CN113151295B

CN113151295B - Rice temperature-sensitive male sterile gene OsFMS1 and application thereof

Info

Publication number: CN113151295B
Application number: CN202110237714.4A
Authority: CN
Inventors: 汪得凯; 裘霖琳; 刘窍; 庞礴; 翟玉凤
Original assignee: Zhejiang Sci Tech University ZSTU
Current assignee: Zhejiang Sci Tech University ZSTU
Priority date: 2021-03-04
Filing date: 2021-03-04
Publication date: 2023-06-20
Anticipated expiration: 2041-03-04
Also published as: CN113151295A

Abstract

The invention relates to the field of plant genetic engineering, in particular to a rice temperature-sensitive male sterile gene OsFMS1 and application thereof. Is characterized by no pollen formation at high temperature (about 22 ℃); while pollen is fully viable at low temperature (about less than 22 ℃), this strain is designated as fullmale-sterile (fms 1). The rice fertility gene OsFMS1 can cause the anther of rice to be aborted after over-expression or induced specific expression, can be used for cultivating a new temperature-sensitive male sterile line, can be applied to creation of the sterile line and hybrid rice seed production, and has important application value.

Description

Rice temperature-sensitive male sterile gene OsFMS1 and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a rice temperature-sensitive male sterile gene OsFMS1 and application thereof.

Background

Rice (Oryza sativa l.) is an important food crop, a staple food for half of the world population, and also an important monocotyledonous pattern plant. The successful creation of hybrid rice by the three-line method and the two-line method solves the problem of seed production and propagation of large-scale utilization of plant hybrid vigor, provides technical support for large-scale popularization and application of hybrid rice, and makes an important contribution to world grain safety. Compared with the three-line hybrid rice, the two-line hybrid rice has the advantages of wide restorer line and simplified seed production process, and occupies an increasingly important position in the production of hybrid rice. Successful popularization of two-line hybrid rice benefits from effective utilization of photo-thermo-sensitive male sterility genes.

Several important photo-thermo-sensitive male sterility genes have been targeted for cloning in rice, such as P/TMS12 (Zhou et al 2012); PMS3 (Ding et al 2012); CSA (Zhang et al, 2013); TMS2 (Chueasiri et al 2014); TMS5 (Zhou et al 2014); TMS9-1 (Qi et al 2014), PMS1 (Zhou et al 2014;Fan et al 2016) and the like, but the genes can not completely meet the practical requirements of breeding production, new temperature-sensitive genic male sterile genes still need to be continuously discovered, the action mechanism of the genes is studied deeply, the rapid creation of excellent male sterile lines is facilitated, the hybrid rice seed production and breeding are promoted, and therefore, the rice yield is improved.

In view of this, the present invention has been made.

Disclosure of Invention

The present disclosure encompasses the following embodiments:

an isolated nucleic acid having a nucleotide sequence set forth in SEQ ID NO: 1.

The isolated protein obtained by expression of the nucleic acid as described above.

A recombinant DNA construct comprising a nucleic acid as described above operably linked to at least one heterologous regulatory sequence.

A host cell comprising a nucleic acid as described above, or a protein as described above, or transformed with a recombinant DNA construct as described above.

A method for producing transgenic rice comprising introducing a recombinant DNA construct as described above into a oryza plant;

wherein the nucleic acid is expressed in rice to constitute temperature sensitive male sterility.

Use of a transgenic oryza plant produced by a method as described above for producing a oryza sativa propagation material, wherein the propagation material is suitable for tissue culture of sexually reproducing, vegetatively reproducing or viable cells.

The invention discovers a male sterile mutant in a flower 11 (ZH 11) T-DNA insertion mutant library in rice varieties, which can not produce mature pollen grains, belongs to pollen-free male sterility, and has the advantages that the fertility is regulated by temperature, and particularly, the pollen-free mutant is formed under the condition of high temperature (about higher than 22 ℃); while pollen is fully viable at low temperature (about less than 22 ℃), this strain is designated full Male-sterile (fms 1). The rice fertility gene OsFMS1 can cause the anther of rice to be aborted after over-expression or induced specific expression, can be used for cultivating a new temperature-sensitive male sterile line, can be applied to creation of the sterile line and hybrid rice seed production, and has important application value.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a graph showing pollen fertility at high temperature for ZH11 and Osfms1 mutants of example 1; wild Type (WT), heterozygote (WT/osfms 1) and homozygous mutant (osfms 1/osfms 1) at position A; b is Wild Type (WT), heterozygote (WT/osfms 1) and homozygous mutant (osfms 1/osfms 1) young ear; C. d is a wild type and homozygous mutant flower; E. f is pollen I2/KI staining of wild type and homozygous mutants.

FIG. 2 is a photo-thermal characterization of osfms1 in example 2; medium flower 11 (ZH 11 is wild type control), 10h and 14h are illuminated for 10 hours and 14 hours, respectively; pollen I ₂ Dyeing with/KI.

FIG. 3 is a graph showing the results of gene localization and cloning of the temperature-sensitive male sterility gene OsFMS1 in example 3; a is OsFMS1 gene localization; b is T-DNA insertion co-segregation analysis, wherein A1-A5 are wild type, B1-B14 are heterozygotes, C1-C9 are homozygous mutants; c is a schematic diagram of T-DNA insertion sites; d is the expression of genes at the upstream and downstream of the T-DNA insertion site identified by semi-quantitative PCR; e is qPCR to identify expression of genes upstream and downstream of the T-DNA insertion site.

FIG. 4 is an example of overexpression of the OsFMS1 gene; wherein A is an OsFMS1 transgenic over-expression plant; b is floret of an OsFMS1 transgenic over-expression plant; transgenic overexpressing plant pollen I with OsFMS1 as C ₂ /KI staining.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

Noun definition

Before setting forth the detailed description of the present invention, it should be understood that several terms are used in this specification.

"Rice genus" or "rice" is a genus (Oryza) of the Gramineae family, preferably comprising an o.sativa species, further comprising indica o.s.indica, japonica o.s.japonica or tropical japonica subspecies.

"agronomically good (trait)", as used herein, refers to a genotype that has a good or optimal performance of many discernable traits that allows a producer to harvest a product of commercial importance. Including, but not limited to, seed yield, vigour, disease resistance, greenness, growth rate, total biomass or accumulation rate, fresh weight at maturity, dry weight at maturity, fruit yield, grain yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in the vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in the vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in the vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear length, salt tolerance, tillering number, panicle size, early seedling vigour, and emergence under low temperature stress, among others.

"phenotype" means a detectable characteristic of a cell or organism.

Mating of two parent plants is "crossed".

"nucleic acid", "polynucleotide", "nucleic acid sequence", "nucleotide sequence" and "nucleic acid fragment" are used interchangeably and refer to a polymer of single-stranded or double-stranded RNA and/or DNA, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually in their 5' -monophosphate form) are referred to by the following single letter codes: "A" means adenylate or deoxyadenylate, "C" means cytidylate or deoxycytidylate, and "G" means guanylate or deoxyguanylate, corresponding to RNA or DNA, respectively; "U" represents uridylic acid; "T" represents deoxythymidylate; "R" represents purine (A or G); "Y" represents pyrimidine (C or T); "K" represents G or T; "H" represents A or C or T; "I" represents inosine; and "N" represents any nucleotide.

"isolated" refers to a substance, such as a nucleic acid molecule and/or protein, that is substantially free of, or otherwise removed from, components with which it is normally associated or interacted in a naturally occurring environment. Isolated polynucleotides may be purified from the host cell in which they naturally occur. Conventional nucleic acid purification methods known to the skilled artisan can be used to obtain isolated polynucleotides. The term also encompasses recombinant polynucleotides and chemically synthesized polynucleotides.

"polypeptide", "peptide", "amino acid sequence" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" may also include modifications including, but not limited to: glycosylation, lipid attachment and sulfation, gamma-carboxylation, hydroxylation and ADP-ribosylation of glutamic acid residues.

"recombinant" refers to the artificial combination of two otherwise isolated sequence segments, e.g., by chemical synthesis or by manipulation of the isolated nucleic acid segments by genetic engineering techniques. "recombinant" also includes reference to a cell or vector that has been modified by the introduction of a heterologous nucleic acid, or cells derived from such modified cells, but does not encompass alterations to the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention.

"recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Thus, a recombinant DNA construct may comprise regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. In some specific embodiments, the recombinant DNA construct is a plasmid or virus. In some embodiments, the recombinant DNA constructs of the invention comprise regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals, and poly U sequences, etc.).

The invention relates to an isolated nucleic acid, the nucleotide sequence of which is shown in SEQ ID NO: 1.

The nucleic acid fragment genes claimed in the invention also include the nucleotide sequence SEQ ID NO:1 and has the same highly homologous equivalent sequence regulating the temperature sensitive male sterility function.

The highly homologous functionally equivalent sequences include sequences capable of hybridizing under stringent conditions to sequences having the sequence of SEQ ID NO:1, and a DNA sequence hybridized with the DNA of the sequence shown in the specification. "stringent conditions" as used in the present invention are well known and include, for example, hybridization in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH 6.4) and 1mM EDTA at 60℃for 12 to 16 hours, followed by washing with a washing solution containing 0.1% SDS and 0.1% SSC at 65℃for 15 to 60 minutes.

Functionally equivalent sequences also include sequences that match SEQ ID NOs: 1, and has at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, and has the same function of regulating temperature sensitive male sterility, and can be isolated from any plant. The percentage of sequence identity may be obtained by well known Bioinformatics algorithms, including Myers and Miller algorithms (Bioinformatics, 4 (1): 11-17, 1988), needleman-Wunsch global alignment (J.mol. Biol.,48 (3): 443-53, 1970), smith-Waterman local alignment (J.mol. Biol.,147:195-197, 1981), pearson and Lipman similarity search (PNAS, 85 (8): 2444-2448, 1988), karlin and Altschul algorithms (Altschul et al, J.mol. Biol.,215 (3): 403-410, 1990; PNAS,90:5873-5877, 1993). As will be familiar to those skilled in the art.

The nucleic acid can regulate and control the temperature-sensitive male sterility function of rice, and particularly, under the condition of high temperature (about higher than 22 ℃), no pollen is formed; while at low temperature (about less than 22 ℃), pollen is fully viable. The rice fertility gene OsFMS1 can cause the anther of rice to be aborted after over-expression or induced specific expression, can be used for cultivating a new temperature-sensitive male sterile line, can be applied to creation of the sterile line and hybrid rice seed production, and has important application value.

The invention also relates to isolated proteins obtained by expression of the nucleic acids as described above.

The invention also relates to recombinant DNA constructs comprising a nucleic acid as described above operably linked to at least one heterologous regulatory sequence.

The invention also relates to a host cell comprising a nucleic acid as described above, or a protein as described above, or transformed with a recombinant DNA construct as described above.

The nucleic acid fragments provided by the invention may be inserted into plasmids, cosmids, yeast artificial chromosomes, bacterial artificial chromosomes or any other vector suitable for transformation into a host cell. Preferred host cells are bacterial cells, in particular bacterial cells for cloning or storing polynucleotides, or for transforming plant cells, such as E.coli, agrobacterium tumefaciens and Agrobacterium rhizogenes.

The invention also relates to a method for producing transgenic rice comprising introducing a recombinant DNA construct as described above into a oryza plant;

In some embodiments, the recombinant DNA construct is introduced into rice by host cell introduction as described above.

The methods of the invention may also be used to introduce the nucleic acid directly into plants to produce transgenic rice, which is produced using transformation methods known to those skilled in the art of plant biotechnology. Any method can be used to transform a recombinant expression vector into a plant cell to produce a transgenic plant of the invention. Transformation methods may include direct and indirect transformation methods. Suitable direct methods include liposome-mediated transformation, introduction using a gene gun, electroporation, and pollen tube channeling, among others.

In some embodiments, the recombinant DNA construct is introduced into rice by hybridization.

In some embodiments, the method comprises:

1) Determining whether the first oryza plant has SEQ ID NO:1, a nucleic acid fragment as set forth in 1;

2) Optionally verifying the thermo-sensitive male sterility phenotype of the first oryza plant;

3) Crossing said first oryza plant with a second oryza plant to produce a progeny plant;

4) Optionally repeating steps 1) -3) 2-10 times using the progeny plant described in step 3) as a starting material to produce other progeny plants.

In some embodiments, the second oryza plant is an agronomically elite variety.

The invention also relates to the use of a transgenic oryza plant produced by the method as described above for producing a oryza sativa propagation material, wherein the propagation material is suitable for tissue culture of sexually reproducing, vegetatively reproducing or regenerating cells;

in some embodiments, the propagation material suitable for sexual reproduction is selected from microspores, pollen, ovaries, ovules, embryo sacs, and egg cells.

In some embodiments, the propagation material suitable for vegetative propagation is selected from cuttings, roots, stems, cells, protoplasts.

In some embodiments, the propagation material suitable for tissue culture of regenerable cells is selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, root tips, anthers, flowers, seeds and stems.

Embodiments of the present invention will be described in detail below with reference to examples.

Flower 11 in the rice variety used in the examples is a standard variety.

Example 1 phenotypic identification and genetic partitioning of fms1 mutants

OsFMS1 mutants were found in the T1 generation in the Zhonghua 11T-DNA insertion mutant pool. The homozygous mutant exhibited half dwarfing, dark green leaf color, semi-coating of neck of ear (FIG. 1A, B), and no breedable seed at maturity. The fruiting rate of the heterozygote plant is 31.1+/-8.4 percent, which is obviously reduced (85.4+/-7.2 percent) compared with the wild type. Florets were observed under dissecting scope, the mutant columella grenade hair was normal, the number and structure of flower organs were normal, but the filaments were elongated and the anther was atrophic and whitish (fig. 1C, D). The anthers of the flowers prior to flowering were stained with 1% I2/KI and no mature pollen grains were found in the mutant anthers (FIG. 1E, F).

In the T1 generation strain, wild type: semi-sterility: total sterile plants = 5:14:9, conform to 1:2:1 (χ) ² _c ＝0.43<χ ² _0.05 =3.84). Harvesting plants exhibiting wild type and semi-sterile plants for the T2 generation, the wild type no longer segregating; the semi-sterile plants can be separated from wild type plants, semi-sterile plants and completely sterile plants, and the separation proportion is 1:2: 1.

TABLE 1 plant isolation

The homozygous mutants were used as parents to hybridize with flowers 11 in the original parent, respectively. When the homozygous mutant is used as a male parent, no seeds are formed; seeds can be normally obtained when the homozygous mutant is used as a female parent, F1 is semi-sterile, and F2 generation wild type: semi-sterility: total sterile plants = 15:32:12, conform to 1:2:1 (χ) ² _c ＝0.46<χ ² _0.05 =3.84).

Based on the phenotype and genetic analysis results, the OsFMS1 mutant is determined to be pollenoless male sterile and is controlled by a pair of incomplete dominant nuclear genes.

Example 2 photo-temperature identification of fms1 mutants

The fms1 mutant is characterized by no pollen male sterility under the condition of long-day high temperature in Hangzhou summer (about 8 months and 10 days for heading and long-day high temperature), no mature seed generation, subtraction of mature spike parts before and after 10 months and 1 day (low temperature and short day), normal fruiting of newly drawn young spikes, planting of OsFMS1 homozygous plant rice piles and harvested seeds in Hainan, and restoration of the athletic performance of the OsFMS1 mutant for heading about 3 months and 10 days (short day and low temperature), and normal fruiting, which suggests that the mutant may be subjected to photoperiod or temperature control. Setting 4 temperature and illumination combinations by utilizing an illumination incubator, wherein the culture conditions are as follows: high temperature long day: 28 ℃ plus 14h illumination; high-temperature short-day 28 ℃ plus 10h illumination; low-temperature long-day 22 ℃ plus 14h illumination; the sunlight at the low temperature is 22 ℃ for +10 hours. The fertility of the plant spikelet pollen is investigated: ZH11 was normally viable in all treatments, whereas OsFMS1 showed normal pollen fertility only at low temperature of 22 ℃ and pollen-free phenotype at high temperature (fig. 2). Proved that the pollen fertility of the OsFMS1 mutant is mainly regulated and controlled by temperature, and the OsFMS1 is a temperature-sensitive genic male sterile mutant.

EXAMPLE 3 localization and cloning of the OsFMS1 Gene

Preparing a locating group by taking an OsFMS1 mutant as a female parent and a long-shaped rice variety Longtenfu B as a male parent, and carrying out gene location by taking an individual with a phenotype of extreme recessive as the locating group. The mutant gene was initially located on chromosome 4 using the SSR primer 192 pairs with polymorphisms covering 12 chromosomes of rice, and then the candidate gene was further located within a physical distance of 103kb using the SSR primer and the newly designed STS marker (fig. 3A).

The SSR primer and STS primer are as follows:

tag name	F(5’-3’)	R(5’-3’)
			RM3288	CAATCTGGAGGCACTGTCACG	AGTGACAAGATGAAGCCAACAGC
RM6089	CGATGGCCAGCGTGATCTCC	CCACCGAATCGAATAACCACAAGC
			RM3474	ACCTCACCTTTCCCTCGATTGG	GTTGGTTGCTTCCTCCCATACG
RM3276	ACAGGTCGATCTCGATGAACTCC	CTCTTCTCCGTCTCGACTCTTCC
			RM3836	CGGAATCACCAATTTCTCTCTCAGC	CGCAAGAAACGGAAACGAAACC
4-1	AGTGCTGTCAGAGAGAAAGCAATCC	GGAGCCATCGAGTGTCATCACC
			4-4	ACTTTGCTCTGAACTTGCAGTGG	GCTAGCTGCTATCAGGATTCACG
4-11	TTGGAAGCCAACTCAAGTTACCC	GAAGCAGGGATGTGAGAGATGG
			4-15	AGACCATAATGCCACAATCC	TTGATTTGTGCTCTTCCCAG
4-18	CAGAAGAACAAACTCCACAG	AAATCGATCCTCTGCAGTGC

Meanwhile, to determine whether the mutant phenotype is coseparated with T-DNA, i.e., whether the mutant is an insertion mutation. All the T1 generation single plants are selected, PCR amplification is carried out by utilizing the HPT gene in the T-DNA, and the heterozygote and the homozygous mutant are found to amplify target bands, while the wild type does not have amplification products. In the T2 generation, all of the lines exhibiting the wild type had no amplified product, and in the lines continuing to be isolated, the target band could be amplified by both the wild type had no amplified product, the heterozygote and the homozygous mutant (fig. 3B). Indicating that the T-DNA is phenotypically co-isolated from the mutant, which is likely to be caused by the T-DNA insertion.

The flanking sequences of the T-DNA insertion site were isolated by TAIL-PCR technique, and after sequencing, the T-DNA was found to be inserted into the above-mentioned finely-located 103kb region by analysis of the rice genome annotation databases TIGR (http:// rice. Plant biology. Msu. Edu /) and RiceGAAS (http:// ricgaas. DNAs. Affrc. Go. Jp/rgadb /) (FIG. 3C)

And respectively selecting 2 genes at the upstream and downstream of the T-DNA insertion site to analyze the expression quantity by combining the gene positioning results. Young ear cdnas from stage III to stage V were selected for semi-quantitative PCR. As a result of the analysis of the experimental results, it was found that the expression level of ORF1 gene (LOC-Os 04g 50030) downstream from the T-DNA insertion site was significantly increased, while the expression levels of the other 3 candidate genes were not significantly different (FIG. 3D). The change in the expression level of the OsFMS1 gene at each period was further examined by qRT-PCR, and it was found that the expression level of the OsFMS1 gene was significantly increased at each period (FIG. 3E). The ORF1 gene (LOC_Os04 g 50030) is shown to be a candidate gene for OsFMS 1. Sequencing analysis of amplified full-length ORF products, database comparison analysis shows that the gene OsFMS1 has no intron, codes for an AT-HOOK transcription factor, and has no report on cloning and functional research of the gene AT present.

The primer sequences used for the RT-PCR are as follows:

example 4 overexpression of the OsFMS1 Gene

Constructing an OsFMS1 gene over-expression vector driven by a UBI promoter to transform a wild medium flower 11 plant, wherein the amplification primers are as follows: osFMS1-BamHI (5'-TGCTGGATCCGTACATGAGCTAGTGGAG-3'); osFMS1-KpnI (3 '-CCAGGTACCCTTGCGATGTCTCCTTTC-5'), amplification primers contained two restriction sites BamHI and KpnI for ligation to pCAMBIA1301-Ubi/Nos vector. The reaction conditions are as follows: pre-denaturation at 94℃for 7min;94 ℃/1min,60 ℃/30s,72 ℃/3min,35 cycles; extending at 72℃for 7min. The PCR reaction system is as follows:

the amplified product was identified and recovered, digested with BamHI and KpnI, ligated to pCAMBIA1301-Ubi/Nos vector, which was also digested with BamHI and KpnI, to construct pCAMBIA1301-Ubi-OsFMS1 vector, and Agrobacterium-mediated transformation of medium flower 11 wild type plants was used. And identifying the obtained transgenic seedlings.

The transformed plants were normal in fertility at low temperature and at high temperature, and the transformed plants exhibited phenotypes similar to OsFMS1 (FIG. 4A), anther characteristics and pollen fertility were also similar to that of OsFMS1 (FIG. 4B), and the floret anthers before flowering were stained with 1% I2/KI, and no mature pollen grains were formed in the overexpressed plant anthers (FIG. 4C). Therefore, LOC_Os04g50030 is determined to be the OsFMS1 gene.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. A method of producing transgenic rice comprising introducing a recombinant DNA construct into rice;

the recombinant DNA construct comprises a nucleotide sequence as set forth in SEQ ID NO:1, a nucleic acid as set forth in seq id no;

wherein expression of the nucleic acid in rice constitutes temperature sensitive male sterility.

2. The method of claim 1, wherein the recombinant DNA construct is introduced into rice by gene gun-mediated transformation, pollen tube channel or liposome transformation.

3. The method of claim 1, wherein the recombinant DNA construct is introduced into rice by hybridization.

4. A method according to claim 3, the method comprising:

1) Determining whether the first rice plant has the sequence of SEQ ID NO:1, a nucleic acid fragment as set forth in 1;

2) Verifying the temperature-sensitive male sterility phenotype of the first rice plant;

3) Crossing said first rice plant with a second rice plant to produce a progeny plant;

4) Repeating steps 1) -3) 2-10 times using the progeny plant described in step 3) as a starting material to produce other progeny plants.

5. The method of claim 4, wherein the second rice plant is an agronomically elite variety.

6. Use of the transgenic rice produced by the method of any one of claims 1 to 5 for the production of rice propagation material, wherein the propagation material is suitable for tissue culture of sexually reproducing or viable cells.

7. The use according to claim 6, said propagation material suitable for sexual reproduction being selected from microspores, pollen, ovaries, ovules, embryo sacs and egg cells.

8. The use according to claim 6, said propagation material suitable for tissue culture of regenerable cells is selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, roots, anthers, flowers, seeds and stems.