Met Arg Met Glu Arg Glu Arg Ser Ala His Asn Tyr His

35 40 45

Pro Ile Pro Val Val Phe Ser Lys Gly Glu Gly Ser His Ile Leu Asp

50 55 60

Pro Glu Gly Asn Lys Tyr Ile Asp Phe Leu Ser Ala Tyr Ser Ala Val

65 70 75 80

Asn Gln Gly His Cys His Pro Lys Val Leu Arg Ala Leu Lys Asp Gln

85 90 95

Ala Glu Arg Leu Thr Leu Ser Ser Arg Ala Phe Tyr Asn Asp Lys Phe

100 105 110

Pro Ile Phe Ala Glu Tyr Leu Thr Ser Met Phe Gly Tyr Glu Met Met

115 120 125

Leu Pro Met Asn Thr Gly Ala Glu Gly Val Glu Thr Ala Ile Lys Leu

130 135 140

Val Arg Lys Trp Gly Tyr Glu Lys Lys Lys Ile Pro Lys Asn Glu Ala

145 150 155 160

Leu Ile Val Ser Cys Cys Gly Cys Phe His Gly Arg Thr Leu Gly Val

165 170 175

Ile Ser Met Ser Cys Asp Asn Asp Ala Thr Arg Gly Phe Gly Pro Leu

180 185 190

Val Pro Gly His Leu Lys Val Asp Phe Gly Asp Ile Asp Gly Leu Glu

195 200 205

Lys Ile Phe Lys Glu His Gly Glu Arg Ile Cys Gly Phe Leu Phe Glu

210 215 220

Pro Ile Gln Gly Glu Ala Gly Val Ile Ile Pro Pro Asp Gly Tyr Leu

225 230 235 240

Lys Ala Val Arg Asp Leu Cys Ser Arg His Asn Ile Leu Met Ile Ala

245 250 255

Asp Glu Ile Gln Thr Gly Ile Ala Arg Thr Gly Lys Met Leu Ala Cys

260 265 270

Asp Trp Glu Asn Ile Arg Pro Asp Val Val Ile Leu Gly Lys Ala Leu

275 280 285

Gly Ala Gly Val Val Pro Val Ser Ala Val Leu Ala Asp Lys Asp Ile

290 295 300

Met Leu Cys Ile Lys Pro Gly Glu His Gly Ser Thr Phe Gly Gly Asn

305 310 315 320

Pro Leu Ala Ser Ala Val Ala Val Ala Ser Leu Lys Val Val Thr Asp

325 330 335

Glu Gly Leu Val Glu Arg Ala Ala Lys Leu Leu Gln Glu Phe Arg Asp

340 345 350

Gln Leu Gln Lys Val Gln Gln Arg Phe Pro Gln Ile Ile Arg Glu Val

355 360 365

Arg Gly Arg Gly Leu Leu Asn Ala Val Asp Leu Ser Asn Glu Ala Leu

370 375 380

Ser Pro Ala Ser Ala Tyr Asp Ile Cys Ile Lys Leu Lys Glu Arg Gly

385 390 395 400

Val Leu Ala Lys Pro Thr His Asp Thr Ile Ile Arg Leu Ala Pro Pro

405 410 415

Leu Ser Ile Ser Pro Glu Glu Leu Ala Glu Ala Ser Lys Ala Phe Ser

420 425 430

Asp Val Leu Glu His Asp Leu Pro Gln Leu Gln Lys Gln Ile Lys Lys

435 440 445

Thr Glu Ser Ala Ala Glu Lys Gln Ser Cys Asp Arg Cys Gly Arg Asp

450 455 460

Leu Tyr

465

<210> 9

<211> 2545

<212> DNA

<213>long-grained nonglutinous rice (Oryza sativa Indica)

<400> 9

gagtgtggct tggattttga tggcctcacc tttggcaagt ttagctaata aagtatggta 60

tgtctaggta atgttagtat gtgaaccaaa cagctgctta aacagactaa aacagcatag 120

gccaataaga cgctggggga ggaggttata cggtctaaaa acctatagca gagtggtccc 180

aaccctatca tgtcgctctc gctctcactt cactctctct cctgtactac tcgactactt 240

cgctctcccc atccggcgca agctcacgcc gccgccgacg ccgccgtgca cgagctcccg 300

cggccgccgc cgacgccgcg cgcgagctca cgcggcctgc cgccgacgcc gtgcgcgagc 360

tcacgtggcc gccgccgccg cgtgcgacct cacgcggccg ccgcctccgc cgcgtgcgag 420

ctcactccgc caccgccgtg cgcaagctca cgccgctacc ccacgctagc tgcctcagcc 480

aagcttcctc aggccatgga ggatctggtg cgggctacca ttttagtcct atttagtcat 540

ttcaaccaaa caggctaggg ctaaaaaggc cattttagtc ctattaagtc atttcaacca 600

aacaggctag gacttaaaaa ggactaatgt tttagttttg gggctaaact ttagtcatag 660

gactaatgta tcaaaacacc acctaagtac tactctattt ggcccacaca gacaaggccc 720

aaacaagagc acagatggac cgttgataag caccaggccg aaacaaattc ctccttcccg 780

gcctcggacg agggatatcc ttcgtcgttt gcatgttatt gaaatggtta tgaaaaaaat 840

ttaaaaaatt aagaagatgt attaacatat gatatatcac ttcgtaaaca tgtaagttca 900

aattcaactt ttacatctcg caacgaaaaa aacaaatttg acagtgaata tacgttaagt 960

agctgcagtt taatttgttt ttttcgttac gaggtgtaga agttgaattc gaacttgcat 1020

gtgttgtgga gtgttatatc acatgttaat acatattctt atttttttaa aattttttaa 1080

taactatttg agtgatatgc aaataacgag gggctcttcc ctcgagggat caaaatagtt 1140

cccccttccc ctcatccttt atatattttg gtactctcag aaaagtgctt tcggtggagc 1200

acatggactg ttggagctgg aattaacccc tcgatcagtt gtaacctttg tagtagatgg 1260

tgctccaagg actttttaga ttgatgttat tttaaatcat ataatttttt tgaaaaaatt 1320

gataaacatg tgaatatatt tagtctatta ctaaatattg tatagaattt cggcaacagc 1380

atatttagca tattgtacaa aaatttggta atattgctaa tttatcaaaa ttttagtatt 1440

attaaatttt aaaagtattt attttatgag taatatgaac agatcacaaa ttgatgacac 1500

cacgttacaa tttcagatgc tttgtgtttc tcctctacga ttgtccggaa aactttggtt 1560

gccatcgtcg tagagagcgt cgctgtgggg cacacggacc aaccaaagca catggcttcg 1620

gctgccacga gggccgacgg caaccgaaca ggcaggcagc gagctggggt ctgattgaca 1680

tacatgatta attactacag aactatccat taacatgtgg ttaattaagt attttttttt 1740

aaaatactcc ctcctttcct tgctcgacgc cgttgacttt ttaaaacatg tttaaccatt 1800

tatcttatta aaaactttta tgaaatgtgt aaaactatat gtatacataa aaacatattt 1860

aacaatatat caaatgatat aaacgaacgg tcaaacatat ttttaaaaaa ttcaactacg 1920

tcaaacactt taggatggag ggagtagaat aatataattt tttaaattaa ctttcgtata 1980

gaaaaacttt ttagaaaata caccgtttat gaagagcgtg cgtgcgtaaa aagacttgaa 2040

acgcagctcg ctcacagcgt cccgtgatcc taccgttcgc gtcgcgttgt ggtgtgggcg 2100

cgacgagcag gcgccgcaaa cgcgcaagcg gcgtgtggaa ggagaacaag tgggcccaga 2160

aagccagcag cgagagggag agccccagca agtcagtgag tgggccccac caccgagagt 2220

agggtaagag tgagagtccc acacgcacac gcccacggcc cacggcggcg acggcgctcg 2280

ctgcttccgt ggcaaaaacg gcagctatcg cccgacccga ggttagatta gatagactga 2340

gttaaacccc catttcatcc catcccgttc cattccgttg cgaaaatttt gcgagctcgc 2400

gacgcgaacc cctacgccgc agccgcaggc ttcctcttca tctcctcctc ctcctcctcc 2460

agacctccac gcgagcgtgc cccgggggtg gaagcggagg cggcggcggc tcgagcgcaa 2520

tctggtggcg tgggggcgcg tcacg 2545

<210> 10

<211> 24

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 10

gatcaggcag aaaggctcac actg 24

<210> 11

<211> 24

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 11

gatgttgccg atgaatactg gagc 24

<210> 12

<211> 20

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 12

gctatgtacg tcgccatcca 20

<210> 13

<211> 21

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 13

ggacagtgtg gctgacacca t 21

<210> 14

<211> 40

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 14

taccgagctc ggatccgagt gtggcttgga ttttgatggc 40

<210> 15

<211> 36

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 15

actgcagtgg gaattctcgt gacgcgcccc cacgcc 36

<210> 16

<211> 40

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 16

ccatgattac gaattcgagt gtggcttgga ttttgatggc 40

<210> 17

<211> 40

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 17

ggccagtgcc aagcttcatc aagacctaag acagcatccg 40

<210> 18

<211> 24

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 18

ggcaggaaaa catacgacct gatg 24

<210> 19

<211> 24

<212> DNA

<213>artificial synthesized (artificial synthesis)

<400> 19

aaaccatcag gtcgtatgtt ttcc 24

Claims (12)

1. a kind of method of regulation plant fertility, passes through the fertility for influencing the expression regulation plant of fertile gene, it is characterised in that The nucleotide sequence of the fertile gene is selected from following group of one of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80%(to be preferably at least 85%) sequence similarity with (a)-(c) sequence, and have the function of sterility changing DNA sequence dna；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

2. method described in claim 1, which is characterized in that by being mutated the nucleotide sequence of fertile gene so that the gene table The protein inactivation reached, so that male sterile material is obtained, wherein the nucleotide sequence of the fertile gene is selected from following group One of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80%(to be preferably at least 85%) sequence similarity with (a)-(c) sequence, and have the function of sterility changing DNA sequence dna；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

3. method as claimed in claim 2, wherein the mutation includes carrying out on the nucleotide sequence of sterility changing gene Replace, miss or add one or more nucleotide.

4. method as claimed in claim 3, wherein the mutation by physical mutagenesis, chemical mutagenesis or RNAi, TALEN, The site-directed mutagenesis techniques such as CRISPR-Cas9 obtain.

5. method described in claim 1, it is characterised in that restored with SEQ ID NO:1 or 2 by corresponding SEQ ID NO:1 or Male sterility caused by gene mutation shown in 2 reverts to malesterile mutants fertile.

6. application of any method of claim 1-5 in regulation plant fertility.

7. a kind of application of expression cassette, expression vector and engineering bacteria in regulation plant fertility, it is characterised in that the expression cassette, Expression vector and engineering bacteria include fertile gene, and the nucleotide sequence of the fertile gene is selected from following group of one of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80%(to be preferably at least 85%) sequence similarity with (a)-(c) sequence, and have the function of sterility changing DNA sequence dna；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

8. a kind of preparation method of mutant material, it is characterised in that the mutant material is made by the mutation of fertile gene At the plant containing the nucleotide sequence after the mutation has male sterile phenotype, wherein the nucleotide of the fertile gene Sequence is selected from following group of one of sequence:

(a) nucleotide sequence as shown in SEQ ID NO:1,2,4,5,20,21,23 or 24；

(b) its encoding amino acid sequence nucleotide sequence as shown in SEQ ID NO:3,6,22 or 25；

(c) under high stringency conditions can with (a) or (b) described in sequence DNA hybridization DNA sequence dna；Or

(d) there is at least 80%(to be preferably at least 85%) sequence similarity with (a)-(c) sequence, and have the function of sterility changing DNA sequence dna；Or

(e) DNA sequence dna complementary with any sequence of (a)-(d).

9. method according to any one of claims 8, wherein the mutation is point mutation or DNA missing or insertion mutation, or logical Cross the generation of the gene silencings means such as RNAi, rite-directed mutagenesis.

10. method according to any one of claims 8, wherein the nucleotide sequence after the mutation is as shown in SEQ ID NO:7.

11. the application of any method of claim 8-10 and its mutant material obtained in breeding.

12. application described in claim 11, wherein the breeding refer to it is maternal using mutant plants as sterile line, and it is extensive Multiple system's hybridization, produces hybrid seed.