CN108441499A - Male fertile related gene HT2925 and its application - Google Patents

Male fertile related gene HT2925 and its application Download PDF

Info

Publication number
CN108441499A
CN108441499A CN201710082491.2A CN201710082491A CN108441499A CN 108441499 A CN108441499 A CN 108441499A CN 201710082491 A CN201710082491 A CN 201710082491A CN 108441499 A CN108441499 A CN 108441499A
Authority
CN
China
Prior art keywords
val
ala
gly
leu
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710082491.2A
Other languages
Chinese (zh)
Inventor
袁书婷
严维
唐晓艳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Xingwang Biological Seed Industry Co ltd
Shenzhen Institute of Molecular Crop Design
Original Assignee
Shenzhen Xingwang Biological Seed Industry Co ltd
Shenzhen Institute of Molecular Crop Design
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Xingwang Biological Seed Industry Co ltd, Shenzhen Institute of Molecular Crop Design filed Critical Shenzhen Xingwang Biological Seed Industry Co ltd
Priority to CN201710082491.2A priority Critical patent/CN108441499A/en
Publication of CN108441499A publication Critical patent/CN108441499A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C12N15/8289—Male sterility

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a male fertile related gene HT2925 and its applications, belong to plant biotechnology field, more particularly to plant hybridization breeding method, it is prepared including sterile line propagation and hybrid seed, relates more specifically to a male sterility gene HT 2925 and its mutant and its application in crossbreeding.This research is accounted for by EMS mutagenesis rice varieties Huangs China, screening obtains the malesterile mutants controlled by single recessive nuclear gene, it is named as os2925, preliminary phenotypic evaluation, genetic analysis and genetic background identification are carried out to it, and utilize SIMM methods, in conjunction with HRM and gene sequencing, successfully positions and cloned the male sterility gene.Fertile gene provided by the present invention has important application value in field of plant breeding.

Description

Male fertile related gene HT2925 and its application
Technical field
The invention belongs to plant biotechnology fields, and in particular to plant hybridization breeding method, including sterile line propagation and Prepared by hybrid seed, relate more specifically to a male sterility gene HT-2925 and its mutant and its in crossbreeding Using.
Technical background
Rice is the important cereal crops in China.From the eighties in last century, the hybrid rice based on male sterility Breeding technique greatly improves the per unit area yield of rice, and key effect is played in ensureing China's grain security.Hybrid rice system Kind is to make the process of male parent and sterile line hybridization production hybrid seed with restorer.It is to improve to make produce using crop heterosis The important channel of amount, and crop male sterility is to efficiently use the premise and basis of hybrid vigour.Rice fertility is to influence rice The key factor of yield, can to male sterility and male during crossbreeding in order to improve yield and acquisition hybrid vigour The genetic manipulation educated is a committed step.Cenospecies is produced using male sterile line, the artificial of a large amount of emasculations can not only be saved, Seed costs is reduced, and mixing caused by emasculation is not clean can be reduced, to improve seed purity, gives full play to hybrid The effect of advantage.It the discovery of male sterility of rice and is utilized as increasing rice yield, improves quality, increase resistance and adaptability and carry For excellent introduces a collection, thus there is important application value in plant breeding.
Plants male sterility refers to the genetic phenomenon that normal fertile male gametophyte cannot be generated in sexual reproduction process, Generally existing in extensive flowering plant.Rice is noteworthy characterized by form 6 pieces of heros as model plant, arrenotoky development Stamen, any participation stamen development, archesporium differentiation, meiosis, the mitosis of microspore, pollen, which break up or blooms, to be waited The mutation of journey gene is possible to cause anther development abnormal, eventually leads to male sterility (Ma H.Molecular genetic analysis of microsporogenesis and microgametogenesis in flowering plants.Annual Review of Plant Biology.2005,56:393-434.)。
Male sterility can be divided into cytoplasmic male sterility (cytoplasmic male sterility, CMS) and cell Kernel male sterile (genic male sterility, GMS).The essence of cytoplasmic male sterility is cytoplasmic skeleton and cell The result of own genetic material is transmitted in Matrix attachment region competition.Nuclear male sterility is generated by nuclear gene mutation, and mutant character can Pass through oogamete or andro gamete heredity.Genetic analysis show most of male fertiles be controlled by karyogene (Sunok M, Ki-Hong J,Do-Eun L,Dong-Yeon L,Jinwon L,Kyungsook An,Hong-Gyu K,Gynheung An.The rice FON1gene controls vegetative and reproductive development by regulating shoot apical meristem size.Molecules and Cells.2006,21(1):147- 152)。
In recent years, with the completion of Sequencing of Rice Genome, the structure and gene expression spectrum analysis of Rice mutant pool The development of equal work, the molecular mechanism research of pollen development, which rises, to be made some progress, it was found that some control rice Floral organ number of genes, such as FON1~4[, OsLRK1, control pollen bladder cell separate and differentiation gene MSP1, OsTDL1A, Male meiosis gene PAIR1, PAIR2, PAIR3, MEL1, MIL1, DTM1, OsSGO1 etc. are controlled, pollen grain development is promoted Key gene CYP703A3, CYP704B2, WDA1, OsNOP, DPW, Ugp2, MTR1 etc..These genes are related to many aspects, Meiosis, tapetal development and degradation and the formation of pollen cell wall including microsporocyte etc..According to infertility Rice recessive Male sterile gene, can be broadly divided into 3 classes by the difference of the function and regulation and control period of gene：1) microspore is female thin Born of the same parents' developmental stage sterile gene；2) tapetal development period sterile gene；3) pollen bag and exposore developmental stage infertility base Cause.
The most common technology of rice mutant gene cloning has map based cloning, homologous clone, transposons or T-DNA marks at present The technologies such as notation, EST method, difference expression gene clone.With the development of high throughput sequencing technologies, 2012, day This scientist propose based on weight sequencing approach Mutmap gene clone technologies (Abe A, Kosugi S, Yoshida K, Natsume S,Takagi H,Kan-zaki H,Matsumura H,Yoshida K,Mistsuoka C,Muluneh T, Innan H,Cano L,Kamoun S,Teraushi R.Genome sequencing reveals agronomically important loci in rice using MutMap.Nature Biotechnology.2012,30(2):174-178), The technology hybridizes mutant with wild-type parent, generates F2For segregating population, 20-30 mutated individual is taken at random, point Indescribably take genomic DNA, after mixed in equal amounts, using two generation sequencing technologies, binding molecule biology is surveyed with bioinformatic analysis Ordinal number evidence finds out Candidate Mutant gene, substantially reduces the gene cloning time, reduces gene cloning cost.
Up to the present, some key genes for being related to Rice Anther development and pollen formation have been accredited and have studied, this The mutation of a little genes leads to male sterile phenotype.But rice Male Gametophyte Development and regulatory mechanism are not visited completely Bright, positioning and the clone of male sterility of rice gene contribute to the molecular mechanism that Devflopment Ofmle Gametophyte is appreciated more fully, and accelerate The process of breeding is carried out using male sterility strain.
This research is accounted for by EMS mutagenesis rice varieties Huangs China, and screening obtains a hero controlled by single recessive nuclear gene Property sterile mutant, be named as os2925, it is carried out preliminary phenotypic evaluation, genetic analysis and genetic background identification, and profit With SIMM methods (Yan et al., Simultaneous identification of multiple causal Mutations in rice.Frontiers in Plant Science, 2016), in conjunction with HRM and gene sequencing, success It positions and has cloned the male sterility gene.The present invention also illustrates application range and the application side of the male sterility gene Method.
Invention summary
The present invention provides a kind of DNA sequence dna, the DNA sequence dna has the function of plant fertility, which is characterized in that The DNA sequence dna is selected from following group of one of sequence：
A) there is SEQ ID NO：1, nucleotide sequence shown in 4 or 5；
B) there is SEQ ID NO：Nucleotide sequence shown in 10；
C) there is SEQ ID NO：Nucleotide sequence shown in 12；
D) there is SEQ ID NO：14, nucleotide sequence shown in 15,16；
It e) under strict conditions can be with the DNA sequence dna of the DNA hybridization of any sequence of (a)-(d)；Or
F) with the DNA sequence dna of any sequence complementation of (a)-(e).
The amino acid sequence of above-mentioned DNA sequence encoding such as SEQ ID NO：2, shown in 3,6,7,11,13,17,18 or 19.
The present invention also provides a kind of expression cassettes, it is characterised in that the expression cassette includes above-mentioned DNA sequence dna.
The present invention also provides a kind of expression vectors, it is characterised in that the expression vector includes above-mentioned expression cassette.
The present invention also provides a kind of engineering bacterias, it is characterised in that the engineering bacteria includes above-mentioned expression vector.
The present invention also provides a kind of application of gene in plant fertility regulation and control, which is characterized in that the sterility changing The nucleotide sequence of gene is selected from following group of one of sequence：
A) there is SEQ ID NO：1, nucleotide sequence shown in 4 or 5；
B) there is SEQ ID NO：Nucleotide sequence shown in 10；
C) there is SEQ ID NO：Nucleotide sequence shown in 12；
D) there is SEQ ID NO：14, nucleotide sequence shown in 15,16；
It e) under strict conditions can be with the DNA sequence dna of the DNA hybridization of any sequence of (a)-(d)；Or
F) with the DNA sequence dna of any sequence complementation of (a)-(e).
The invention also includes one kind by being mutated sterility changing genes of SEQ ID NO:1, it 4,5,10,12,14,15 or 16 obtains The method for obtaining male sterile material.
Heretofore described " mutation " includes being replaced on the nucleotide sequence of sterility changing gene, lacked or being added Add one or more nucleotide.The mutation can be point mutation, can also be DNA missings or insertion mutation.The mutation It can be obtained by way of mutagenesis or site-directed point mutation, the method for mutagenesis includes being handled with mutagens such as EMS Caused mutagenesis；The method of site-directed point mutation include but not limited to ZFN directed mutagenesis methods, TALEN directed mutagenesis methods, And/or the directed mutagenesis methods such as CRISPR/Cas9.
The present invention also provides a kind of recoveries by corresponding SEQ ID NO:1, gene shown in 4,5,10,12 or 14,15,16 Male sterility caused by mutation, makes malesterile mutants revert to fertile method.
The invention also includes a kind of applications of mutant material, it is characterised in that the mutant material is by nucleotide sequence Mutation caused by, the nucleotide sequence such as SEQ ID NO:1, shown in 4,5,10,12 or 14,15,16.
Above-mentioned " mutation " can be point mutation, can also be DNA missings or insertion mutation, can also be by RNAi, determine The means such as point mutation generate.
The present invention also provides above-mentioned material and DNA sequence dna are applied to the method in breeding, the more specifically described application Refer to hybridizing with restorer using mutant plants as sterile line female parent, producing hybrid seed.
The invention also includes application of the above-mentioned DNA sequence dna in any one of following (a) to (d)：
(a) plant variety or strain are cultivated；
(b) plant variety or strain of the enhancing of Pollination Fertilization ability are cultivated；
(c) plant variety or strain that Pollination Fertilization ability slackens are cultivated；
(d) male sterile plants kind or strain are cultivated.
(method detailed can for the method for the homozygous recessive condition that the present invention also provides a kind of for keeping male sterile plants Refering to PCT Patent PCT/CN2013/086657), the method includes：
A) the first plant is provided, it includes the homozygous recessive alleles of HT2925 genes, and it is male sterile；
B) following constructs are introduced into the first plant, form the second plant, and second plant includes HT2925 genes Homozygous recessive alleles and the construct, and construct is hemizygous condition in the second plant, and the construct includes：
I) the first nucleotide sequence, it includes HT2925 nucleotide sequences, and when being expressed in the first plant, it will restore Male fertility；
Ii) the second nucleotide sequence, when it is expressed, can inhibit in second plant formation of fertile males gamete or Function, specially pollen inactivated gene ZM-PA；And
C) so that first plant is fertilized with the male gamete of second plant, first plant is maintained to generate The offspring of homozygous recessive condition.
Description of the drawings
Fig. 1 is that osht2925 mutant and wild type Huang China account for plant forms.
Fig. 2 is that osht2925 mutant and wild type Huang China account for spike of rice form.
Fig. 3 is that osht2925 mutant and wild type Huang China account for small ear form.
Fig. 4 is that osht2925 mutant and wild type Huang China account for anther form.
Fig. 5 is that osht2925 mutant and wild type Huang China account for pollen staining analysis.
Fig. 6 is that osht2925 mutant and wild type Huang China account for the analysis of anther slices across, and wherein E is epidermis (tables Cortex)；En is endothecium (endodermis)；M is (middle level) middle layer；T is tapetal layer (tapetum)； PMC is pollen mother cell (microsporocyte)；Tds is tetrads (tetrad)；DMs is degenerated Microspores (microspore of degradation)；MP is mature pollen (mature flower powder)；Ms is microspores (small spores Son).
Fig. 7 is that yellow China accounts for Osht2925, osht2925 mutant and the CDS sequence alignment results of Nipponbare Osht2925, Wherein HHZ CDS-1, HHZ CDS-2 indicate that yellow China accounts for two CDS sequences of Osht2925 transcriptions respectively, and Mutant CDS are indicated The CDS sequences of osht2925 mutant Osht2925 transcriptions, Nip CDS-1, Nip CDS-2 are indicated in Nipponbare respectively Two CDS sequences of Osht2925 transcriptions.
Fig. 8 is that yellow China accounts for OsHT2925, osht2925 mutant and the sequence alignment of protein knot of Nipponbare OsHT2925 Fruit, wherein HHZ-1, HHZ-2 indicate that yellow China accounts for two protein sequences of Osht2925 codings respectively, and Mutant indicates osht2925 The protein sequence of mutant Osht2925 codings, Nip-1, Nip-2 indicate two of the codings of the Osht2925 in Nipponbare respectively Protein sequence.
Expression analyses of Fig. 9 Osht2925 in different rice tissue organs.Wherein st6, st7, st8, st9, St10, st11, st12 indicate that the gynoecium of Anther stage and young fringe grain husk flower primordium idiophase, young fringe pollen mother cell subtract successively Number division period, tetrad formation stages, microspore early stage, microspore middle and advanced stage, two spore pollen periods and mature pollen phase.
The transgenic function complementation carrier of Figure 10 rice male sterility mutants (osht2925).
The knockout carrier of Figure 11 Osht2925 genes.
The alignment of homologous gene albumen of Figure 12 Osht2925 genes in Different Crop schemes.Wherein Brachypodium distachyon refer to albumen, the Setaria from two fringe false bromegrass Osht2925 homologous genes encodings Italica refer to from the albumen of millet (millet) Osht2925 homologous genes encodings, Zea mays.1, Zea mays.2, Zea mays.3 refer to the albumen from corn Osht2925 homologous genes encodings.
Detailed description of the invention
All bibliography being mentioned herein all are incorporated herein by reference.
Unless there are indicating on the contrary, all technical and scientific terms used herein all have common with fields of the present invention The identical meaning that technical staff is generally understood.Unless there are indicating on the contrary, technology that is used herein or mentioning is ability Standard technique well known to the those of ordinary skill of domain.Material, method and example are only used as to illustrate, rather than limit.
The present invention includes a kind of fertility-related gene and its nucleotide and protein sequence, further includes being existed by operating the gene Regulate and control the application in plant male fertility.Without limitation for example, any method described below all can be with the present invention The corresponding nucleotide sequence provided is used together, for example, the mutant sequence of the fertile gene is introduced plant to cause Plant male sterility, the antisense sequences for making the mutation of plant endogenous sequence, introducing into plant the sequence, using hair fastener form or It is connected to the phenotype of regulation and control plant with other nucleotide sequences, or is known to the skilled in the art and can be used for shadow Ring the either method in a variety of methods of the male fertility of plant.
Fertile gene HT2925 provided by the present invention is a relevant gene of pollen development.The fertility in rice Gene is located on rice chromosome, such as SEQ ID NO of the nucleotide sequence in long-grained nonglutinous rice：Shown in 1 or 4, amino acid sequence is such as SE Q ID NO:Shown in 2 and 3；Its nucleotide sequence such as SEQ ID NO in japonica rice:Shown in 5, amino acid sequence such as SEQ ID NO:Shown in 6 and 7；The nucleotide sequence of the fertile gene such as SEQ ID NO in two fringe false bromegrass:Shown in 10, amino Acid sequence such as SEQ ID NO:Shown in 11；The nucleotide sequence of the fertile gene such as SEQ ID NO in millet:Shown in 12, Amino acid sequence such as SEQ ID NO:Shown in 13；The nucleotide sequence of the fertile gene such as SEQ ID NO in corn:14、15 Shown in 16, amino acid sequence is successively such as SEQ ID NO:17, shown in 18 and 19.
The malesterile mutants osht2925 obtained in the present invention is due to a single base on OsHT2925 genes It is mutated G..A, causes to encode SEQ ID NO in mutant:The transcript of 2 albumen, First Intron and second exon Shearing site by GT ... AG sports GT ... AA, and then cause in mutant mainly to encode SEQ ID NO:3 transcript In the presence of；For SEQ ID NO:For albumen coded by 3, the 117th amino acid sports A GG (smart ammonia by GGG (glycine) Acid)；Eventually lead to coding such as SEQ ID NO:Albumen shown in 9.
The invention also includes one of following group sequences：A) have at least 90% (preferably with above-mentioned HT2925 gene orders It is at least 95%) sequence similarity, and DNA sequence dna with the same function；It b) under strict conditions can be with sequence described in (a) DNA hybridization DNA sequence dna；C) with the DNA sequence dna of any of the above-described sequence complementation.
Fertile gene described above can be detached from various plants and be obtained.Those skilled in the art should know, of the invention The restoring gene include with HT2925 gene very high homologies, and with same sterility changing function height it is same The function equivalence body sequence in source.The function equivalence body sequence of the very high homology is included under high stringency conditions can be with institute of the present invention The DNA sequence dna of the nucleotide sequence hybridization of disclosed HT2925 genes." high stringency conditions " used in the present invention be it is well known, It is small including hybridizing 12-16 in 60 DEG C such as in the hybridization solution of NaCl containing 400mM, 40mM PIPES (pH6.4) and 1mM EDTA When, then washed 15-60 minutes with the cleaning solution containing 0.1SDS and 0.1%SSC at 65 DEG C.
Function equivalence body sequence further include have at least 90% with sequence shown in HT2925 genes disclosed in this invention, 95%, 96%, 97%, 98% or 99% sequence similarity, and the DNA sequence dna with sterility changing function, can be from any plant It detaches and obtains in object.Wherein, the percentage of sequence similarity can be obtained by well known bioinformatics, including Myers and Miller algorithms (Bioinformatics, 4 (1)：11-17,1988), Needleman-Wunsch overall comparison methods (J.Mol.Biol., 48 (3)：443-53,1970), Smith-Waterman Local Alignments method (J.Mol.Biol., 147：195- 197,1981), Pearson and Lipman similarity-searching (PNAS, 85 (8)：2444-2448,1988), Karlin and Algorithm (Altschul etc., J.Mol.Biol., 215 (3) of Altschul：403-410,1990；PNAS, 90：5873-5877, 1993).This is known to those skilled in the art.
Gene order of the present invention can be detached from any plant and be obtained, including but not limited to Btassica, corn, Wheat, sorghum, two section shepherd's purse categories, sinapsis alba, castor bean, sesame, cottonseed, linseed, soybean, Arabidopsis, Phaseolus, peanut, lucerne Mu, oat, rapeseed, barley, oat, rye (Rye), grain, chinese sorghum, triticale, einkorn, Si Peierte wheats (Spelt), emmer, flax, gramagrass (Gramma grass), friction standing grain, false chinese sorghum, fescue grass, perennial ryegrass, sweet Sugarcane, crowberry, papaya, banana, safflower, oil palm, muskmelon, apple, cucumber, the stem of noble dendrobium, gladiolus, chrysanthemum, Liliaceae, cotton, Eucalyptus, sunflower, rape, beet, coffee, ornamental plant and conifer etc..Preferably, plant include corn and soybean, safflower, leaf mustard, Wheat, barley, rye, rice, cotton and sorghum.
The present invention also provides the nucleotide sequence by influencing HT2925 or the transcriptions by regulating and controlling HT2925 genes Expression is to influence the method for plant fertility.The plant fertility that influences refers to the expression by regulating and controlling HT2925 genes, to So that the fertility of the plant is changed, such as leads to plant male sterility.Specifically, concrete application demand, Ke Yitong are depended on A variety of methods are crossed to influence expression of the HT2925 genes in plant, to achieve the effect that regulate and control plant male fertile.More Specifically, the expression of regulation and control HT2925 genes can use tool obtained by many those of ordinary skill in the art to carry out, example Such as, by mutation, mutagenesis, being transferred to of antisense gene, the introducing etc. of co-suppression or hairpin structure, may be used to destroy HT2925 The normal expression of gene, to obtain male sterile plant.On the other hand, the invention also includes by by wild type HT2925 Nucleotide sequence introduce plant to restore the male fertility of plant that HT2925 expression is destroyed.
The present invention also provides a kind of sterile mutant sequence of HT2925 genes and its malesterile mutants materials.More Specifically, the malesterile mutants material is the OsHT2925 gene endogenous by being mutated rice, or mutation and its height The nucleotide sequence of homologous gene makes the plant lose the process of male fertile." mutation " include but not limited to Lower method, such as the gene mutation caused by method physically or chemically, chemical method includes caused by the processing of the mutagens such as EMS Mutagenesis, the mutation can also be point mutation, can also be DNA missings or insertion mutation, can also be through RNAi, gene The means such as rite-directed mutagenesis generate, and the method for site-directed point mutation includes but not limited to that ZFN directed mutagenesis methods, TALEN fixed points are prominent The directed mutagenesis methods such as change method, and/or CRISPR/Cas9.
Specifically, the present invention also provides a kind of rice male sterility mutants, contain the male sterility base after mutation Cause, the nucleotide sequence such as SEQ ID NO of the male sterility gene after the mutation:Shown in 8, amino acid sequence such as SEQ ID NO:Shown in 9.Compared with wild type, in sterile mutant, a single base mutation G..A of the gene causes in mutant Middle coding SEQ ID NO:The shearing site of the transcript of 2 albumen, First Intron and second exon is by GT ..., and AG is prominent The AA that becomes GT ..., and then cause in mutant mainly to encode SEQ ID NO:3 transcript exists；For SEQ ID NO:3 For coded albumen, the 117th amino acid sports AGG (arginine) by GGG (glycine)；Eventually lead to coding such as SEQ ID NO:Albumen shown in 9.(Fig. 7).Those skilled in the art should know, can be by the nucleotide sequence SEQ ID NO: 8 are building up to plant expression vector, Plant Transformation are carried out, to obtain the malesterile mutants material of new transgenosis.
In addition, the promoter of the present invention can be connected with the nucleotide sequence of not HT2925 genes, it is other heterologous to express Nucleotide sequence.The promoter nucleotide sequence and its segment and variant of the present invention can be assembled in together with heterologous nucleotide sequence In one expression cassette, for being expressed in purpose plant, more specifically, being expressed in the male organs of the plant.The expression Box has suitable restriction enzyme site, for being inserted into the promoter and heterologous nucleotide sequence.These expression cassettes can be used for Genetic manipulation is carried out to any plant, to obtain desired corresponding phenotype.
In some embodiments, the core mentioned in the present invention for being operatively coupled on promoter downstream of the present invention Acid, wherein " nucleic acid " can be operatively connected to structural gene on promoter disclosed herein, adjust base Because of the antisense gene of, structural gene, the tiny RNA that adjusts the antisense gene of gene or can interfere with endogenous gene expression.
The invention also includes the construct containing HT2925 genes and/or its promoter, the construct includes usual institute The carrier or expression cassette said.Promoter in the construct can be natural promoter or substituted promoter, will drive It moves connected nucleotides sequence and is listed in the expression in plant.Promoter in construct can be inducible promoter.When by HT2925 The nucleotide sequence of gene is connected with another promoter, it is preferred that fully driving should in pollen development early stage for the promoter The expression of sequence, for example, can pollen development the P9 phases it is specific expressed.Specifically, the type of workable promoter includes Composing type viral promotors, such as cauliflower mosaic virus (CaMV) 19S and 35S promoter or radix scrophulariae mosaic virus 35 S start Son, or ubiquitin promoter.
Organizing specific expression promoter can be used for targeting enhancing transcription and/or expression in specific plant tissue.Promoter It can express and also be expressed in other plant tissues in targeted tissue, it can strong expression and than other tissues in targeted tissue The much lower expression of degree, or highly preferred can in targeted tissue express.In one embodiment, promoter is preference The specifically expressed type in the male of plant or female tissue.The present invention necessarily uses any specific male in method Type of priority promoter is organized, any in many such promoters well known by persons skilled in the art can use.It retouches herein The natural HT2925 promoters stated are an examples of workable promoter.Another such promoter is 5126 startups Son, MS45 promoters, MS26 promoters, BS92-7 promoters, SGB6 controlling elements and TA29 promoters etc., prefer to instruct Its expression of gene connected in male plant tissue.Can also include that gamete tissue priority expression starts in certain constructs Son.Male gamete priority expression promoter includes PG47 promoters and ZM13 promoters.
It may also include other components in above-mentioned construct, this depends primarily on the purpose and purposes of vector construction, such as can Further comprise selectable marker gene, targeting or regulating and controlling sequence, critical sequences or boot sequence, introne etc..Expression cassette will also It is included in plant at 3 ' ends of desired heterologous nucleotide sequence and has functional transcription and translation terminator.Terminator can be The terminator of gene provided by the present invention can also be the terminator from external source.More specifically, above-mentioned terminator can be rouge Fat propylhomoserin synthase or octopine synthase termination area.
It is desirable that guiding the expression product of heterologous nucleotide sequence into specific cells device, such as plastid, amyloplast, Huo Zheyin To endoplasmic reticulum, or in the case of cell surface or cell exocrine, expression cassette also may include the nucleosides for encoding transit peptides Acid sequence.Such transit peptides be it is known in the art, its include but not limited to the small subunit of Rubisco, plant EPSP synthase, Corn Brittle-1 chloroplast transit peptides etc..
During preparing expression cassette, a variety of DNA fragmentations can be operated, proper orientation is in provide, or DNA sequence dna in correct reading frame.To reach this purpose, adapter or connector can be used, DNA fragmentation is linked up, or Person further comprises other operations, to provide convenient restriction enzyme site etc..
Further, it may also include selectable marker gene in construct provided by the present invention, it is inverted for selecting Cell or tissue.The selectable marker gene includes assigning antibiotic resistance or the gene to Herbicid resistant.Suitable selection Marker gene includes but not limited to:Chloramphenicol resistance gene, hygromycin gene, streptomycin resistance gene, miramycin resistance Gene, sulfamido resistant gene, glyphosate gene, glufosinate-resistant gene.The selectable marker gene can also be red Color fluorogene, cyan fluorescent protein gene, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene, flower The genes such as green glucoside p1.
Expression cassette or carrier provided by the present invention can be inserted into plasmid, clay, yeast artificial chromosome, bacteria artificial dye Colour solid or other be suitble to be transformed into any carrier in host cell.Preferred host cell is bacterial cell, is especially used In cloning or storage polynucleotides or bacterial cell for converting plant cell, for example, Escherichia coli, Agrobacterium tumdfaciens and Agrobacterium rhizogenes.When host cell is plant cell, expression cassette or carrier can be inserted into the base for the plant cell being converted Because in group.Insertion can be positioning or random insertion.Preferably, such as homologous recombination is inserted through to realize.In addition, table It is positively retained at outside chromosome up to box or carrier.The expression cassette or carrier of the present invention may be present in the core, chloroplaset, line of plant cell In plastochondria and/or plastid.Preferably, expression cassette of the invention or carrier are inserted into the chromosomal DNA of plant nucleolus.
The invention also includes the applications of disclosed HT2925 genes and its promoter, in the embodiment of certain applications In, can using HT2925 genes provided by the present invention or its promoter come realize HT2925 or other similar to fertility dependency basis Because being mutated the breeding and holding of obtained male sterile line.
Specifically, it is to turn that the breeding and holding of above-mentioned male sterile line, which refers to homozygous recessive kernel male sterile mutant, Change acceptor material, 3 target genes of close linkage are converted into the sterile mutant recipient plant.3 target bases Because being restoring gene, pollen inactivated gene and screening-gene respectively.Wherein, restoring gene can make infertility conversion by Body fertility restorer, pollen inactivated gene can make the pollen inactivation of the foreign gene containing conversion, that is, lose fertilizing ability, screen base Because can be used for the sorting of transgenic seed and non-transgenic seed, it is miscellaneous that the non-transgenic seed sorted out is used as sterile line production Hand over kind, transgenic seed as maintainer come continuously, steadily produce sterile line.
In the present invention, the pollen inactivated gene includes but not limited to DAM methylases genes, Zea mays α starch The composite sequence of enzyme gene, cytotoxin encoding gene or Barnase and Barstar.The pollen inactivated gene with prefer to The promoter of male gamete expression is connected.More specifically, the promoter for preferring to male gamete expression is selected from poly- galactolipin 47 gene of aldehydic acid enzyme (PG47), Zm13 genes, pectin methylesterase gene, caldesmon gene, actin solution The regulatory region of poly- factor gene, prolfilin genes or sulphated pentapeptide phytosulphokine genes i.e. its promoter region Domain.
Above-mentioned screening-gene includes assigning antibiotic resistance or the gene to Herbicid resistant.Suitable screening-gene includes But it is not limited to:Chloramphenicol resistance gene, hygromycin gene, streptomycin resistance gene, miramycin resistant gene, sulfamido are anti- Property gene, glyphosate gene, glufosinate-resistant gene.The screening-gene can also be that red fluorescent gene, cyan are glimmering The genes such as aequorin, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene, anthocyanin p1.
More specifically, according to one embodiment of present invention, it can be with the recessive infertility ht2925/ht2925 mutation of rice core Body is transformation receptor material, and 3 target genes of close linkage are converted to the sterile line：Wherein, restoring gene OsHT2925 can make transformation receptor fertility restorer；Pollen inactivated gene Zm-PA can be such that the pollen containing foreign gene inactivates, that is, lose Remove fertilizing ability；Fluorescence color sorting gene RFP (r) is used for the sorting of transgenic seed and non-transgenic seed, non-turn sorted out Gene seed is used as sterile line and produces cenospecies, and transgenic seed continuously steadily produces infertility as maintainer System.Since the technology produces non-transgenic product using biotechnology, solves the bottleneck faced during the paddy rice cross breeding production of hybrid seeds Problem, i.e., three line method resource utilization is low and (it is special that method detailed sees PCT the problem of sterile line fertility instability in two line method Sharp PCT/CN2013/086657).
The present invention also provides a kind of production methods of plant comprising：
(1) expression cassette provided by the present invention is built；
(2) expression cassette for obtaining step (1) imports plant cell；
(3) genetically modified plants are regenerated；With
(4) genetically modified plants are selected；And
(5) optionally, the plant that amplification step (4) obtains is to obtain offspring.
The genetically modified plants of the present invention are prepared using method for transformation known to plant biotechnology field technical staff.It is any Method can be used for recombinant expression carrier being transformed into plant cell, to generate the genetically modified plants of the present invention.Method for transformation It may include method for transformation directly or indirectly.Suitable direct method includes that the DNA of polyethylene glycol induction takes in, is liposome-mediated Conversion, imported using particle gun, electroporation and microinjection, etc..In the specific implementation mode of the present invention, the present invention Use the transformation technology based on agrobacterium (reference can be made to Horsch RB etc. (1985) Science 225：1229；White FF, Vectors for Gene Transfer in Higher Plants, Transgenic Plants, volume 1, Engineering and Utilization, Academic Press, 1993, pp.15-38；The .Techniques such as Jenes B For Gene Transfer, Transgenic Plants, volume 1, Engineering and Utilization, Academic Press, 1993, pp.128-143, etc.).Agrobacterium bacterial strain (such as Agrobacterium tumdfaciens or hair root soil bar Bacterium) include plasmid (Ti or Ri plasmids) and T-DNA elements, the plasmid and element are transferred to plant after with Agrobacterium transfection Object, and T-DNA is integrated into the genome of plant cell.T-DNA can be located on Ri- plasmids or Ti- plasmids, or independently wrap It is contained in so-called binary vector.During agrobacterium-mediated method for transformation is described in for example.Agrobacterium-mediated conversion is most It is suitble to dicotyledon, but also is adapted for monocotyledon.During agrobacterium is described in for example the conversion of plant.Conversion can be led Cause conversion and expression instantaneous or stablize.Although the nucleotide sequence of the present invention, which can be inserted into, falls into appointing in these broad varieties In what plant and plant cell, but it is particularly suitable for crop plants cell.
Compared with prior art, the present invention has following advantageous effect：The present invention provides a kind of pollen developments Gene and based on male sterile line caused by the gene mutation, the stable fertility of the sterile line, not by environmental influence, It can be restored by wild-type transgenic.The sterile line that the gene and the gene mutation generate is structure third generation crossbreeding body System provides necessary element, the male sterile line which generates, for producing hybrid seed, for breaking through and improveing Existing " three systems " and " two systems " hybridization technique are significant.
Specific implementation mode
It elaborates below to the embodiment of the present invention, the present embodiment is carried out lower based on the technical solution of the present invention Implement, gives detailed embodiment and specific operating process, but protection scope of the present invention is not limited to following implementation Example.
Embodiment 1, rice male sterility mutant (osht2925) screening
The EMS mutagenesis long-grained nonglutinous rice Huangs China that is obtained by of the mutant accounts for seed (M0), and EMS mutagenesis concentration and time is 0.7%, 12 hours, from M0 for the solid rear mixed receipts of seed plant, obtain mutant library (M1).Exist for the plant of seed from M1 Seed maturity, by Phenotypic Observation, obtains sterile plant (Fig. 1,2) for screening.Sterile plant cuts rice stub regeneration, and regeneration strain is in life It grows the phase and dyes detection pollen development and staining reaction with I2-KI.The pollen of one of mutant is typical infertility, for no powder Type, plant show as holandry infertility, are named as osht2925.
Embodiment 2, rice male sterility mutant (osht2925) genetic analysis
Osht2925 mutant sterile plant is accounted for wild type Huang China to be hybridized, and three hybrid Population F1 generation plant all show as It is fertile.F1 generation is selfed again, F2 is for infertility in plant and the segregation ratio of fertile plant close to 1:3(67:192), display should Mutation is controlled by Recessive genes.
Embodiment 3, rice male sterility mutant (osht2925) reproductive organs phenotypic analysis
Compared with wild type, mutant plants growth and development is normal, and the same period blooms.Lemma and glumelle size, form, the first transaction of a day's business Size, the first transaction of a day's business time and wild type do not have difference (Fig. 3).But mutant anther slight of stature is in pale yellow (Fig. 4) that anther does not crack, into One step carries out dyeing detection with I2-KI solution to the pollen of mutant, and the results are shown in Figure 5, and the pollen staining of wild type is normal, And mutant performance is without powder.Such as Fig. 6, compared with wild type, 9 mutant microspores of stage do not have apparent vacuolization and wrinkle Contracting, until microspore degradation disappears in the 12 mutant anther rooms stage, hetero-organization such as tapetum, pollen outer wall, outside pollen Wall does not have significant difference.
The clone of embodiment 4, rice male sterility mutant gene
Mutant gene clone takes Mutmap methods, that is, utilizes mutant and open country life parents structure F2 groups, The method for carrying out the assignment of genes gene mapping by resurveying sequence.Sterile plant is accounted for wild type Huang China and is hybridized, chooses 30 F2 for sterile plant, It takes blade to extract genomic DNA, high throughput genome sequencing is used for after mixed in equal amounts, obtains about 10Gb genome sequence columns altogether According to being equivalent to 22x rice genomes (table 1).Show that mutator may be the 4th compared with accounting for genome sequence with wild type Huang China LOC_Os04g024530 allele on chromosome.
1 rice male sterility mutant of table weight sequencing data
In the code area overall length 2121bp of the wild type Huang Hua Zhanzhong genes, nucleotide sequence such as SEQ ID NO:1 institute Show.SEQ ID NO:1 two protein sequences of coding, amino acid sequence such as SEQ ID NO:2、SEQ ID NO:Shown in 3, SEQ ID NO:The albumen of 2 codings contains 556 amino acid, SEQ ID NO:The albumen of 3 codings contains 523 amino acid.It is mutated in infertility In body, a single base mutation G..A on OsHT2925 genes causes to encode SEQ ID NO in mutant:2 albumen turn Record this, the shearing site of First Intron and second exon is by GT ... AG sports GT ... AA, and then lead to mutant In mainly to encode SEQ ID NO:3 transcript exists；For SEQ ID NO:For albumen coded by 3, the 117th amino Acid sports AGG (arginine) by GGG (glycine)；Eventually lead to coding such as SEQ ID NO:Albumen shown in 9..Using most New SNP (single nucleotide polymorphism) research tools HRM (High Resolution Melt, i.e. high-resolution melt) analysis, It further verifies all sterile plants and carries homozygous mutant site, and fertile plant carries pure and mild wild type or heterozygous Site (table 2).The site is that the plant selfing offspring of pure and mild wild type is all fertile, after the plant selfing of heterozygous is in the site Represent existing 1:3 (infertility：It is fertile) separation.
2 mutator of table (LOC_Os04g24530) HRM genotyping results
There are nucleotide sequence polymorphism (figures between japonica rice Nipponbare and wild type Huang China account in the gene cDNA encoding area 7) amino acid sequence of the corresponding gene, is caused the polymorphism (Fig. 8) of individual amino acid residue occur.Specifically in japonica rice day During this is fine, the nucleotide sequence such as SEQ ID NO of the gene:Shown in 5, the amino acid sequence such as SEQ ID NO of coding:6、 SEQ ID NO:Shown in 7.
Single base mutation in LOC_Os04g24530 causes preceding tanscription termination, leads to the anther table of osacos12 mutant Skin defect eventually leads to the phenotype of rice holandry infertility.
The expression analysis of embodiment 5, OsHT2925 genes in each organ of rice
According to the cDNA sequence design primer of OsHT2925, sense primer is OsHT2925-qRT-F1 5 ' AGAGGAAGGAGG AGACGGAG3’(SEQ ID NO:20), downstream primer is OsHT2925-qRT-R1 5 ' GCGACCTGAAACCCCTTGT A 3’(SEQ ID NO:21), while using rice Actin genes as internal reference control design draw Object, 5 ' GCTATGTACGTCGCCATCCA of sense primer, 3 ' (SEQ ID NO:22), downstream primer 5 ' GGACAGTGTGGCTGACACCAT3’(SEQ ID NO:23).Rice material extraction total serum IgE is accounted for yellow China and synthesizes cDNA moulds Plate.Take real-time quantitative PC R methods, analysis OsHT2925 genes rice root, stem, leaf, lemma, glumelle, lepicena, gynoecium and Young fringe grain husk flower primordium idiophase (stage6), young fringe pollen mother cell Meiosis (stage 7) and tetrahedron are at rank Section (stage 8), microspore early stage (stage 9), microspore middle and advanced stage (stage 10) and mature pollen phase (stage 12) Express spectra, the results are shown in Figure 9, gene specifically expressing (Fig. 9) in Rice Anther.
The transgenic function complementation of embodiment 6, rice male sterility mutant (osht2925)
The structure (Figure 10) of complementing vector：With primer OsHT2925-Res-F (CCATGATTACGAATTCCTATCCCATCAATGT AGCTGAAGATAAGG, SEQ ID NO:And OsHT2925-Res-R 24) (GGCCAGTGCCAAGCTTTACTTCATGCATGTAT TTTCCCTTTTTG, SEQ ID NO:25) amplifying rice genome obtains The base for obtaining 2000bp containing the upstreams OsHT2925 initiation codon ATG or so and 2600 alkali after terminator codon TAA Full-length genome DNA sequencing fragment (the SEQ ID NO of base：3), while genome complementation expression vector EcoR I, Hind III Enzymes double zyme cutting simultaneously recycles the segment after digestion, with In-Fusion enzymes by carrier recovery segment and full-length genome DAN sequences Segment connects.The callus of the Seed inducement that accounts for osht2925 mutant is converted by agriculture bacillus mediated method to yellow China In, screening regeneration obtains transfer-gen plant.
It is fertile to find that all transgenic positive plant show for the transgenic positive plant for analyzing all acquisitions.These points Analysis further proves that gene Osht2925 participates in pollen development regulation and control, which leads to pollen abortion.
Embodiment 7, the acquisition for knocking out transgenic line of OsHT2925 genes and phenotypic analysis
The structure of the knockout carrier (Figure 11) of OsHT2925 genes：With target spot Target1 (TGAAGGATGGATCCTGCAAGAAACC, SEQ ID NO:And Target2 26) (TGGACTAGTTTTGATACGTGCTCATTTC, SEQ ID NO:27) U6a and U3 of CRISPR/Cas9 carriers are connected respectively to It is connected into promoter, after digestion in CRISPR/Cas9 carriers and obtains HT2925 knockout carriers.Turned by agriculture bacillus mediated method Chemical weapons transport the callus of round-grained rice, and screening regeneration obtains transfer-gen plant.Phenotypic analysis is carried out to the transgenic positive plant, is found All transfer-gen plants show pollen abortion, which further illustrates that OsHT2925 participates in pollen development regulation and control, should The expression of gene, which is suppressed, leads to pollen abortion.
The homologous protein predicted in embodiment 8, the albumen of OsHT2925 gene codes and barley, sorghum, Maize genome Sequence alignment
In ncbi database, using protein blast tools, to the albumen total order of rice Os HT2925 gene codes It is listed in albumen database and is searched, obtained millet (millet) (Setaria italica), two fringe false bromegrass The homologous protein predicted in the genome of (Brachypodium distachyon), corn (Zea mays), by these albumen sequences Row are compared, as a result show the homologous protein from different plants all have closely similar conserved sequence, each other it Between homology it is very high (Figure 12), show that albumen biological function in the male organs growth course of plant flowers is conservative, play Very important effect.
Wherein, the nucleotide sequence of the fertile gene such as SEQ ID NO in two fringe false bromegrass:Shown in 10, amino acid Sequence such as SEQ ID NO:Shown in 11；The nucleotide sequence of the fertile gene such as SEQ ID NO in millet:Shown in 12, ammonia Base acid sequence such as SEQ ID NO:Shown in 13；The nucleotide sequence of the fertile gene ZmHT2925 such as SEQ ID NO in corn: 14、SEQ ID NO:15、SEQ ID NO:Shown in 16, amino acid sequence such as SEQ ID NO:17、SEQ ID NO:18、SEQ ID NO:Shown in 19.
SEQUENCE LISTING
<110>Shenzhen Xingwang Biological Seed Industry Co., Ltd.
Shenzhen Crop Molecular Design Breeding Institute
<120>Male fertile related gene HT2925 and its application
<130>
<160> 27
<170> PatentIn version 3.3
<210> 1
<211> 2121
<212> DNA
<213>Rice（Oryza sativa ssp.indica）
<400> 1
atgggcgacg ccgcggtacc cgccatggtg gtggaggagg aggaacagga gcacgtgttc 60
cggagcaggt tcccgccggt ggccgtgccg gacggcgtca ccgtgccgga gttcgtgctg 120
gacggcgccg aggcctacgc cgacagggtg gcgctcgtgg aggccgcggc gggcgggcgg 180
tcgtacacgt acggcgaggt ggcgcgcgac acggcgcggt tcgccagggc gctccggtcg 240
gtgggcgtcc ggaaggggca cgtcgtcgtc gtcgcgctcc caaacctcgc cgtgtacccc 300
gtcgtgtcgc tcgggatcat gtcggcgggg gccgtgttct ccggcgtgaa cccgcgcgcg 360
ctcgccgcgg agatcaagaa gcaggtggag gactccgagg cgaagctggt cgttgccaac 420
gaggtcgcgt tcgacaaggt gaaggacgcc ggcgtgccgg tgatcggcgt cggcgacagg 480
gagcggatgc ctggggcgat cagctgggac gagctcctcg ccgcggcgga ccgcaccggc 540
gccggggtgg tgccggtgga cgcggcgcag cagtccgacc tgtgcgcgct cccctactcc 600
tccggcacca ccggcgtgtc caagggcgtg atgctgagcc accgcaacct ggtgtccaac 660
ctctgctcgt ccatgttcgc cgtggcgccg gagacggccg ggcaggtggt gacgctgggg 720
ctcatgccgt tcttccacat ctacggcatc accggcatct gctgcgccac gctccggcac 780
aagggcacgg tggtggtgat ggaccgcttc gacctccgca cgttcctccg tgcgctcgtc 840
gaccaccgcg tcatgttcgc gccgctggtt ccccccgtga tgctcgccat ggtcaagagc 900
cccgtcgccg acgagttcga cctctccgac ctcgccctca agtccgtcat gaccgccgcc 960
gcgccgctcg cccccgacct cctcgccgcg ttccagcgca agttccccgg cgtgcaggtg 1020
gaggaagcct acggcctcac cgagcacagc tgcatcaccc tcacgcacgc cgccggcgac 1080
ggccacggcc acgtcgccaa gaagagctcg gtggggttca tcctgccgaa cctggaggtg 1140
aagttcgtgg acccggacac cgggaggtcg ctgccggcga acacgccggg ggagctgtgc 1200
gtgcggagcc agagcgtgat gcaggggtac tacaagagga aggaggagac ggagcgcacg 1260
gtggacggca aggggtggct gcacaccggc gacgtcgggt acatcgacgg cgacggcgac 1320
gtgttcatcg tggacaggat caaggagctg atcaagtaca aggggtttca ggtcgccccc 1380
gccgagctcg aggccgtcct cctctcccac ccctccgttg aggacgccgc cgtcttcggg 1440
taacaccctt cttcttcttc ttctctgacc gtcgaaactt caacagttga ttctggagta 1500
aagttatgaa gcagtcaaaa cccagcttta tatttctagt ttattttgtg agatcatttc 1560
agccagcttc attctaattt tgtatggagt ttaaactttt tagttggatt ttaattttaa 1620
aaagatggaa ttgtagatgg agcttttgcc atgtcctaaa gccatgcatg catggatacg 1680
cagggtgccg gacgaggagg ccggcgaggt gccggtggcg tgcgtggtgc ggcggcacgg 1740
tgcggaggag ggggaggagg agatagtggc gtacgtggcg gagagggtgg cgtcgtacaa 1800
gcgggtccgg gtgctgcaca tcgtcgacgc catccccaag tcggtgtccg ggaagatcct 1860
gaggaggcag cttagggacg agttcatcaa gaggatgaaa ccgtcagctt gattaattaa 1920
cagacataaa tcattgtgat tgatatcaag aaccgaaagc atgcaaggtg ttaaattgca 1980
taaaaatgga gttggataag tgtttcatca tcaccgagta tatgtacgta catgttagtg 2040
attatcgtgt gaaattacca tggaaatgaa ttctaagtct ttaatttaag tacatttatc 2100
ttcgtttctt ttttacaaat a 2121
<210> 2
<211> 555
<212> PRT
<213>Rice（Oryza sativa ssp.indica）
<400> 2
Met Gly Asp Ala Ala Val Pro Ala Met Val Val Glu Glu Glu Glu Gln
1 5 10 15
Glu His Val Phe Arg Ser Arg Phe Pro Pro Val Ala Val Pro Asp Gly
20 25 30
Val Thr Val Pro Glu Phe Val Leu Asp Gly Ala Glu Ala Tyr Ala Asp
35 40 45
Arg Val Ala Leu Val Glu Ala Ala Ala Gly Gly Arg Ser Tyr Thr Tyr
50 55 60
Gly Glu Val Ala Arg Asp Thr Ala Arg Phe Ala Arg Ala Leu Arg Ser
65 70 75 80
Val Gly Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu
85 90 95
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
100 105 110
Phe Ser Gly Val Asn Pro Arg Ala Leu Ala Ala Glu Ile Lys Lys Gln
115 120 125
Val Glu Asp Ser Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Phe
130 135 140
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Val Gly Asp Arg
145 150 155 160
Glu Arg Met Pro Gly Ala Ile Ser Trp Asp Glu Leu Leu Ala Ala Ala
165 170 175
Asp Arg Thr Gly Ala Gly Val Val Pro Val Asp Ala Ala Gln Gln Ser
180 185 190
Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys
195 200 205
Gly Val Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser
210 215 220
Met Phe Ala Val Ala Pro Glu Thr Ala Gly Gln Val Val Thr Leu Gly
225 230 235 240
Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala
245 250 255
Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu
260 265 270
Arg Thr Phe Leu Arg Ala Leu Val Asp His Arg Val Met Phe Ala Pro
275 280 285
Leu Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Asp
290 295 300
Glu Phe Asp Leu Ser Asp Leu Ala Leu Lys Ser Val Met Thr Ala Ala
305 310 315 320
Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Gln Arg Lys Phe Pro
325 330 335
Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile
340 345 350
Thr Leu Thr His Ala Ala Gly Asp Gly His Gly His Val Ala Lys Lys
355 360 365
Ser Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp
370 375 380
Pro Asp Thr Gly Arg Ser Leu Pro Ala Asn Thr Pro Gly Glu Leu Cys
385 390 395 400
Val Arg Ser Gln Ser Val Met Gln Gly Tyr Tyr Lys Arg Lys Glu Glu
405 410 415
Thr Glu Arg Thr Val Asp Gly Lys Gly Trp Leu His Thr Gly Asp Val
420 425 430
Gly Tyr Ile Asp Gly Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys
435 440 445
Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu
450 455 460
Ala Val Leu Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe Gly
465 470 475 480
Val Pro Asp Glu Glu Ala Gly Glu Val Pro Val Ala Cys Val Val Arg
485 490 495
Arg His Gly Ala Glu Glu Gly Glu Glu Glu Ile Val Ala Tyr Val Ala
500 505 510
Glu Arg Val Ala Ser Tyr Lys Arg Val Arg Val Leu His Ile Val Asp
515 520 525
Ala Ile Pro Lys Ser Val Ser Gly Lys Ile Leu Arg Arg Gln Leu Arg
530 535 540
Asp Glu Phe Ile Lys Arg Met Lys Pro Ser Ala
545 550 555
<210> 3
<211> 522
<212> PRT
<213>Rice（Oryza sativa ssp.indica）
<400> 3
Met Gly Asp Ala Ala Val Pro Ala Met Val Val Glu Glu Glu Glu Gln
1 5 10 15
Glu His Val Phe Arg Ser Arg Phe Pro Pro Val Ala Val Pro Asp Gly
20 25 30
Val Thr Val Pro Glu Phe Val Leu Asp Gly Ala Glu Ala Tyr Ala Asp
35 40 45
Arg Val Ala Leu Val Glu Ala Ala Ala Gly Gly Arg Ser Tyr Thr Tyr
50 55 60
Gly Glu Val Ala Arg Asp Thr Ala Arg Phe Ala Arg Ala Leu Arg Ser
65 70 75 80
Val Gly Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu
85 90 95
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
100 105 110
Phe Ser Gly Val Asn Pro Arg Ala Leu Ala Ala Glu Ile Lys Lys Gln
115 120 125
Val Glu Asp Ser Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Phe
130 135 140
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Val Gly Asp Arg
145 150 155 160
Glu Arg Met Pro Gly Ala Ile Ser Trp Asp Glu Leu Leu Ala Ala Ala
165 170 175
Asp Arg Thr Gly Ala Gly Val Val Pro Val Asp Ala Ala Gln Gln Ser
180 185 190
Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys
195 200 205
Gly Val Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser
210 215 220
Met Phe Ala Val Ala Pro Glu Thr Ala Gly Gln Val Val Thr Leu Gly
225 230 235 240
Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala
245 250 255
Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu
260 265 270
Arg Thr Phe Leu Arg Ala Leu Val Asp His Arg Val Met Phe Ala Pro
275 280 285
Leu Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Asp
290 295 300
Glu Phe Asp Leu Ser Asp Leu Ala Leu Lys Ser Val Met Thr Ala Ala
305 310 315 320
Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Gln Arg Lys Phe Pro
325 330 335
Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile
340 345 350
Thr Leu Thr His Ala Ala Gly Asp Gly His Gly His Val Ala Lys Lys
355 360 365
Ser Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp
370 375 380
Pro Asp Thr Gly Arg Ser Leu Pro Ala Asn Thr Pro Gly Glu Leu Cys
385 390 395 400
Val Arg Ser Gln Ser Val Met Gln Gly Tyr Tyr Lys Arg Lys Glu Glu
405 410 415
Thr Glu Arg Thr Val Asp Gly Lys Gly Trp Leu His Thr Gly Asp Val
420 425 430
Gly Tyr Ile Asp Gly Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys
435 440 445
Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu
450 455 460
Ala Val Leu Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe Gly
465 470 475 480
Trp Ser Phe Cys His Val Leu Lys Pro Cys Met His Gly Tyr Ala Gly
485 490 495
Cys Arg Thr Arg Arg Pro Ala Arg Cys Arg Trp Arg Ala Trp Cys Gly
500 505 510
Gly Thr Val Arg Arg Arg Gly Arg Arg Arg
515 520
<210> 4
<211> 7408
<212> DNA
<213>Rice（Oryza sativa ssp.indica）
<400> 4
ctatcccatc aatgtagctg aagataaggt agagttaatt gctggactac ttggttgcaa 60
ggttggatct atgccattca attatttgag tttacctatg gggacaacca tacctaaggt 120
aattgatttt gctcctttag tggatagagt tgagagaagg ctaacaataa gctcagcctt 180
tttaccccag ggtggtaggc tgacacttat caactatgtt ctttctataa tcctcacata 240
ctatatgtgt tctcttgaac tgtctttaac tgtcatcaaa gccattgata cagtaagaaa 300
gaacggttta tagagaggaa ataacccaaa ttccaccaga aaatatttag tttcctagga 360
gctagtgtgc aggctaaagg acaagggtgg tttaggggtg ataaatctaa gaaaccagaa 420
tgttgttctt ttattgaaac acttagataa gttctataga aatgttgatc ttccttgggt 480
ggatctcata tggaaatctt attgcactta aaagtctctt cacttagttt caaacagagg 540
ctccttttgg tggaaaaata ttgtttccct ggttgatgtt tttagaggga tgctcattgc 600
acagtgcaaa taggaacctc actgctcttt tggggatctg tgtaatgggg aactaagttt 660
cctaatcttt tttgggcagc ttataacaaa gatgaatttg ttaagatggc ttgctccaag 720
cctttggaag atgctttacg ctaccaatga atgctgaagc ttatggggaa tttttagttt 780
tgcaatctga acttgacaat gtccatttaa gtgaggggtt gggtgatcat tggagctata 840
tttggaatgt tgataagtat tctgctcaaa gattttaaaa aatgaattat tcatgcttac 900
agcctccaag gccgcttgtt tggatctgga agacaaagcg tgtgatgaaa atcaaagtgt 960
ttgcttggct cctctcttta gacagaatta atacaaggga catggtggat tgcaggcact 1020
atgctaagga aaatgatgat ctcacctgtg ttctttgctt tgggggtatt agagagataa 1080
ggctacatct cttctttact taccttttta gtctccgatg ttgacagtat ttgggttttg 1140
attggtctcc ttatttaaat ttcttccaga tgattgttct agtgagaatt cgttttggta 1200
cgaaggtttc ctggagatct tctttacaac tcctgacata tttggaagca aagaaatggc 1260
ttgatttttc ataatgtacc tccaactttt catggatgga aagttcagtt caggaaagag 1320
cttcttctac atatgtgtag aatgaaggag cctctcaagc aattagtttt tgattagtca 1380
caaattttgt aattattttg tgggtttctg tttttcctag taagatgtaa atatttcttt 1440
ttatacaagc tatactggta ggcaaatgcc tggcagtaat ttgtcaaaaa aaaatgaact 1500
ttgtatttat cgtattatgt tgttaatcta gtatttaagt atcaaatgca aattgcagtt 1560
ggggtgtcaa ggatatgtgt gttagtgtgt gtattagtgt gctaaggaca ttttagtctt 1620
ttcccatatc tttgtataca atatattccc ctctagggca aaatcaatgg atcaacgatt 1680
tatccccaga tccccaaaat tataacatct gacatgtgaa ccgtatgcac ctacacttat 1740
ccgctactac ggtctgttaa tattcaggca caacacaact tacacgatat acaaaatgca 1800
tcaagaaaat catcgtaaga tcgattatta ttatgcatca agaaaatcat cgtaagatcg 1860
attattatta ttaactgttt atagttaaca acagctacta cgatcctctc catttctacc 1920
agcattcgaa gattcacact ctttgcaagc caaaaggcca tgacccaacc aaacctcacc 1980
tacaccccac tagtcatggt aacacacaag aaccgtgtca tcctcgccac gaccaccacc 2040
accaccatgt cgtcgccttc ctctcgccac ccctcgccac cacgctctct acaaatgcca 2100
gagctccggc cacccccacc accacccaag aagcctgcgc cgccgaccgg catcgcgaca 2160
tgggcgacgc cgcggtaccc gccatggtgg tggaggagga ggaacaggag cacgtgttcc 2220
ggagcaggtt cccgccggtg gccgtgccgg acggcgtcac cgtgccggag ttcgtgctgg 2280
acggcgccga ggcctacgcc gacagggtgg cgctcgtgga ggccgcggcg ggcgggcggt 2340
cgtacacgta cggcgaggtg gcgcgcgaca cggcgcggtt cgccagggcg ctccggtcgg 2400
tgggcgtccg gaaggggcac gtcgtcgtcg tcgcgctccc aaacctcgcc gtgtaccccg 2460
tcgtgtcgct cgggatcatg tcggcggggg ccgtgttctc cggcgtgaac ccgcgcgcgc 2520
tcgccgcgga gatcaagaag caggtggagg actccgaggc gaagctggtc gttgccaacg 2580
aggtcgcgtt cgacaaggtg aaggacgccg gcgtgccggt gatcggcgtc ggcgacaggg 2640
agcggatgcc tggggcgatc agctgggacg agctcctcgc cgcggcggac cgcaccggcg 2700
ccggggtggt gccggtggac gcggcgcagc agtccgacct gtgcgcgctc ccctactcct 2760
ccggcaccac cggcgtgtcc aagggcgtga tgctgagcca ccgcaacctg gtgtccaacc 2820
tctgctcgtc catgttcgcc gtggcgccgg agacggccgg gcaggtggtg acgctggggc 2880
tcatgccgtt cttccacatc tacggcatca ccggcatctg ctgcgccacg ctccggcaca 2940
agggcacggt ggtggtgatg gaccgcttcg acctccgcac gttcctccgt gcgctcgtcg 3000
accaccgcgt catgttcgcg ccgctggttc cccccgtgat gctcgccatg gtcaagagcc 3060
ccgtcgccga cgagttcgac ctctccgacc tcgccctcaa gtccgtcatg accgccgccg 3120
cgccgctcgc ccccgacctc ctcgccgcgt tccagcgcaa gttccccggc gtgcaggtgg 3180
aggaagccta cggcctcacc gagcacagct gcatcaccct cacgcacgcc gccggcgacg 3240
gccacggcca cgtcgccaag aagagctcgg tggggttcat cctgccgaac ctggaggtga 3300
agttcgtgga cccggacacc gggaggtcgc tgccggcgaa cacgccgggg gagctgtgcg 3360
tgcggagcca gagcgtgatg caggggtact acaagaggaa ggaggagacg gagcgcacgg 3420
tggacggcaa ggggtggctg cacaccggcg acgtcgggta catcgacggc gacggcgacg 3480
tgttcatcgt ggacaggatc aaggagctga tcaagtacaa ggggtttcag gtcgcccccg 3540
ccgagctcga ggccgtcctc ctctcccacc cctccgttga ggacgccgcc gtcttcgggt 3600
aacacccttc ttcttcttct tctctgaccg tcgaaacttc aacagttgat tctggagtaa 3660
agttatgaag cagtcaaaac ccagctttat atttctagtt tattttgtga gatcatttca 3720
gccagcttca ttctaatttt gtatggagtt taaacttttt agttggattt taattttaaa 3780
aagatggaat tgtagatgga gcttttgcca tgtcctaaag ccatgcatgc atggatacgc 3840
agggtgccgg acgaggaggc cggcgaggtg ccggtggcgt gcgtggtgcg gcggcacggt 3900
gcggaggagg gggaggagga gatagtggcg tacgtggcgg agagggtggc gtcgtacaag 3960
cgggtccggg tgctgcacat cgtcgacgcc atccccaagt cggtgtccgg gaagatcctg 4020
aggaggcagc ttagggacga gttcatcaag aggatgaaac cgtcagcttg attaattaac 4080
agacataaat cattgtgatt gatatcaaga accgaaagca tgcaaggtgt taaattgcat 4140
aaaaatggag ttggataagt gtttcatcat caccgagtat atgtacgtac atgttagtga 4200
ttatcgtgtg aaattaccat ggaaatgaat tctaagtctt taatttaagt acatttatct 4260
tcgtttcttt tttacaaata gccatgctta ttttttttaa aaaaaaaaac taggaagata 4320
gtccacgcat atgcgcgagc atcttattaa atattgtttg aatttttatt atggaagctt 4380
atatgtgggt gattttttct ttaaatattc tgactctatt ctaaatctat ttccgtcgat 4440
aatttattta agattgctta tgattttttt ctaattaccc ttgcaacgta taaatcactt 4500
ttattaggtc aattcttacg ataaagtata ttttcattac atggattctc atatatatat 4560
aagtttaaca tggtatgctt ctcctagtta accgaattta tagtggaata tccatgtacc 4620
aattatattt aatactggat ggatacccca cgtattgctg cggaattttt atatccttcg 4680
gagcattccc ctattgtcat gcataaagcc atattcctca ttcgagtata aaaagataac 4740
atgaaaaatt atatgaaaaa ttataggaat gttttgtcta aatggactcc atggaaccct 4800
tttagaaaat aggcatgttc gtaattaggg gtgaaaacgg taacggtaat taccggccga 4860
ccggcgttcg ttttcgactt tctaccggcc gagccatatg gaaatggtaa tcgaccgaaa 4920
caaaaatgga aatggtaaaa aatatggaaa tgaaaacgga aatggttttg ctgttatacc 4980
gatcgtttcc gtatttaccg tattcttgcg gaaattacca tttcttataa tatgataatt 5040
accgtattct aaatatgtcg atattatagg acatgtctat actttaccca cagcttatag 5100
attgaatgac tctttaataa aatctctaac ttttgtacat ggctaaaatg aagttaattt 5160
ataatttata tagtataaac ttgaatttat gtatatatat aacatactta tgtaaagtta 5220
aatatatatt tttatagttt aatgtttccg tatttgttac cggtttccga tctgtaccga 5280
catgtttccg tccgtattgt tccgtttccg gttttccgat atttccgata tcgttttcgt 5340
ttccgacttt accgtttccg attttgtttc cgagaaaaat atggttacgg aaatggttga 5400
ggctgttttc cgatcgtttc cgaccgtttt catccctatt cgtaatgata catatataaa 5460
attttcccaa aaactgaaaa caaataacca agtatctgta attctgagct ggaattgcac 5520
agcatgaaaa aaaattatgc gaggttaacg tcaagaagat taaatataac acgtaatatg 5580
ggacaaaata aaatggatta ctcttgaagt ataaaattgg atgcaaaagc atatacctaa 5640
caaaaaaact aatcaatgta atttggcatt cagtttagag ggttaaaaat gcacgatgca 5700
aaatattttt caacatgagg tcccaacgaa ctgaaatatg agcgggtgac tgataactcg 5760
tacttcagat ccacatgatt gttttttcct catagtccat cttaatatcc atttgcagct 5820
aagtgtagag tattgaacgg gagattctga tattctagag aaaaatataa accatcagtg 5880
cacggtaata tgagcaaaca aaagtacaaa ctgacatgga gatgccacat taacggtaat 5940
atgaacaaac aaaagtacaa actgacacgg agatgccgca ggaacttaga gaggaatggg 6000
agggaggaga gatcaagtaa ttacatgtgc ttgtcggagt gattaaataa ttacacaatg 6060
atgttttaac cttttttatt ctagtaggat tggaccatga cccttatagc agattctacc 6120
aatagtcgac aaatggatgg aactatttat atacatgagg aggctatgca gcatgaacac 6180
cgatgaaatg atgagggaac cgttggtttt taggcgatat gggaggtgat tggacgaatc 6240
gatcgataaa cgtgcagacg gacacgtgcg caacattgaa gtgaactttt acgtggtgtc 6300
gcatggcatc catcagggat ggcaaaccga tcatatgggt tgggccagtt ggctatgccc 6360
tatgctgggc taggattaaa tatcaatcga catggatgaa cggtcagatg agaagcaaag 6420
aagcggatag ataaaaatcg aacagctatg ctattagtaa tgatgtggct cactctcaag 6480
atagcaaatt agtattaatt atactaagtg cgatcaatta tatagttata ctaaaaaatc 6540
ggcatgctta gtcagcctat atatacttat tatcactaaa aaatattaca tggtaaaatt 6600
ggtgtgctca ctaatattta aaatatgtat atacttcatt ttcttatttg aatttttaga 6660
gttttcataa aatattttaa aaagaaaatt gtgaaccact cttttagttt taacaaatga 6720
atatatgata ttaaaaacat ttatggacgt atatataaat gatttattta ttatgtataa 6780
gtgaaaaaca tatgtgtcat aaaaaatata gaactttata tcatgtcaac caaaagtata 6840
aaatttaatg tgtcatttta tacataaatt ttgatgaaat ccaaaaaatt taatgtgtca 6900
ttttatacat aaattttgat aaaatccaaa caagtaaagt tatttttaag atttatcaaa 6960
attaattggt taaaatatat gatttgaata tttgaaagat caattattta gtatattcaa 7020
agttatagga gtagtaccga gtaggcgtag tatatttaaa gaaggaaaat gaatgtaaat 7080
tcgttgtttt agatttgttt tttttttaat aatgttgggt ttactatata ttctagagtt 7140
ataggagtag taccgagtgt ggtatattta tataaggcaa aggagtaaaa gtttttgtga 7200
ttgaaaaagg gagatagttt tggaagcctc tggaatccat atgtgatact tttctctata 7260
tttttcctga catatgattg ttaggtgttt tttctttact ataaatttat gatttttctt 7320
caaagtaaga gatgccacgt ggaccaatcg aaagctagca aaaagccagc taggataaat 7380
caaaaaggga aaatacatgc atgaagta 7408
<210> 5
<211> 2121
<212> DNA
<213>Rice（Oryza sativa ssp.japonica）
<400> 5
atgggcgacg ccgcggtacc cgccatggtg gtggaggagg aggaacagga gcacgtgttc 60
cggagcaggt tcccgccggt ggccgtgccg gacggcgtca ccgtgccgga gttcgtgctg 120
gacggcgccg aggcctacgc cgacagggtg gcgctcgtgg aggccgcggc gggcgggcgg 180
tcgtacacgt acggcgaggt ggcgcgcgac acggcgcggt tcgccagggc gctccggtcg 240
gtgggcgtcc ggaaggggca cgtcgtcgtc gtcgcgctcc caaacctcgc cgtgtacccc 300
gtcgtgtcgc tcgggatcat gtcggcgggg gccgtgttct ccggcgtgaa cccgcgcgcg 360
ctcgccgcgg agatcaagaa gcaggtggag gactccgagg cgaagctggt cgttgccaac 420
gaggtcgcgt tcgacaaggt gaaggacgcc ggcgtgccgg tgatcggcgt cggcgacagg 480
gagcggatgc ctggggcgat cagctgggac gggctcctcg ccgcggcgga ccgcaccggc 540
gccggggtgg tgccggtgga cgcggcgcag cagtccgacc tgtgcgcgct cccctactcc 600
tccggcacca ccggcgtgtc caagggcgtg atgctgagcc accgcaacct ggtgtccaac 660
ctctgctcgt ccatgttcgc cgtggcgccg gagacggccg ggcaggtggt gacgctgggg 720
ctcatgccgt tcttccacat ctacggcatc accggcatct gctgcgccac gctccggcac 780
aagggcacgg tggtggtgat ggaccgcttc gacctccgca cgttcctccg tgcgctcgtc 840
gaccaccgcg tcatgttcgc gccgctggtt ccccccgtga tgctcgccat ggtcaagagc 900
cccgtcgccg acgagttcga cctctccgac ctcgccctca agtccgtcat gaccgccgcc 960
gcgccgctcg cccccgacct cctcgccgcg ttccagcgca agttccccgg cgtgcaggtg 1020
gaggaagcct acggcctcac cgagcacagc tgcatcaccc tcacgcacgc cgccggcgac 1080
ggccacggcc acgtcgccaa gaagagctcg gtggggttca tcctgccgaa cctggaggtg 1140
aagttcgtgg acccggacac cgggaggtcg ctgccggcga acacgccggg ggagctgtgc 1200
gtgcggagcc agagcgtgat gcaggggtac tacaagagga aggaggagac ggagcgcacg 1260
gtggacggca aggggtggct gcacaccggc gacgttgggt acatcgacgg cgacggcgac 1320
gtgttcatcg tggacaggat caaggagctg atcaagtaca aggggtttca ggtcgccccc 1380
gccgagctcg aggccgtcct cctctcccac ccctccgttg aggacgccgc cgtcttcggg 1440
taacaccctt cttcttcttc ttctctgacc gtcgaaactt caagagttga ttctggagta 1500
aagttatgga gcaatcaaaa ccaagcttta tatttctagt ttattttgtg agatcatttc 1560
agccagcttc attctaattt tgtatggagt ttaaactttt tagttggatt ttaattttaa 1620
aaagatggaa ttgtagatgg agcttttgcc atgtcctaaa gccatgcatg catggatatg 1680
cagggtgccg gacgaggagg ccggcgaggt gccggtggcg tgcgtggtgc ggcggcacgg 1740
tgcggaggag ggggaggagg agatagtggc gtacgtggcg gagagggtgg cgtcgtacaa 1800
gcgggtccgg gtgctgcaca tcgtcgacgc catccccaag tcggtgtccg ggaagatcct 1860
gaggaggcag cttagggacg agttcatcaa gaggatgaaa ccgtcagctt gattaattaa 1920
cagacataaa tcattgtgat tgatatcaag aaccgaaagc atgcaaggtg ttaaattgca 1980
taaaaatgga gttggataag tgtttcatca tcaccgagta tatgtacgta catgttagtg 2040
attatcgtgt gaaattacca tggaaatgaa ttctaagtct ttaatttaag tacatttatc 2100
ttcgtttctt ttttacaaat a 2121
<210> 6
<211> 555
<212> PRT
<213>Rice（Oryza sativa ssp.japonica）
<400> 6
Met Gly Asp Ala Ala Val Pro Ala Met Val Val Glu Glu Glu Glu Gln
1 5 10 15
Glu His Val Phe Arg Ser Arg Phe Pro Pro Val Ala Val Pro Asp Gly
20 25 30
Val Thr Val Pro Glu Phe Val Leu Asp Gly Ala Glu Ala Tyr Ala Asp
35 40 45
Arg Val Ala Leu Val Glu Ala Ala Ala Gly Gly Arg Ser Tyr Thr Tyr
50 55 60
Gly Glu Val Ala Arg Asp Thr Ala Arg Phe Ala Arg Ala Leu Arg Ser
65 70 75 80
Val Gly Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu
85 90 95
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
100 105 110
Phe Ser Gly Val Asn Pro Arg Ala Leu Ala Ala Glu Ile Lys Lys Gln
115 120 125
Val Glu Asp Ser Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Phe
130 135 140
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Val Gly Asp Arg
145 150 155 160
Glu Arg Met Pro Gly Ala Ile Ser Trp Asp Gly Leu Leu Ala Ala Ala
165 170 175
Asp Arg Thr Gly Ala Gly Val Val Pro Val Asp Ala Ala Gln Gln Ser
180 185 190
Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys
195 200 205
Gly Val Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser
210 215 220
Met Phe Ala Val Ala Pro Glu Thr Ala Gly Gln Val Val Thr Leu Gly
225 230 235 240
Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala
245 250 255
Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu
260 265 270
Arg Thr Phe Leu Arg Ala Leu Val Asp His Arg Val Met Phe Ala Pro
275 280 285
Leu Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Asp
290 295 300
Glu Phe Asp Leu Ser Asp Leu Ala Leu Lys Ser Val Met Thr Ala Ala
305 310 315 320
Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Gln Arg Lys Phe Pro
325 330 335
Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile
340 345 350
Thr Leu Thr His Ala Ala Gly Asp Gly His Gly His Val Ala Lys Lys
355 360 365
Ser Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp
370 375 380
Pro Asp Thr Gly Arg Ser Leu Pro Ala Asn Thr Pro Gly Glu Leu Cys
385 390 395 400
Val Arg Ser Gln Ser Val Met Gln Gly Tyr Tyr Lys Arg Lys Glu Glu
405 410 415
Thr Glu Arg Thr Val Asp Gly Lys Gly Trp Leu His Thr Gly Asp Val
420 425 430
Gly Tyr Ile Asp Gly Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys
435 440 445
Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu
450 455 460
Ala Val Leu Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe Gly
465 470 475 480
Val Pro Asp Glu Glu Ala Gly Glu Val Pro Val Ala Cys Val Val Arg
485 490 495
Arg His Gly Ala Glu Glu Gly Glu Glu Glu Ile Val Ala Tyr Val Ala
500 505 510
Glu Arg Val Ala Ser Tyr Lys Arg Val Arg Val Leu His Ile Val Asp
515 520 525
Ala Ile Pro Lys Ser Val Ser Gly Lys Ile Leu Arg Arg Gln Leu Arg
530 535 540
Asp Glu Phe Ile Lys Arg Met Lys Pro Ser Ala
545 550 555
<210> 7
<211> 522
<212> PRT
<213>Rice（Oryza sativa ssp.japonica）
<400> 7
Met Gly Asp Ala Ala Val Pro Ala Met Val Val Glu Glu Glu Glu Gln
1 5 10 15
Glu His Val Phe Arg Ser Arg Phe Pro Pro Val Ala Val Pro Asp Gly
20 25 30
Val Thr Val Pro Glu Phe Val Leu Asp Gly Ala Glu Ala Tyr Ala Asp
35 40 45
Arg Val Ala Leu Val Glu Ala Ala Ala Gly Gly Arg Ser Tyr Thr Tyr
50 55 60
Gly Glu Val Ala Arg Asp Thr Ala Arg Phe Ala Arg Ala Leu Arg Ser
65 70 75 80
Val Gly Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu
85 90 95
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
100 105 110
Phe Ser Gly Val Asn Pro Arg Ala Leu Ala Ala Glu Ile Lys Lys Gln
115 120 125
Val Glu Asp Ser Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Phe
130 135 140
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Val Gly Asp Arg
145 150 155 160
Glu Arg Met Pro Gly Ala Ile Ser Trp Asp Gly Leu Leu Ala Ala Ala
165 170 175
Asp Arg Thr Gly Ala Gly Val Val Pro Val Asp Ala Ala Gln Gln Ser
180 185 190
Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys
195 200 205
Gly Val Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser
210 215 220
Met Phe Ala Val Ala Pro Glu Thr Ala Gly Gln Val Val Thr Leu Gly
225 230 235 240
Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala
245 250 255
Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu
260 265 270
Arg Thr Phe Leu Arg Ala Leu Val Asp His Arg Val Met Phe Ala Pro
275 280 285
Leu Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Asp
290 295 300
Glu Phe Asp Leu Ser Asp Leu Ala Leu Lys Ser Val Met Thr Ala Ala
305 310 315 320
Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Gln Arg Lys Phe Pro
325 330 335
Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile
340 345 350
Thr Leu Thr His Ala Ala Gly Asp Gly His Gly His Val Ala Lys Lys
355 360 365
Ser Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp
370 375 380
Pro Asp Thr Gly Arg Ser Leu Pro Ala Asn Thr Pro Gly Glu Leu Cys
385 390 395 400
Val Arg Ser Gln Ser Val Met Gln Gly Tyr Tyr Lys Arg Lys Glu Glu
405 410 415
Thr Glu Arg Thr Val Asp Gly Lys Gly Trp Leu His Thr Gly Asp Val
420 425 430
Gly Tyr Ile Asp Gly Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys
435 440 445
Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu
450 455 460
Ala Val Leu Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe Gly
465 470 475 480
Trp Ser Phe Cys His Val Leu Lys Pro Cys Met His Gly Tyr Ala Gly
485 490 495
Cys Arg Thr Arg Arg Pro Ala Arg Cys Arg Trp Arg Ala Trp Cys Gly
500 505 510
Gly Thr Val Arg Arg Arg Gly Arg Arg Arg
515 520
<210> 8
<211> 1912
<212> DNA
<213>Rice（Oryza sativa ssp.indica）
<400> 8
atgggcgacg ccgcggtacc cgccatggtg gtggaggagg aggaacagga gcacgtgttc 60
cggagcaggt tcccgccggt ggccgtgccg gacggcgtca ccgtgccgga gttcgtgctg 120
gacggcgccg aggcctacgc cgacagggtg gcgctcgtgg aggccgcggc gggcgggcgg 180
tcgtacacgt acggcgaggt ggcgcgcgac acggcgcggt tcgccagggc gctccggtcg 240
gtgggcgtcc ggaaggggca cgtcgtcgtc gtcgcgctcc caaacctcgc cgtgtacccc 300
gtcgtgtcgc tcgggatcat gtcggcgggg gccgtgttct ccggcgtgaa cccgcgcgcg 360
ctcgccgcgg agatcaagaa gcaggtggag gactccgagg cgaagctggt cgttgccaac 420
gaggtcgcgt tcgacaaggt gaaggacgcc ggcgtgccgg tgatcggcgt cggcgacagg 480
gagcggatgc ctggggcgat cagctgggac gagctcctcg ccgcggcgga ccgcaccggc 540
gccggggtgg tgccggtgga cgcggcgcag cagtccgacc tgtgcgcgct cccctactcc 600
tccggcacca ccggcgtgtc caagggcgtg atgctgagcc accgcaacct ggtgtccaac 660
ctctgctcgt ccatgttcgc cgtggcgccg gagacggccg ggcaggtggt gacgctgggg 720
ctcatgccgt tcttccacat ctacggcatc accggcatct gctgcgccac gctccggcac 780
aagggcacgg tggtggtgat ggaccgcttc gacctccgca cgttcctccg tgcgctcgtc 840
gaccaccgcg tcatgttcgc gccgctggtt ccccccgtga tgctcgccat ggtcaagagc 900
cccgtcgccg acgagttcga cctctccgac ctcgccctca agtccgtcat gaccgccgcc 960
gcgccgctcg cccccgacct cctcgccgcg ttccagcgca agttccccgg cgtgcaggtg 1020
gaggaagcct acggcctcac cgagcacagc tgcatcaccc tcacgcacgc cgccggcgac 1080
ggccacggcc acgtcgccaa gaagagctcg gtggggttca tcctgccgaa cctggaggtg 1140
aagttcgtgg acccggacac cgggaggtcg ctgccggcga acacgccggg ggagctgtgc 1200
gtgcggagcc agagcgtgat gcaggggtac tacaagagga aggaggagac ggagcgcacg 1260
gtggacggca aggggtggct gcacaccggc gacgtcgggt acatcgacgg cgacggcgac 1320
gtgttcatcg tggacaggat caaggagctg atcaagtaca aggggtttca ggtcgccccc 1380
gccgagctcg aggccgtcct cctctcccac ccctccgttg aggacgccgc cgtcttcggg 1440
taacaccctt cttcttcttc ttctctgacc gtcgaaactt caacagttga ttctggagta 1500
aagttatgaa gcagtcaaaa cccagcttta tatttctagt ttattttgtg agatcatttc 1560
agccagcttc attctaattt tgtatggagt ttaaactttt tagttggatt ttaattttaa 1620
aaagatggaa ttgtagatgg agcttttgcc atgtcctaaa gccatgcatg catggatacg 1680
caaggtgccg gacgaggagg ccggcgaggt gccggtggcg tgcgtggtgc ggcggcacgg 1740
tgcggaggag ggggaggagg agatagtggc gtacgtggcg gagagggtgg cgtcgtacaa 1800
gcgggtccgg gtgctgcaca tcgtcgacgc catccccaag tcggtgtccg ggaagatcct 1860
gaggaggcag cttagggacg agttcatcaa gaggatgaaa ccgtcagctt ga 1912
<210> 9
<211> 522
<212> PRT
<213>Rice（Oryza sativa ssp.indica）
<400> 9
Met Gly Asp Ala Ala Val Pro Ala Met Val Val Glu Glu Glu Glu Gln
1 5 10 15
Glu His Val Phe Arg Ser Arg Phe Pro Pro Val Ala Val Pro Asp Gly
20 25 30
Val Thr Val Pro Glu Phe Val Leu Asp Gly Ala Glu Ala Tyr Ala Asp
35 40 45
Arg Val Ala Leu Val Glu Ala Ala Ala Gly Gly Arg Ser Tyr Thr Tyr
50 55 60
Gly Glu Val Ala Arg Asp Thr Ala Arg Phe Ala Arg Ala Leu Arg Ser
65 70 75 80
Val Gly Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu
85 90 95
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
100 105 110
Phe Ser Gly Val Asn Pro Arg Ala Leu Ala Ala Glu Ile Lys Lys Gln
115 120 125
Val Glu Asp Ser Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Phe
130 135 140
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Val Gly Asp Arg
145 150 155 160
Glu Arg Met Pro Gly Ala Ile Ser Trp Asp Glu Leu Leu Ala Ala Ala
165 170 175
Asp Arg Thr Gly Ala Gly Val Val Pro Val Asp Ala Ala Gln Gln Ser
180 185 190
Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys
195 200 205
Gly Val Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser
210 215 220
Met Phe Ala Val Ala Pro Glu Thr Ala Gly Gln Val Val Thr Leu Gly
225 230 235 240
Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala
245 250 255
Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu
260 265 270
Arg Thr Phe Leu Arg Ala Leu Val Asp His Arg Val Met Phe Ala Pro
275 280 285
Leu Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Asp
290 295 300
Glu Phe Asp Leu Ser Asp Leu Ala Leu Lys Ser Val Met Thr Ala Ala
305 310 315 320
Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Gln Arg Lys Phe Pro
325 330 335
Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile
340 345 350
Thr Leu Thr His Ala Ala Gly Asp Gly His Gly His Val Ala Lys Lys
355 360 365
Ser Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp
370 375 380
Pro Asp Thr Gly Arg Ser Leu Pro Ala Asn Thr Pro Gly Glu Leu Cys
385 390 395 400
Val Arg Ser Gln Ser Val Met Gln Gly Tyr Tyr Lys Arg Lys Glu Glu
405 410 415
Thr Glu Arg Thr Val Asp Gly Lys Gly Trp Leu His Thr Gly Asp Val
420 425 430
Gly Tyr Ile Asp Gly Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys
435 440 445
Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu
450 455 460
Ala Val Leu Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe Gly
465 470 475 480
Trp Ser Phe Cys His Val Leu Lys Pro Cys Met His Gly Tyr Ala Arg
485 490 495
Cys Arg Thr Arg Arg Pro Ala Arg Cys Arg Trp Arg Ala Trp Cys Gly
500 505 510
Gly Thr Val Arg Arg Arg Gly Arg Arg Arg
515 520
<210> 10
<211> 2101
<212> DNA
<213>Two fringe false bromegrass（Brachypodium distachyum）
<400> 10
aaggccatga cccaaccgaa ccttacctac accccacttg tcttggcaac acacaagaac 60
tgtgtcacca ttaccagcat gtcatcctcg tcttggtctc gtcactcctc ggcgaagccc 120
ctgctggtct ctacaaatgc aagcagagcc gcagccttcc cgctcaccac cactaacacc 180
gtcctgctgg aagcctccaa caacaaccag cagcagcaga tcatcagcat gggtgacgcg 240
gccatcgccg tgatggatcc agaagaggac tcggaagtag aggagcacat cttccggagc 300
cggttcccgc cggtgtccgt tccggacggc gtcacggttc ccgacttcgt gatgtccggc 360
gccgaggcgt acgccgacaa agtggccctg gttgaagccg cccccggcgg gcgctcctac 420
acctacggcg agatgtcccg cgacatcgcg cgcttcgcca gggcgctgcg gtctgtgggc 480
atccgcaagg gccacgtcat cgtggtcgtg ctgccgaacc tggccgtgta ccccgtggtg 540
tccctgggcg tgatggccgc cggggccgtg ttctccggcg tgaacccgcg cgctctggcc 600
gccgagatcc ggaagcaggt ggaggactcg gaggccaagc tggtggtcgc caacgaggtg 660
gcctacgaca aagtcaaaga cgtgggcgtg ccagtcatcg gcattacgag caacaacaac 720
atgcccggcg cgatcagctg ggacgagctc ctggccgcgg cggaccgcac gggcgcgccg 780
gtggtaccgc tggacccggt tctgcagtcc gacctgtgcg cgctgcctta ctcctccggc 840
accacgggtg tctccaaggg cgtgatgctg agccacggca acctggtctc caacctctgc 900
tcctccatgt tcgccgtcgg gcccgagctg cgtggccagg tggtaaccct gggcctcatg 960
ccattcttcc acatctacgg catcaccggc atctgctgcg ccacgctgcg gcacaagggc 1020
accgtggtcg tcatggaccg cttcgacctg cgcactttcc tcggcgctct ggtcacgcat 1080
cgggtcatgt tcgcgcccgt ggttcccccc gtaatgctgg ccatggtcaa gaaccccatc 1140
gccgaagagt tcgatctctc agggctggct ctcaagtcag tcatgacagc cgcggctccg 1200
ctagcgccgg atctcctgga ggcgttccag aagaagttcc ctggggttca ggtggaagaa 1260
gcctacgggc tcacggagca cagctgcgtc acgctcacgc acgccgggga tgacccggag 1320
aagggccaca tcgccaagaa gaactcggtc gggttcatcc tgcccaacct ggaggtgaag 1380
ttcgtggatc ctgacactgg ccgctcgttg cccaagaaca cgccggggga gctctgcgtc 1440
cggagccagt gcgtcatgca ggggtactac aagaagaagg cggagacgga gcgcaccatc 1500
gactccaaag gctggctgca caccggagac gtcggctaca tcgacgacga cggcgatgtc 1560
ttcatcgtcg acaggatcaa ggaactcatc aagtacaagg gcttccaggt cgctccggcg 1620
gagctcgagg ccattctcct gtcccatcct tccgtcgaag atgcagccgt cttcgggtaa 1680
gacattatgt ggcattggct ggccatttgt aaagtgtaaa caacgtgtta actgaaattt 1740
tcatttgttg cagactgccg gacgaggagg caggagaggt cccggtgtct tgcgtggtgc 1800
ggcggagcgg cgcggcggag agcgaggcgg acatcatggg gtacgtggcg tcgcgcgtgg 1860
cgtcgtacaa gaggctccgg atgctgcacc ttgtcgacgc cattcccaaa tcggtctccg 1920
gcaagatcct gcggaggcaa ctcagggacg agttcatcaa gatgatcaaa ctggcggctt 1980
aataattaat gattgtgatt ggaatcgcca ctgcttacat cctagcctgc atttagaaga 2040
acaagaaggc atgatgttac tttcaatttt tcatatgaac atggttggaa aacgtatagt 2100
a 2101
<210> 11
<211> 632
<212> PRT
<213>Two fringe false bromegrass（Brachypodium distachyum）
<400> 11
Met Thr Gln Pro Asn Leu Thr Tyr Thr Pro Leu Val Leu Ala Thr His
1 5 10 15
Lys Asn Cys Val Thr Ile Thr Ser Met Ser Ser Ser Ser Trp Ser Arg
20 25 30
His Ser Ser Ala Lys Pro Leu Leu Val Ser Thr Asn Ala Ser Arg Ala
35 40 45
Ala Ala Phe Pro Leu Thr Thr Thr Asn Thr Val Leu Leu Glu Ala Ser
50 55 60
Asn Asn Asn Gln Gln Gln Gln Ile Ile Ser Met Gly Asp Ala Ala Ile
65 70 75 80
Ala Val Met Asp Pro Glu Glu Asp Ser Glu Val Glu Glu His Ile Phe
85 90 95
Arg Ser Arg Phe Pro Pro Val Ser Val Pro Asp Gly Val Thr Val Pro
100 105 110
Asp Phe Val Met Ser Gly Ala Glu Ala Tyr Ala Asp Lys Val Ala Leu
115 120 125
Val Glu Ala Ala Pro Gly Gly Arg Ser Tyr Thr Tyr Gly Glu Met Ser
130 135 140
Arg Asp Ile Ala Arg Phe Ala Arg Ala Leu Arg Ser Val Gly Ile Arg
145 150 155 160
Lys Gly His Val Ile Val Val Val Leu Pro Asn Leu Ala Val Tyr Pro
165 170 175
Val Val Ser Leu Gly Val Met Ala Ala Gly Ala Val Phe Ser Gly Val
180 185 190
Asn Pro Arg Ala Leu Ala Ala Glu Ile Arg Lys Gln Val Glu Asp Ser
195 200 205
Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Tyr Asp Lys Val Lys
210 215 220
Asp Val Gly Val Pro Val Ile Gly Ile Thr Ser Asn Asn Asn Met Pro
225 230 235 240
Gly Ala Ile Ser Trp Asp Glu Leu Leu Ala Ala Ala Asp Arg Thr Gly
245 250 255
Ala Pro Val Val Pro Leu Asp Pro Val Leu Gln Ser Asp Leu Cys Ala
260 265 270
Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys Gly Val Met Leu
275 280 285
Ser His Gly Asn Leu Val Ser Asn Leu Cys Ser Ser Met Phe Ala Val
290 295 300
Gly Pro Glu Leu Arg Gly Gln Val Val Thr Leu Gly Leu Met Pro Phe
305 310 315 320
Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala Thr Leu Arg His
325 330 335
Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu Arg Thr Phe Leu
340 345 350
Gly Ala Leu Val Thr His Arg Val Met Phe Ala Pro Val Val Pro Pro
355 360 365
Val Met Leu Ala Met Val Lys Asn Pro Ile Ala Glu Glu Phe Asp Leu
370 375 380
Ser Gly Leu Ala Leu Lys Ser Val Met Thr Ala Ala Ala Pro Leu Ala
385 390 395 400
Pro Asp Leu Leu Glu Ala Phe Gln Lys Lys Phe Pro Gly Val Gln Val
405 410 415
Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Val Thr Leu Thr His
420 425 430
Ala Gly Asp Asp Pro Glu Lys Gly His Ile Ala Lys Lys Asn Ser Val
435 440 445
Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp Pro Asp Thr
450 455 460
Gly Arg Ser Leu Pro Lys Asn Thr Pro Gly Glu Leu Cys Val Arg Ser
465 470 475 480
Gln Cys Val Met Gln Gly Tyr Tyr Lys Lys Lys Ala Glu Thr Glu Arg
485 490 495
Thr Ile Asp Ser Lys Gly Trp Leu His Thr Gly Asp Val Gly Tyr Ile
500 505 510
Asp Asp Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys Glu Leu Ile
515 520 525
Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu Ala Ile Leu
530 535 540
Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe Gly Leu Pro Asp
545 550 555 560
Glu Glu Ala Gly Glu Val Pro Val Ser Cys Val Val Arg Arg Ser Gly
565 570 575
Ala Ala Glu Ser Glu Ala Asp Ile Met Gly Tyr Val Ala Ser Arg Val
580 585 590
Ala Ser Tyr Lys Arg Leu Arg Met Leu His Leu Val Asp Ala Ile Pro
595 600 605
Lys Ser Val Ser Gly Lys Ile Leu Arg Arg Gln Leu Arg Asp Glu Phe
610 615 620
Ile Lys Met Ile Lys Leu Ala Ala
625 630
<210> 12
<211> 1985
<212> DNA
<213>Millet（Setaria italica）
<400> 12
ctcgcttcta cccacaccca agaagaaccc accagcaaca acagccagca gcagctcagg 60
atgggcgacg ccgccatcgc cgttgtgcgt gaggacgagg aggagcacat cttccggagc 120
cggttcccgc cagtgtcggt gccggacgac gtgacggtgc ccgagttcgt gctggagggc 180
gccgaggctt acgctgacaa ggtggcgctg gtggaggccg cgccgggggg ccggtcctac 240
acctacggcg aggtggcccg tgacgtggcc cggttcgccc gggcgctccg gtccgtcggc 300
gtccgcaagg gccacgtcgt ggtggttgct ctcccgaacc tcgccgtgta ccccgtcgtc 360
tcgctgggga tcatgtctgc cggcgcggtg ttctccggcg tgaacccgcg cgccatcgcc 420
gccgagatca ggaagcaggt ggaggactcg gaggccaagc tcgtggtcgc caacgaggtg 480
gccttcgaca aggtgaagga cgccggcgtg ccggtaatcg gcatcggcga cgcggagcgt 540
atgcccggcg cgatcgggtg ggacgagctc ctcgtcgccg ctgaccggac cggcgcgccg 600
gtggtggcgc tggagcccgt gcagcagtcg gacctgtgcg cgctgcccta ctcgtccggg 660
acgacggggg tctccaaggg cgtgatgctg agccaccgga acctggtgtc caacctctgc 720
tcctccatgt tcgccgtcgg ggaggagctc gccgggcagg tggtgacgct ggggctcatg 780
cccttcttcc acatctacgg catcaccggc atctgctgcg cgacgctgcg gcacaagggc 840
acggtggtgg tgatggaccg cttcgacctg cgcaccttcc tgagcgcgct ggtggcgcac 900
cgcgtcatgt tcgcgcccct cgtgccgccg gtcatgctgg ccatggtgaa gagccccgtc 960
gccgccgagt tcgacctctc cggtctcgcc ctcaggtccg tcatgaccgc cgccgcgccg 1020
ctggcgcccg acctcctcgc ggcgttccag gagaagttcc cgggggtgca ggtggaggag 1080
gcgtacgggc tgacggagca cagctgcatc acgctgacgc acgccggcgg agacccgcag 1140
cggggacccg tacagatcgc caagaagaac tccgtcggct tcatcctgcc caacctggag 1200
gtgaagttcg ttgacccgga cacgggccgg tcgctgccca agaacacccc cggcgaggtc 1260
tgcgtccgga gccaggccgt catgcagggg tactacaaga agaaggagga gaccgagcgc 1320
accatcgacg ccaagggctg gctccacacc ggcgacgtcg gctacatcga cgacgatggc 1380
gacgtcttca tcgtcgaccg gatcaaggag ctcatcaagt acaagggctt ccaggtcgcg 1440
ccggccgagc tggaggccat cctcctgtcc cacccgtcag tggaagacgc ggcggtcttc 1500
gggtaagcag cagcctgatc gtacagggat ttgaccgaac gttgactgag ctcgtgtttt 1560
tcttgggtcg tcgtcgtggc aggctgccgg acgaggaggc cggcgaggtc ccggcgtcgt 1620
gcgtggtgcg gcggcgcggc gcggcggaga gcgaggcgga cgtgatggcg tacgtggcgg 1680
cgcgggtggc gtcgtacaag aagctccggc tgctgcggtt cgtggacgcc atccccaagt 1740
cggtgtccgg caagatcctg cggaggcagc tcagggacga gttcctcgag agggccaagg 1800
cggccgccgc ggcggagggc aagtagccac gctcaaatta aaatccctgc ttggagcatg 1860
tatacgagcg ctaggcaaaa tgcgagttca aacgagtgcc actagaggtg ttgtcaatta 1920
tgtacttgaa caagtgctat atccggttgc agaaaccgtt tgagaacaac tattttatga 1980
gtgta 1985
<210> 13
<211> 561
<212> PRT
<213>Millet（Setaria italica）
<400> 13
Met Gly Asp Ala Ala Ile Ala Val Val Arg Glu Asp Glu Glu Glu His
1 5 10 15
Ile Phe Arg Ser Arg Phe Pro Pro Val Ser Val Pro Asp Asp Val Thr
20 25 30
Val Pro Glu Phe Val Leu Glu Gly Ala Glu Ala Tyr Ala Asp Lys Val
35 40 45
Ala Leu Val Glu Ala Ala Pro Gly Gly Arg Ser Tyr Thr Tyr Gly Glu
50 55 60
Val Ala Arg Asp Val Ala Arg Phe Ala Arg Ala Leu Arg Ser Val Gly
65 70 75 80
Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu Ala Val
85 90 95
Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val Phe Ser
100 105 110
Gly Val Asn Pro Arg Ala Ile Ala Ala Glu Ile Arg Lys Gln Val Glu
115 120 125
Asp Ser Glu Ala Lys Leu Val Val Ala Asn Glu Val Ala Phe Asp Lys
130 135 140
Val Lys Asp Ala Gly Val Pro Val Ile Gly Ile Gly Asp Ala Glu Arg
145 150 155 160
Met Pro Gly Ala Ile Gly Trp Asp Glu Leu Leu Val Ala Ala Asp Arg
165 170 175
Thr Gly Ala Pro Val Val Ala Leu Glu Pro Val Gln Gln Ser Asp Leu
180 185 190
Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys Gly Val
195 200 205
Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser Met Phe
210 215 220
Ala Val Gly Glu Glu Leu Ala Gly Gln Val Val Thr Leu Gly Leu Met
225 230 235 240
Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala Thr Leu
245 250 255
Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu Arg Thr
260 265 270
Phe Leu Ser Ala Leu Val Ala His Arg Val Met Phe Ala Pro Leu Val
275 280 285
Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Ala Glu Phe
290 295 300
Asp Leu Ser Gly Leu Ala Leu Arg Ser Val Met Thr Ala Ala Ala Pro
305 310 315 320
Leu Ala Pro Asp Leu Leu Ala Ala Phe Gln Glu Lys Phe Pro Gly Val
325 330 335
Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile Thr Leu
340 345 350
Thr His Ala Gly Gly Asp Pro Gln Arg Gly Pro Val Gln Ile Ala Lys
355 360 365
Lys Asn Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val
370 375 380
Asp Pro Asp Thr Gly Arg Ser Leu Pro Lys Asn Thr Pro Gly Glu Val
385 390 395 400
Cys Val Arg Ser Gln Ala Val Met Gln Gly Tyr Tyr Lys Lys Lys Glu
405 410 415
Glu Thr Glu Arg Thr Ile Asp Ala Lys Gly Trp Leu His Thr Gly Asp
420 425 430
Val Gly Tyr Ile Asp Asp Asp Gly Asp Val Phe Ile Val Asp Arg Ile
435 440 445
Lys Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu
450 455 460
Glu Ala Ile Leu Leu Ser His Pro Ser Val Glu Asp Ala Ala Val Phe
465 470 475 480
Gly Leu Pro Asp Glu Glu Ala Gly Glu Val Pro Ala Ser Cys Val Val
485 490 495
Arg Arg Arg Gly Ala Ala Glu Ser Glu Ala Asp Val Met Ala Tyr Val
500 505 510
Ala Ala Arg Val Ala Ser Tyr Lys Lys Leu Arg Leu Leu Arg Phe Val
515 520 525
Asp Ala Ile Pro Lys Ser Val Ser Gly Lys Ile Leu Arg Arg Gln Leu
530 535 540
Arg Asp Glu Phe Leu Glu Arg Ala Lys Ala Ala Ala Ala Ala Glu Gly
545 550 555 560
Lys
<210> 14
<211> 2166
<212> DNA
<213>Corn (Zea mays)
<400> 14
caagccgaac tcttttgtga gctcaaaggc catgacccaa caaccaaaca tcacctgcac 60
accacttgtc ttgacacacc acacacaaga attgtatcac cgctgccagc atgccctcac 120
cttcctccct ccatcacttc tcgccaaggc tcccgctcgc ctctacaaat ggcaaggcca 180
cgcccttcca cttccaccaa ttcactacca acgacgtaca agccaccacc aaccagcagg 240
agctcatccg gatgggcgac gcggctattg ccgtcgtgca tgaggctgat gaggaggagc 300
aggagcacat cttccggagc cggttcccgc ctgtggacct gccggacgac gtcactgtgc 360
cggagttcgt actggccggc gccgaggcct acgcggacaa ggtggcgctc gtggaggccg 420
cgccgggggg gcggtcctac acctacggcg aggtggcccg ggacgtggcg cggttcgcca 480
gggcgctgcg gtccgtgggc gtccgcaagg gccacgtagt ggtggtcgcg ctcccgaacc 540
tcgcggtgta ccccgtggtg agccttggga tcatgtccgc aggcgcggtc ttctctggtg 600
tgaacccgcg cgccatcgcc gcggagatca agaagcaggt ggaagactcg gatgccaagc 660
tcgtggtcac caacgaggtt gcctacgaca aggtgaagga cgcgggcgtg ccggtgatcg 720
gcatcgggga cgacatggag cgcctccccg gtgcgatcag ctgggacgag ctcctcgccg 780
ccgcggaccg cacgggcgcg ccggtggtgg cgctggaccc ggtgcagcag tccgacctgt 840
gcgcactccc ctactcgtcc ggcacgacgg gggtgtccaa gggcgtgatg ctgagccacc 900
ggaacctggt ctccaacctc tgctcgtcta tgttcgcggt cggggaggag ctggtcggtc 960
aggtcgtcac gctggggctc atgcctttct tccacatcta cggcatcacc ggcatctgct 1020
gctccacgct gcggcacaag ggcactgtgg tggtgatgga ccgcttcgac ctgcgcacct 1080
tcctgggcgc gctggtgacg caccgcgtga tgttcgcgcc ggtggtgccg cccgtgatgc 1140
tggccatggt gaagagcccc gtggccgacg atttcgacct ctccggcctc gccctcaggt 1200
ccatcatgac ggctgccgcg cccctcgcgc cggacctcct cgcggccttc gagaagaagt 1260
tcccgggcgt gcaggtggag gaggcgtacg ggctcacgga gcacagctgc atcacgctga 1320
cgcacgccgc gtccggcgac gacgcgcggc aggggcccgt ccaggtcgcc aagaagaact 1380
cggttgggtt catcctgccc aacctggagg tgaagttcgt cgaccccgac acgggccggt 1440
cgctgcccaa gaacacgccc ggcgagatct gcgtccggag tcaggccgtg atgcagggct 1500
actacaggaa gaaggaggag acggagcgca ccatcgatgc caaggggtgg ctccataccg 1560
gcgacgtcgg ctacatcgac gacgacggcg acgtgttcat cgtcgaccgg atcaaggagc 1620
tcatcaagta caagggcttc caggtcgctc ctgccgagct ggaggccatt ctcctgtccc 1680
acccgtcggt ccaagatgcg gccgtcttcg ggtaagctat cgatcgagca tgaacgagtg 1740
cagttcacag cgacgcacta gacagagaga cttgaccgct gtgcttggtg ctgcgtcatg 1800
ccatgcagcc tgccggacga ggaggctggc gaggtcccgg tgtcgtgcgt ggtgcggcgg 1860
tgtggcgcgt cggagagcga agcggacatc atggcgtacg tggcgggccg cgtggcgtcg 1920
tacaagaagc tccggctgct gcagttcgtg gacgtcatcc acaagtcggt gtcaggcaag 1980
atcctgcggc ggcagctccg ggacgagttc gttagcagga ccaaaacggc ggcagcctag 2040
ctctagcgag agctagacag tccaatatgc cagttacata cttacattgc acacgtacat 2100
caaacgaata aatgtcaagc tattctaaat tttaatacta ctgcaatggt gatgctcaat 2160
tatgca 2166
<210> 15
<211> 1986
<212> DNA
<213>Corn (Zea mays)
<400> 15
aaggccacgc ccttccactt ccaccaattc actaccaacg acgtacaagc caccaccaac 60
cagcaggagc tcatccggat gggcgacgcg gctattgccg tcgtgcatga ggctgatgag 120
gaggagcagg agcacatctt ccggagccgg ttcccgcctg tggacctgcc ggacgacgtc 180
actgtgccgg agttcgtact ggccggcgcc gaggcctacg cggacaaggt ggcgctcgtg 240
gaggccgcgc cgggggggcg gtcctacacc tacggcgagg tggcccggga cgtggcgcgg 300
ttcgccaggg cgctgcggtc cgtgggcgtc cgcaagggcc acgtagtggt ggtcgcgctc 360
ccgaacctcg cggtgtaccc cgtggtgagc cttgggatca tgtccgcagg cgcggtcttc 420
tctggtgtga acccgcgcgc catcgccgcg gagatcaaga agcaggtgga agactcggat 480
gccaagctcg tggtcaccaa cgaggttgcc tacgacaagg tgaaggacgc gggcgtgccg 540
gtgatcggca tcggggacga catggagcgc ctccccggtg cgatcagctg ggacgagctc 600
ctcgccgccg cggaccgcac gggcgcgccg gtggtggcgc tggacccggt gcagcagtcc 660
gacctgtgcg cactccccta ctcgtccggc acgacggggg tgtccaaggg cgtgatgctg 720
agccaccgga acctggtctc caacctctgc tcgtctatgt tcgcggtcgg ggaggagctg 780
gtcggtcagg tcgtcacgct ggggctcatg cctttcttcc acatctacgg catcaccggc 840
atctgctgct ccacgctgcg gcacaagggc actgtggtgg tgatggaccg cttcgacctg 900
cgcaccttcc tgggcgcgct ggtgacgcac cgcgtgatgt tcgcgccggt ggtgccgccc 960
gtgatgctgg ccatggtgaa gagccccgtg gccgacgatt tcgacctctc cggcctcgcc 1020
ctcaggtcca tcatgacggc tgccgcgccc ctcgcgccgg acctcctcgc ggccttcgag 1080
aagaagttcc cgggcgtgca ggtggaggag gcgtacgggc tcacggagca cagctgcatc 1140
acgctgacgc acgccgcgtc cggcgacgac gcgcggcagg ggcccgtcca ggtcgccaag 1200
aagaactcgg ttgggttcat cctgcccaac ctggaggtga agttcgtcga ccccgacacg 1260
ggccggtcgc tgcccaagaa cacgcccggc gagatctgcg tccggagtca ggccgtgatg 1320
cagggctact acaggaagaa ggaggagacg gagcgcacca tcgatgccaa ggggtggctc 1380
cataccggcg acgtcggcta catcgacgac gacggcgacg tgttcatcgt cgaccggatc 1440
aaggagctca tcaagtacaa gggcttccag gtcgctcctg ccgagctgga ggccattctc 1500
ctgtcccacc cgtcggtcca agatgcggcc gtcttcgggt aagctatcga tcgagcatga 1560
acgagtgcag ttcacagcga cgcactagac agagagactt gaccgctgtg cttggtgctg 1620
cgtcatgcca tgcagcctgc cggacgagga ggctggcgag gtcccggtgt cgtgcgtggt 1680
gcggcggtgt ggcgcgtcgg agagcgaagc ggacatcatg gcgtacgtgg cgggccgcgt 1740
ggcgtcgtac aagaagctcc ggctgctgca gttcgtggac gtcatccaca agtcggtgtc 1800
aggcaagatc ctgcggcggc agctccggga cgagttcgtt agcaggacca aaacggcggc 1860
agcctagctc tagcgagagc tagacagtcc aatatgccag ttacatactt acattgcaca 1920
cgtacatcaa acgaataaat gtcaagctat tctaaatttt aatactactg caatggtgat 1980
gctcaa 1986
<210> 16
<211> 1976
<212> DNA
<213>Corn (Zea mays)
<400> 16
ccaccaccac cagcagcagc tgaggatggg cgacgcggcc atcgccgccg tgcatttgca 60
tgagtctgag gaggagcaca tcttccggag ccggttcccg cccgtggccg taccagacga 120
cgtcaccgtg ccggagttcg tgctggcgga cgccgaggcc tacgcggaca agacggcgct 180
cgtggaggcc gcgccgggtg gccggtccta cacctacggc gagctggtcc gggacgtggc 240
gcggttcgcc agggcgctgc ggtccatcgg cgtccgcagg ggccacgtcg tggtggtcgc 300
gctcccgaac ctggcggtgt accccgtggt gagcctcggg atcatgtccg ccggagcggt 360
cttctccggc gtgaacccgc gcgccgtcgc cgccgagatc aagaagcagg tggaggactc 420
cgaggccagg ctcgtggtcg ccgacgcggt ggcctacgac aaggtgaagg acgctggcgt 480
gccggtgatc ggcatcgggg acgtggcgcg gcttcccggc gccataggct gggacgagct 540
cctcgccatg gcggaccgcg cgggcgcgcc ggtggtggcg cttgagccgg cgcagcagtc 600
cgacctgtgc gcgctcccct actcgtctgg tacgacgggg gtgtccaagg gcgtgatgct 660
gagccaccgg aacctggtgt ccagcctctg ctcctccatg ttcgccgtcg ggcaggagct 720
ggtcgggcag gtggtcaccc tgggcctgat gcccttcttc cacatctacg gcatcaccgg 780
catctgctgc gccacgctgc ggcacaaggg cacggtggtg gtgatggacc gcttcgacct 840
gcgcgcgttc ctgggcgcgc tgctgacgca ccgcgtcatg ttcgcgcccg tcgtgccgcc 900
ggtcatgctg gccatggtga agagccccgt ggccgacgag ttcgacctgt ccggcctggc 960
cctcaggtcc gtcatgacgg ccgccgcgcc gctcgcgccg gacctcctgg cggcgttcga 1020
gcgcaagttc ccgggcgtgc aggtggagga ggcgtacggg ctcacggagc acagctgcat 1080
cacgctgacg cacgccagcg gcggcggcga ggacgtgggg tcggcggtgc aggtcgccaa 1140
gaagaagtcg gtcggcttca tcctgcccaa cctggaggtg aagttcgtgg accccgacac 1200
ggggcggtcg ctgcccaaga acacgccggg ggagatctgc gtgcggagcc aggccgtgat 1260
gcagggctac tacaggaaga aggaggagac ggagcgcacc atcgacgccg cggggtggct 1320
ccacacgggc gacgtcgggt acatcgacga cgacggcgac gtgttcatcg tggaccgcat 1380
caaggagctc atcaagtaca agggcttcca agtcgcccct gccgagctgg aggccatcct 1440
gctgtctcac ccgtccgtcg aggacgccgc cgtcttcggg taagcgaccg agcggaccgc 1500
ggcatgcagt tggagattgt gcgtgtgtgt tcctgcgggt catcatgcat gtatgcgggc 1560
gcaggctgcc ggacgaggag gccggcgagg tcccggcgtc gtgcgtggtg cggcgacgtg 1620
gcgcgccgga gagcgaggcg gacatgatgg cgtacgtggc ggggcgcgtt gcgtcgtaca 1680
agaagctccg gctgctgcgc ttcgtggacg ccatccccaa gtcggtgtcc ggcaagatcc 1740
tgcggaggca gctcagggac gagttcgtca agaagacggc agcagcgtaa taatgcacat 1800
catcctgtgg gtgggtgctt gcttatacca gtgcaagatc ctgcattcgc cacttgatga 1860
agacaataat acaattaggg tacagtcaga tgttccaagc tactgataca attgttgttt 1920
ctgcaaacag tactccaaac tagtgcatat acattggcgt tgtggaccca aaaaaa 1976
<210> 17
<211> 636
<212> PRT
<213>Corn (Zea mays)
<400> 17
Met Thr Gln Gln Pro Asn Ile Thr Cys Thr Pro Leu Val Leu Thr Thr
1 5 10 15
Thr His Lys Asn Cys Ile Thr Ala Ala Ser Met Pro Ser Pro Ser Ser
20 25 30
Leu His His Phe Ser Pro Arg Leu Pro Leu Ala Ser Thr Asn Gly Lys
35 40 45
Ala Thr Pro Phe His Phe His Gln Phe Thr Thr Asn Asp Val Gln Ala
50 55 60
Thr Thr Asn Gln Gln Glu Leu Ile Arg Met Gly Asp Ala Ala Ile Ala
65 70 75 80
Val Val His Glu Ala Asp Glu Glu Glu Gln Glu His Ile Phe Arg Ser
85 90 95
Arg Phe Pro Pro Val Asp Leu Pro Asp Asp Val Thr Val Pro Glu Phe
100 105 110
Val Leu Ala Gly Ala Glu Ala Tyr Ala Asp Lys Val Ala Leu Val Glu
115 120 125
Ala Ala Pro Gly Gly Arg Ser Tyr Thr Tyr Gly Glu Val Ala Arg Asp
130 135 140
Val Ala Arg Phe Ala Arg Ala Leu Arg Ser Val Gly Val Arg Lys Gly
145 150 155 160
His Val Val Val Val Ala Leu Pro Asn Leu Ala Val Tyr Pro Val Val
165 170 175
Ser Leu Gly Ile Met Ser Ala Gly Ala Val Phe Ser Gly Val Asn Pro
180 185 190
Arg Ala Ile Ala Ala Glu Ile Lys Lys Gln Val Glu Asp Ser Asp Ala
195 200 205
Lys Leu Val Val Thr Asn Glu Val Ala Tyr Asp Lys Val Lys Asp Ala
210 215 220
Gly Val Pro Val Ile Gly Ile Gly Asp Asp Met Glu Arg Leu Pro Gly
225 230 235 240
Ala Ile Ser Trp Asp Glu Leu Leu Ala Ala Ala Asp Arg Thr Gly Ala
245 250 255
Pro Val Val Ala Leu Asp Pro Val Gln Gln Ser Asp Leu Cys Ala Leu
260 265 270
Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys Gly Val Met Leu Ser
275 280 285
His Arg Asn Leu Val Ser Asn Leu Cys Ser Ser Met Phe Ala Val Gly
290 295 300
Glu Glu Leu Val Gly Gln Val Val Thr Leu Gly Leu Met Pro Phe Phe
305 310 315 320
His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ser Thr Leu Arg His Lys
325 330 335
Gly Thr Val Val Val Met Asp Arg Phe Asp Leu Arg Thr Phe Leu Gly
340 345 350
Ala Leu Val Thr His Arg Val Met Phe Ala Pro Val Val Pro Pro Val
355 360 365
Met Leu Ala Met Val Lys Ser Pro Val Ala Asp Asp Phe Asp Leu Ser
370 375 380
Gly Leu Ala Leu Arg Ser Ile Met Thr Ala Ala Ala Pro Leu Ala Pro
385 390 395 400
Asp Leu Leu Ala Ala Phe Glu Lys Lys Phe Pro Gly Val Gln Val Glu
405 410 415
Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile Thr Leu Thr His Ala
420 425 430
Ala Ser Gly Asp Asp Ala Arg Gln Gly Pro Val Gln Val Ala Lys Lys
435 440 445
Asn Ser Val Gly Phe Ile Leu Pro Asn Leu Glu Val Lys Phe Val Asp
450 455 460
Pro Asp Thr Gly Arg Ser Leu Pro Lys Asn Thr Pro Gly Glu Ile Cys
465 470 475 480
Val Arg Ser Gln Ala Val Met Gln Gly Tyr Tyr Arg Lys Lys Glu Glu
485 490 495
Thr Glu Arg Thr Ile Asp Ala Lys Gly Trp Leu His Thr Gly Asp Val
500 505 510
Gly Tyr Ile Asp Asp Asp Gly Asp Val Phe Ile Val Asp Arg Ile Lys
515 520 525
Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Ala Glu Leu Glu
530 535 540
Ala Ile Leu Leu Ser His Pro Ser Val Gln Asp Ala Ala Val Phe Gly
545 550 555 560
Leu Pro Asp Glu Glu Ala Gly Glu Val Pro Val Ser Cys Val Val Arg
565 570 575
Arg Cys Gly Ala Ser Glu Ser Glu Ala Asp Ile Met Ala Tyr Val Ala
580 585 590
Gly Arg Val Ala Ser Tyr Lys Lys Leu Arg Leu Leu Gln Phe Val Asp
595 600 605
Val Ile His Lys Ser Val Ser Gly Lys Ile Leu Arg Arg Gln Leu Arg
610 615 620
Asp Glu Phe Val Ser Arg Thr Lys Thr Ala Ala Ala
625 630 635
<210> 18
<211> 610
<212> PRT
<213>Corn (Zea mays)
<400> 18
Met Pro Ser Pro Ser Ser Leu His His Phe Ser Pro Arg Leu Pro Leu
1 5 10 15
Ala Ser Thr Asn Gly Lys Ala Thr Pro Phe His Phe His Gln Phe Thr
20 25 30
Thr Asn Asp Val Gln Ala Thr Thr Asn Gln Gln Glu Leu Ile Arg Met
35 40 45
Gly Asp Ala Ala Ile Ala Val Val His Glu Ala Asp Glu Glu Glu Gln
50 55 60
Glu His Ile Phe Arg Ser Arg Phe Pro Pro Val Asp Leu Pro Asp Asp
65 70 75 80
Val Thr Val Pro Glu Phe Val Leu Ala Gly Ala Glu Ala Tyr Ala Asp
85 90 95
Lys Val Ala Leu Val Glu Ala Ala Pro Gly Gly Arg Ser Tyr Thr Tyr
100 105 110
Gly Glu Val Ala Arg Asp Val Ala Arg Phe Ala Arg Ala Leu Arg Ser
115 120 125
Val Gly Val Arg Lys Gly His Val Val Val Val Ala Leu Pro Asn Leu
130 135 140
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
145 150 155 160
Phe Ser Gly Val Asn Pro Arg Ala Ile Ala Ala Glu Ile Lys Lys Gln
165 170 175
Val Glu Asp Ser Asp Ala Lys Leu Val Val Thr Asn Glu Val Ala Tyr
180 185 190
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Ile Gly Asp Asp
195 200 205
Met Glu Arg Leu Pro Gly Ala Ile Ser Trp Asp Glu Leu Leu Ala Ala
210 215 220
Ala Asp Arg Thr Gly Ala Pro Val Val Ala Leu Asp Pro Val Gln Gln
225 230 235 240
Ser Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser
245 250 255
Lys Gly Val Met Leu Ser His Arg Asn Leu Val Ser Asn Leu Cys Ser
260 265 270
Ser Met Phe Ala Val Gly Glu Glu Leu Val Gly Gln Val Val Thr Leu
275 280 285
Gly Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys
290 295 300
Ser Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp
305 310 315 320
Leu Arg Thr Phe Leu Gly Ala Leu Val Thr His Arg Val Met Phe Ala
325 330 335
Pro Val Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala
340 345 350
Asp Asp Phe Asp Leu Ser Gly Leu Ala Leu Arg Ser Ile Met Thr Ala
355 360 365
Ala Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Glu Lys Lys Phe
370 375 380
Pro Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys
385 390 395 400
Ile Thr Leu Thr His Ala Ala Ser Gly Asp Asp Ala Arg Gln Gly Pro
405 410 415
Val Gln Val Ala Lys Lys Asn Ser Val Gly Phe Ile Leu Pro Asn Leu
420 425 430
Glu Val Lys Phe Val Asp Pro Asp Thr Gly Arg Ser Leu Pro Lys Asn
435 440 445
Thr Pro Gly Glu Ile Cys Val Arg Ser Gln Ala Val Met Gln Gly Tyr
450 455 460
Tyr Arg Lys Lys Glu Glu Thr Glu Arg Thr Ile Asp Ala Lys Gly Trp
465 470 475 480
Leu His Thr Gly Asp Val Gly Tyr Ile Asp Asp Asp Gly Asp Val Phe
485 490 495
Ile Val Asp Arg Ile Lys Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val
500 505 510
Ala Pro Ala Glu Leu Glu Ala Ile Leu Leu Ser His Pro Ser Val Gln
515 520 525
Asp Ala Ala Val Phe Gly Leu Pro Asp Glu Glu Ala Gly Glu Val Pro
530 535 540
Val Ser Cys Val Val Arg Arg Cys Gly Ala Ser Glu Ser Glu Ala Asp
545 550 555 560
Ile Met Ala Tyr Val Ala Gly Arg Val Ala Ser Tyr Lys Lys Leu Arg
565 570 575
Leu Leu Gln Phe Val Asp Val Ile His Lys Ser Val Ser Gly Lys Ile
580 585 590
Leu Arg Arg Gln Leu Arg Asp Glu Phe Val Ser Arg Thr Lys Thr Ala
595 600 605
Ala Ala
610
<210> 19
<211> 559
<212> PRT
<213>Corn (Zea mays)
<400> 19
Met Gly Asp Ala Ala Ile Ala Ala Val His Leu His Glu Ser Glu Glu
1 5 10 15
Glu His Ile Phe Arg Ser Arg Phe Pro Pro Val Ala Val Pro Asp Asp
20 25 30
Val Thr Val Pro Glu Phe Val Leu Ala Asp Ala Glu Ala Tyr Ala Asp
35 40 45
Lys Thr Ala Leu Val Glu Ala Ala Pro Gly Gly Arg Ser Tyr Thr Tyr
50 55 60
Gly Glu Leu Val Arg Asp Val Ala Arg Phe Ala Arg Ala Leu Arg Ser
65 70 75 80
Ile Gly Val Arg Arg Gly His Val Val Val Val Ala Leu Pro Asn Leu
85 90 95
Ala Val Tyr Pro Val Val Ser Leu Gly Ile Met Ser Ala Gly Ala Val
100 105 110
Phe Ser Gly Val Asn Pro Arg Ala Val Ala Ala Glu Ile Lys Lys Gln
115 120 125
Val Glu Asp Ser Glu Ala Arg Leu Val Val Ala Asp Ala Val Ala Tyr
130 135 140
Asp Lys Val Lys Asp Ala Gly Val Pro Val Ile Gly Ile Gly Asp Val
145 150 155 160
Ala Arg Leu Pro Gly Ala Ile Gly Trp Asp Glu Leu Leu Ala Met Ala
165 170 175
Asp Arg Ala Gly Ala Pro Val Val Ala Leu Glu Pro Ala Gln Gln Ser
180 185 190
Asp Leu Cys Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Val Ser Lys
195 200 205
Gly Val Met Leu Ser His Arg Asn Leu Val Ser Ser Leu Cys Ser Ser
210 215 220
Met Phe Ala Val Gly Gln Glu Leu Val Gly Gln Val Val Thr Leu Gly
225 230 235 240
Leu Met Pro Phe Phe His Ile Tyr Gly Ile Thr Gly Ile Cys Cys Ala
245 250 255
Thr Leu Arg His Lys Gly Thr Val Val Val Met Asp Arg Phe Asp Leu
260 265 270
Arg Ala Phe Leu Gly Ala Leu Leu Thr His Arg Val Met Phe Ala Pro
275 280 285
Val Val Pro Pro Val Met Leu Ala Met Val Lys Ser Pro Val Ala Asp
290 295 300
Glu Phe Asp Leu Ser Gly Leu Ala Leu Arg Ser Val Met Thr Ala Ala
305 310 315 320
Ala Pro Leu Ala Pro Asp Leu Leu Ala Ala Phe Glu Arg Lys Phe Pro
325 330 335
Gly Val Gln Val Glu Glu Ala Tyr Gly Leu Thr Glu His Ser Cys Ile
340 345 350
Thr Leu Thr His Ala Ser Gly Gly Gly Glu Asp Val Gly Ser Ala Val
355 360 365
Gln Val Ala Lys Lys Lys Ser Val Gly Phe Ile Leu Pro Asn Leu Glu
370 375 380
Val Lys Phe Val Asp Pro Asp Thr Gly Arg Ser Leu Pro Lys Asn Thr
385 390 395 400
Pro Gly Glu Ile Cys Val Arg Ser Gln Ala Val Met Gln Gly Tyr Tyr
405 410 415
Arg Lys Lys Glu Glu Thr Glu Arg Thr Ile Asp Ala Ala Gly Trp Leu
420 425 430
His Thr Gly Asp Val Gly Tyr Ile Asp Asp Asp Gly Asp Val Phe Ile
435 440 445
Val Asp Arg Ile Lys Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala
450 455 460
Pro Ala Glu Leu Glu Ala Ile Leu Leu Ser His Pro Ser Val Glu Asp
465 470 475 480
Ala Ala Val Phe Gly Leu Pro Asp Glu Glu Ala Gly Glu Val Pro Ala
485 490 495
Ser Cys Val Val Arg Arg Arg Gly Ala Pro Glu Ser Glu Ala Asp Met
500 505 510
Met Ala Tyr Val Ala Gly Arg Val Ala Ser Tyr Lys Lys Leu Arg Leu
515 520 525
Leu Arg Phe Val Asp Ala Ile Pro Lys Ser Val Ser Gly Lys Ile Leu
530 535 540
Arg Arg Gln Leu Arg Asp Glu Phe Val Lys Lys Thr Ala Ala Ala
545 550 555
<210> 20
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 20
agaggaagga ggagacggag 20
<210> 21
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 21
gcgacctgaa accccttgta 20
<210> 22
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 22
gctatgtacg tcgccatcca 20
<210> 23
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 23
ggacagtgtg gctgacacca t 21
<210> 24
<211> 45
<212> DNA
<213>It is artificial synthesized
<400> 24
ccatgattac gaattcctat cccatcaatg tagctgaaga taagg 45
<210> 25
<211> 44
<212> DNA
<213>It is artificial synthesized
<400> 25
ggccagtgcc aagctttact tcatgcatgt attttccctt tttg 44
<210> 26
<211> 25
<212> DNA
<213>It is artificial synthesized
<400> 26
tgaaggatgg atcctgcaag aaacc 25
<210> 27
<211> 28
<212> DNA
<213>It is artificial synthesized
<400> 27
tggactagtt ttgatacgtg ctcatttc 28

Claims (11)

1. a kind of method of regulation and control plant fertility, regulates and controls the fertility of the plant by expression of regulatory fertility related gene, It is characterized in that, the nucleotide sequence of the fertility-related gene is selected from following group of one of sequence：
A) there is SEQ ID NO：1, nucleotide sequence shown in 4 or 5；
B) there is SEQ ID NO：Nucleotide sequence shown in 10；
C) there is SEQ ID NO：Nucleotide sequence shown in 12；
D) there is SEQ ID NO：14, nucleotide sequence shown in 15,16；
It e) under strict conditions can be with（a）-（d）Any sequence DNA hybridization DNA sequence dna；Or
F) with（a）-（e）Any sequence complementation DNA sequence dna.
2. method described in claim 1, wherein the amino acid sequence such as SEQ ID NO of its coding of the nucleotide sequence： 2, shown in 3,6,7,11,13,17,18 or 19.
3. method as claimed in claim 1 or 2, which is characterized in that by being mutated sterility changing genes of SEQ ID NO: 1、4、5、 10,12,14,15 or 16 male sterile material is obtained.
4. the method described in claim 3, wherein the mutation includes being carried out on the nucleotide sequence of sterility changing gene Replace, miss or add one or more nucleotide.
5. any method of claim 1-4, it is characterised in that further include extensive with DNA sequence dna described in claim 1 Again by corresponding SEQ ID NO:1, the male sterility caused by gene mutation shown in 4,5,10,12,14,15 or 16, makes male Sterile mutant reverts to fertile.
6. a kind of method obtaining malesterile mutants material, the mutant material pass through mutation, mutagenesis, antisense gene It is transferred to, the introducing etc. of co-suppression or hairpin structure, influences the expression of the fertility-related gene in plant body, it is characterised in that described The amino acid sequence of fertility-related gene such as SEQ ID NO：2, shown in 3,6,7,11,13,17,18 or 19.
7. method of claim 6, wherein the nucleotide sequence such as SEQ ID NO of the fertility-related gene: 1、4、 5, shown in 10,12,14,15 or 16.
8. the method described in claim 6 or 7 such as uses physics or change wherein the mutation includes but not limited to following methods Gene mutation caused by method, chemical method include that caused mutagenesis is handled with mutagens such as EMS, and the mutation may be used also To be point mutation, it can also be DNA missings or insertion mutation, can also be and generated by means such as RNAi, site-directed point mutations, The method of site-directed point mutation includes but not limited to ZFN directed mutagenesis methods, TALEN directed mutagenesis methods, and/or CRISPR/ The gene editings method such as Cas9.
9. application of the claim 6-8 malesterile mutants that only any the method is obtained in breeding.
It is and extensive wherein the breeding refers to maternal using mutant plants as sterile line 10. the application described in claim 9 Multiple system's hybridization, produces hybrid seed.
11. a kind of propagation method of genic male sterile line, the method includes：
（a）A kind of genic male sterile line is provided as the first plant, the male-sterile character of the genic male sterile line byHT2925Gene mutation causes；
（b）It is transferred to following constructs into above-mentioned first plant and forms the second plant, the construct includes：
i）Restoring gene expression cassette, it includesHT2925The genomic dna sequence of gene, when it is in above-mentioned kernel male sterile It can restore the male fertility of the plant when being expressed in system；
ii）Pollen inactivated gene expression cassette, when it is expressed, can inhibit the fertile males gamete of be transferred to plant formation or Function；And
（c）So that first plant is fertilized with the male gamete of second plant, the genic male sterile line of the first plant is made to obtain To breeding；Or make the second plant self-pollination, by 1:1 ratio breeds genic male sterile line.
CN201710082491.2A 2017-02-16 2017-02-16 Male fertile related gene HT2925 and its application Pending CN108441499A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710082491.2A CN108441499A (en) 2017-02-16 2017-02-16 Male fertile related gene HT2925 and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710082491.2A CN108441499A (en) 2017-02-16 2017-02-16 Male fertile related gene HT2925 and its application

Publications (1)

Publication Number Publication Date
CN108441499A true CN108441499A (en) 2018-08-24

Family

ID=63190450

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710082491.2A Pending CN108441499A (en) 2017-02-16 2017-02-16 Male fertile related gene HT2925 and its application

Country Status (1)

Country Link
CN (1) CN108441499A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109355291A (en) * 2018-11-22 2019-02-19 深圳市作物分子设计育种研究院 A kind of identification and application of plant endosperm specificity expression promoter pOsEnS93
CN110373418A (en) * 2018-01-24 2019-10-25 深圳市作物分子设计育种研究院 Regulate and control gene and its application of size of plant seed
CN113005128A (en) * 2021-03-12 2021-06-22 北京科技大学 Male sterile gene ZmMYB84 and application thereof in creating male sterile line of corn
CN118406697A (en) * 2024-06-28 2024-07-30 吉林农业大学 Zm4CL2 gene and application of overexpression vector thereof in improving drought resistance of corn plants

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104911191A (en) * 2014-03-11 2015-09-16 深圳市作物分子设计育种研究院 Fertility regulation gene FG3 and application thereof
CN105638446A (en) * 2016-03-16 2016-06-08 湖南省水稻研究所 Method for breeding rice dual-purpose genic male sterile line with excellent seed production characteristics
CN106609280A (en) * 2015-10-09 2017-05-03 上海师范大学 Application of acyl-coenzyme A ligase related to pollen development or encoding gene of acyl-coenzyme A ligase and method for culturing plant sterile line

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104911191A (en) * 2014-03-11 2015-09-16 深圳市作物分子设计育种研究院 Fertility regulation gene FG3 and application thereof
CN106609280A (en) * 2015-10-09 2017-05-03 上海师范大学 Application of acyl-coenzyme A ligase related to pollen development or encoding gene of acyl-coenzyme A ligase and method for culturing plant sterile line
CN105638446A (en) * 2016-03-16 2016-06-08 湖南省水稻研究所 Method for breeding rice dual-purpose genic male sterile line with excellent seed production characteristics

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FENG,Q. 等: "Q7XXL2.2", 《GENBANK》 *
陈竹锋 等: "优质水稻黄华占雄性不育突变体的筛选及初步分析", 《广东农业科学》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110373418A (en) * 2018-01-24 2019-10-25 深圳市作物分子设计育种研究院 Regulate and control gene and its application of size of plant seed
CN110373418B (en) * 2018-01-24 2024-05-10 深圳市作物分子设计育种研究院 Gene for regulating and controlling plant seed size and application thereof
CN109355291A (en) * 2018-11-22 2019-02-19 深圳市作物分子设计育种研究院 A kind of identification and application of plant endosperm specificity expression promoter pOsEnS93
CN113005128A (en) * 2021-03-12 2021-06-22 北京科技大学 Male sterile gene ZmMYB84 and application thereof in creating male sterile line of corn
CN113005128B (en) * 2021-03-12 2023-06-30 北京科技大学 Male sterile gene ZmMYB84 and application thereof in creating maize male sterile line
CN118406697A (en) * 2024-06-28 2024-07-30 吉林农业大学 Zm4CL2 gene and application of overexpression vector thereof in improving drought resistance of corn plants
CN118406697B (en) * 2024-06-28 2024-09-03 吉林农业大学 Zm4CL2 gene and application of overexpression vector thereof in improving drought resistance of corn plants

Similar Documents

Publication Publication Date Title
US10619168B2 (en) Fertility gene and use thereof
US7842851B2 (en) Floral transition genes in maize and uses thereof
CN107267527A (en) The keeping method of male fertile and its application
CN113121664A (en) Method for identifying, selecting and generating disease resistant crops
CN108441499A (en) Male fertile related gene HT2925 and its application
CN106834305B (en) Rice male fertility regulation gene OsSTRL2 and application thereof
CN109897858A (en) A method of male sterible series of rice is obtained using fertile gene S44
CN113832179B (en) Application of ZmELF3.1 protein and functional deletion mutant thereof in regulating and controlling number of tassel branches of crops
CN104911191B (en) A kind of sterility changing gene FG3 and its application
CN108660139B (en) Plant fertility regulation gene NP2, and coding protein and application thereof
CN108341857B (en) Rice yield related protein and coding gene and application thereof
CN101356188A (en) Plants having improved growth characteristics and a method for making the same
CN111826391A (en) Application of NHX2-GCD1 double genes or protein thereof
CN113151295A (en) Rice temperature-sensitive male sterile gene OsFMS1 and application thereof
CN105886516B (en) One sterility changing gene OsRPLP0 and its application
CN113754746A (en) Rice male fertility regulation gene, application thereof and method for regulating rice fertility by using CRISPR-Cas9
CN114540366B (en) Rice fertility regulating gene GMS3, mutant and application thereof
AU769117B2 (en) Root transcriptional factors and methods of use
CN114644692A (en) Method for creating drought-sensitive corn germplasm by site-specific mutagenesis and application thereof
US20030213014A1 (en) Root transcriptional factors and methods of use
US20010049832A1 (en) Root transcriptional factors and methods of use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180824