CN102925478A - Building method and breeding method for rice male-fertile controllable line - Google Patents

Abstract

The invention provides a building method for a rice male-fertile controllable line, comprising the following steps of: (a) obtaining the sterile mutant line of rice male-fertile genes and the corresponding functional male-fertile genes; (b) building a functional male-fertile gene expression cassette conversion carrier controlled by an inducible promoter; and (c) converting the sterile mutant line by the expression cassette conversion carrier, so as to obtain the rice male-fertile controllable line. The male-fertile controllable line built by the method provided by the invention can induce recombinant fertile gene expression by virtue of a corresponding inducer, thus realizing fertile selfing breeding; and the male-fertile controllable line represents complete male sterility in the case that the inductor is not applied, thus being capable of being hybridized with the male parent to produce hybrid seeds. Via the breeding method, the defects of breeding for three-line hybrid rice based on cytoplasmic male sterility, breeding for two-line hybrid rice based on photo-thermo-sensitive genic male sterile line, and methods for creating a sterile line by virtue of other genetic engineering methods are overcome.

Description

Construction process and the breeding method of the controlled system of a kind of rice male fertility

Technical field

The present invention relates to the plant gene engineering technology field, be specifically related to a kind of genetic engineering breeding of the controlled system of rice male fertility of condition Induction Control and the method for hybrid seeding thereof.

Technical background

The hybrid that allogamy between the crop different varieties produces may have advantage at aspects such as growth potential, adaptability, output.Utilize these hybrid vigours can improve Yield and quality and the resistance of farm crop.Paddy rice is a kind of hermaphrodite self-pollinated plant, produce hybrid rice seeds, must male sterile strain of seed selection, and allow gynoecium accept pollen from different strain.China breeding man utilize common wild-rice ( Oryza rufipogon) natural male sterile plant (being called " open country is lost ") be the donor of sterile cytoplasm, by with the cultivation long-grained nonglutinous rice ( O. sativa ssp. indica) hybridize and backcross and bring out sterile line required in the ternary hybrid rice production, maintenance line and restorer.Utilize sterile line and restorer to do parent's hybridization and can economize the operation of removing hero, be convenient to produce highly purified cenospecies, therefore have important production application be worth (Yuan Longping. 1977. Scientia Agricultura Sinicas. 1:27-31, Lin, and Yuan 1980. In:IRRI (eds) Innovative approaches to rice breeding. IRRI, Manila, p35 – 51).In China, lose sterile cytoplasm and cultivated a large amount of triple crossing rice varieties and large-scale application with wild, produced huge economic and social benefit (Cheng etc., 2007, Ann. Bot., 100,959-966).

Multiple kinds of crops such as paddy rice, wheat, corn, rape etc. are used on a large scale cross-fertilize seed and produce about the existing many reports of the research of male infertility and fertility restorer thereof on producing.Sterile line can be divided into the cytoplasmic male sterility (cytoplasmic male sterility is referred to as CMS) of Cytoplasmic male sterile genes control and the nuclear sterile (genic male sterility is referred to as GMS) of genic male sterile gene control.Genetics from developed recently: the tenuigenin of cytoplasmic male sterile line is generally the Mitochondrial Genome Overview of carrying sterile gene, and the expression of its sterile gene causes pollen sterility; Carry cytoplasmic male sterility in the nuclear gene group of restorer and recover gene (restorer of fertility), referred to as recover gene or RfGene, its pollen normally can be educated, but self-fertility; But maintenance line has normal hatching cell matter, but its nuclear gene group does not carry the gene of restore funcitons, and pollen normally can be educated, but self-fertility.In " three are " of supporting application, maintenance line has identical nuclear gene group with sterile line in the production, and its difference is that the plasmone group is different.Because dissimilar cytoplasmic male sterility in plants is to be produced by the special sterile gene in the Mitochondrial Genome Overview of sterile cytoplasm, the recovery of its fertility needs effect (the Schnable and Wise of special recovery gene, 1998, Trends Plant Sci. 3:175-180).Rice cytoplasmic male sterile has broad variety, mainly is: (1) Yebai (wild abortive is called for short the WA type) belongs to sporophyte sterile; (2) bag platform (BT) type belongs to gametophyte sterile; (3) red lotus (HL) type belongs to gametophyte sterile (Zhu Yingguo, 2000, the biology of male sterility of rice, press of Wuhan University).Most widely used general at " three are " hybridisation rice of wild abortion type sterile series wherein.The ternary hybrid rice breeding system has special requirement to the hereditary basis of germplasm, be that sterile line will have sterile cytoplasm (Mitochondrial Genome Overview contains special sterile gene), maintenance line will not contain main effect and minor effect fully and recovers gene, and restorer will be carried main effect and minor effect recovers gene.Therefore, three of ternary hybrid rice is that to cultivate the germ plasm resource that can utilize limited, and the breeding difficulty is larger, and the degree of freedom of hybridizing combo is little, and the breeding of sterile line and cross-fertilize seed and production of hybrid seeds program are more loaded down with trivial details.

Also successfully cultivating based on two of photo-thermo-sensitive genetic male sterile line in paddy rice is hybridisation rice, and applies aborning (Zhu Yingguo, 2000, the biology of male sterility of rice, press of Wuhan University; Cheng etc., 2007, Ann. Bot., 100,959-966).Photo-thermo-sensitive genetic male sterile line is to utilize male-fertile self propagated under the condition of short day low temperature, and male sterile under the condition of long day high temperature can be used as female parent and the paternal hybrid production of hybrid seeds.The relevant wild-type fertile gene of any male parent that normally can educate can suppress the temperature sensitive sterility of light, and cross-fertilize seed is normal at the pollen fertility in normal growth season.Therefore two is that the degree of freedom of screening combo of male parent of hybridisation rice is larger.Two of at present application of China is that hybridisation rice mainly is take temperature sensitive sterile as main.Because the male fertile of temp-sensing sterile line is controlled by temperature, sterile line propagation need to carry out at particular season (such as the winter in area by north, Hainan Province) or the specified conditions (irrigating such as deep water storehouse water at low temperature) of specific region.More serious problem be fertility conversion critical porion (generally being that meiophase is to the microspore development phase) in production of hybrid seeds season run into unusual microthermal climate (25 ℃ or following) can the generating portion fertile pollen, cause the part self-fertility and reduce hybrid purity, make cross-fertilize seed not reach purity rubric in the serious situation and scrap.Therefore, the risk in hybrid seed production that produces owing to temperature variation is that restriction two is the principal element of hybridisation rice development.

Rice Anther is grown the participation that relates to a large amount of nuclear genes, and spontaneous mutation or physics and chemistry mutagenesis can produce male-sterile mutation by the higher-frequency degree.Reported a large amount of male-sterile mutation bodies in paddy rice, wherein existing more than 20 male fertile gene is cloned (Zhang DB and Wilson ZA, 2009, Chinese Science Bulletin, 2342-2353).But because most of mutant is the sterile sudden change of genes involved recessiveness, their homozygous mutation body can not self propagated, and be hybrid with it the hybrid that educates (or part can be educated) that can only produce the genes involved heterozygosis with wild-type parent, therefore examine sterile mutantion line and be not suitable for direct sterile line parent as the production of hybrid seeds of commercialization hybridisation rice.

On the other hand, also there is the several genes engineering proposal to create the report of plant sterile line and restorer thereof.These schemes are summed up and mainly contain 2 kinds, and the one, affect the normal development of flower pesticide or pollen with the expression of flower pesticide or pollen-specific expression promoters driven cytotoxin gene.As producing male sterile (Mariani etc., 1990) with anther specific expression promoter TA29 control Barnase gene transformation tobacco and rape.Another kind is to express the sense-rna of promoters driven or the expression that RNA disturbs inhibition flower pesticide indispensable gene with flower pesticide or pollen-specific.Produce male sterile (Cie etc. 1981) as in corn, expressing flavonoid biosynthesizing key gene CHS sense-rna.These schemes all need to solve the breeding problem of sterile line and the recovery problem of hybrid male fertile with genetic engineering technique.For example in the sterile system of Barnase genetically engineered, need with selection markers genescreen sterile line, and with Barster gene transformation male parent as recovery gene (Mariani etc., 1992).In paddy rice, also do not develop at present the genetically engineered hybrid seeding system of practicality.

Based on above analysis, it is and temperature sensitive two-line hybridisation rice seeding technique system and existing genetically engineered hybrid seeding system that further developing of hybridisation rice had great importance that exploitation is better than three.

Summary of the invention

First purpose of the present invention provides the construction process of the controlled system of a kind of rice male fertility.

Second purpose of the present invention is to utilize this controlled system of rice male fertility to carry out the method for hybrid seeding.

The 3rd purpose of the present invention provides critical material and the element with this breeding method, i.e. male sterility of rice mutantion line, the recombinant gene expression box that comprises inducible promoter and male fertile gene and carrier and suitable inductor.

For this reason, the construction process of the controlled system of rice male fertility of the present invention comprises that (a) obtains sterile mutantion line and the corresponding male fertile gene of rice male fertile gene; (b) make up the male fertile gene expression cassette conversion carrier of being controlled by inducible promoter; (c) transform described sterile mutantion line with described expression cassette conversion carrier, obtain the controlled system of rice male fertility.

Aforesaid method comprises the sterile mutantion line that obtains a rice male fertile gene, clones this male fertile gene with molecular biology method, and filters out suitable inductor (for example chemical inducer) and corresponding inducible promoter.Make up the described male fertile recombinant gene expression box carrier of this inducible promoter control, transform described male sterile line, obtain the controlled system of rice male fertility.The controlled system of male fertile that the present invention sets up preferably utilizes chemical inducer to induce the restructuring fertile gene to express and makes its self propagated, does not show completely male sterile and do not apply under the natural growthing condition of inductive condition, thus can with paternal hybrid production first-filial generation (F ₁) seed.

For obtaining the sterile mutantion line of described rice male fertile gene, the present invention obtains 1 sporophyte type male-sterile mutation system from the mutant library screening of 60Co-γ rays mutagenesis rice strain 02428 Msl12The deposit number of this mutantion line is CCTCC P201207, and depositary institution is Chinese Typical Representative culture collection center, and the address is Lopa Nationality an ancient woman's ornament mountain, Wuhan, China city Wuhan University, and preservation date is on August 29th, 2012, and the biomaterial Latin name of preservation is Oryza sativaL., Classification And Nomenclature is the Oryza paddy rice.Account for hybridization with this mutantion line and the yellow China of rice varieties and obtain F ₂Genetic group is cloned into positional cloning and causes this male sterile afunction mutator gene (SEQ ID No.1), called after Osabcg15, and functional type (wild-type) gene (SEQ ID No.2, SEQ ID No.3), called after OsABCG15 OsABCG15688 amino acid whose ABC of genes encoding albumen (ATP-binding cassette transporter) (SEQ ID No.4) that turns round Its function relates to from anther tapetum transportation lipid acid to sporule, and the main component pollenin of synthetic pollen wall belongs to the sporophyte fertile gene.In this mutantion line, this genetically deficient comprise 1479 bp of an exon and 2 introns and afunction, cause the early stage sporule can not normal development and degenerate, produce the non-pollen type abortion.

Systemic fungicide (can between the plant tissue conduct) mixing solutions of the present invention take Wocosin 50TK and nitrile bacterium azoles as effective constituent is applied to the rice leaf in boot stage, gets behind the 24h to process and the flower pesticide of contrast extracts RNA.Utilize the full genomic expression chip of paddy rice (OsAffx) hybridization and quantitative RT-PCR checking, the gene of finding 1 chip probe (OsAffx.13615.1.S1_at) representative is very low at the expression level of non-processing sample, and is much higher than non-processing contrast at the expression level of processing sample.The present invention has cloned the promoter sequence (SEQ ID No.5) of this gene with the round pcr amplification.

The present invention is with full length coding region (CDS) sequence of described promotor and functional type fertile gene or have the Partial cDNA Sequence of this protein function bioactive sequence of coding or genome sequence is listed in and is built into the recombinant gene expression box on the conversion carrier.Shown in SEQ ID No.6 is recombinant gene expression box with the total length CDS sequence construct of described promotor and functional type fertile gene.The carrier that will contain this recombinant gene expression box transforms and imports described male-sterile mutation is to induce fertility restorer through following method, the controlled system of male fertile that self propagated acquisition transgenosis is isozygotied.If when making up restructuring fertile gene conversion carrier, be combined with a kind of selection markers rejecting technology, just can obtain the controlled system of male fertile of screening marker-free.

Described functional type male fertile gene refers to realize the gene of male fertility, although it comprises the wild-type male fertile gene and undergos mutation but still keeps the gene of male fertile function, or from the homologous gene with identical function activity of other species separation.

The self propagated method of the controlled system of rice male fertility that the present invention breeds is, be that meiophase is to the mononuclear microspore growth period in the anther development phase, spray blade or be manured into soil with Wocosin 50TK or nitrile bacterium azoles or its mixed aqueous solution, can induce the restructuring fertile gene to express and the recovery pollen fertility, selfing obtains seed.

Method for crossbreeding of the present invention is that the controlled system of described rice male fertility is planted in seed farm with the male parent (by suitable proportion) that normally can educate.Do not using under the normal growth condition of chemical inducer, because the background expression level of described chemical inducible promoter is low, the genetically modified expression level of namely recombinating is low, and endogenous mutator gene (SEQ ID No.1) is afunction, the anther development of the controlled system of male fertile is unusual and holandry is sterile, therefore can accept the pollen fertilization of male parent, obtain highly purified F ₁Seed.The functional type fertile gene in male parent source OsABCG15The normal function of (SEQ ID No.2) can make F ₁The flower pesticide of plant and pollen normal development, so male fertile is normal, can produce solid seed.

With the inventive method except utilizing described fertile gene OsABCG15Outside (SEQ ID No.2) and the mutator gene thereof (SEQ ID No.1), can also obtain and utilize OsABCG15The allelomorphism sudden change sterile gene that any position of (comprising its promoter region) produces makes up the controlled system of male fertile with the described similar effect of the present embodiment.Because by various induced-mutation techniques or from spontaneous mutation, can obtain the male-sterile mutation body of other fertile gene of paddy rice, and can clone corresponding wild-type fertile gene with Protocols in Molecular Biology, the method according to this invention, paddy rice other male fertile mutator gene and wild type gene thereof be can also utilize, the controlled system of male fertile and hybrid seeding system thereof with the described similar effect of the present embodiment made up.Similarly, also can substitute promotor (SEQ ID No.5) and inductor Wocosin 50TK or the nitrile bacterium azoles shown in the present embodiment with other inducible promoter and suitable inductor thereof, make up the controlled system of male fertile and hybrid seeding system thereof with similar effect.

The controlled system of male fertile that the inventive method makes up and method for crossbreeding thereof are that to utilize the sterile mutator gene of endogenous nuclear and restructuring genetically modified novel two be hybridisation rice production of hybrid seeds system in a kind of combination.It has overcome based on cytoplasmic male sterile gene is the problem that the hybrid rice breeding method exists with the ternary hybrid rice that recovers gene with based on two of the temperature sensitive sterile gene of light, also have than the sterile line of other gene engineering method initiative and restorer crossbred cording and more many advantage: (1) other genetically engineered malesterile technique that cultivates plants is based on genetically modified expression and controls male sterile generation, often genetically modified expression effect and effects of action thereof are unstable, cause sterility incomplete or unstable.The pollen sterility of the controlled system of male fertile that the present invention produces is determined by endogenous afunction mutator gene, thereby sterility is complete and stable, is not subjected to envrionment conditions such as temperature and a day long impact; (2) do not need as other genetically engineered plants male sterile system, method, to set up sterile line propagation and hybrid fertile recovery system with genetic engineering technique, the inventive method all is potential male parent restorer to any kind (being) of educating, thereby the degree of freedom of cross combination pairing is large; (3) the present invention only just induces the expression of restructuring fertile gene to recover fertility with chemical inducer in the self propagated link of the controlled system of male fertile, and less demanding to the fertility restorer degree can reach economic and practical such as the setting percentage about 40-60%; (4) can breed and the production of hybrid seeds season at the paddy growth of all paddy fields, needn't as photo-thermo-sensitive genetic male sterile line, select the season of suitable day long or temperature or breed the region and the production of hybrid seeds; (5) need fertility to control the breeding field area of (executing inductor) minimum (be hybrid seeding field area approximately 1/300), and used chemical inducer is the low toxicity sterilant of the cheapness commonly used, thereby the breeding of the controlled system of male fertile is simple, cost is low; (6) in the situation that be combined with selection markers rejecting technology, the transgenosis component (promotor and fertile gene) in plant origin (such as the paddy rice source) is only carried by the controlled system of male fertile that present method produces, and does not consist of the biological safety problem that exceeds spontaneous mutation event degree.

Description of drawings

The controlled system initiative of Fig. 1 male fertile and method for crossbreeding schematic diagram thereof; MsBe the fertility mutator gene, MSBe male fertile functional type gene; P _IndBe inducible promoter.

Fig. 2 rice male sterility mutant Msl12Phenotype: A is the Xiao Hua of wild-type (WT) and mutant; B is flower pesticide I ₂-k dyeing does not contain pollen granule in the mutant flower pesticide; C is the plant type after wild-type and the mutant grouting; Scale is 1 mm among the little figure of A, B.

Fig. 3 (A) male-sterile mutation Msl12The Fine Mapping of locus; (B) correlation function type fertile gene ( OsABCG15) and the afunction mutator gene ( Osabcg15) structure; (C) carry out with quantitative RT-PCR OsABCG15The expression analysis of flower pesticide (with OsActin1Be confidential reference items); 1-5 is respectively pollen mother cell phase, meiophase, tetrad phase, monokaryon middle and advanced stage early stage to monokaryon, two nuclear phases; (D) with Pubi:: OsABCG15Genetic transformation Msl12Mutant recovers male fertile, to verify its function.

Relative expression's level after Fig. 4 quantitative RT-PCR detects the background expression (contrast) of paddy rice chemical inducible promoter (SEQ ID No.4) and induced 24 h (with OsUbiquitinGene is confidential reference items).

Fig. 5 recombinant gene expression box structure, the base position of institute's witness mark are to list according to SEQ ID No.5.

Fig. 6 (A) transforms the male-sterile mutation body with described recombination, and the male fertile of acquisition is controlled to tie up to that to produce non-pollen type in the situation of not using inductor sterile; (B-D) pollen fertility and the small ear of inductor is solid shown in use to the microspore development phase meiophase.

The hybrid F1 that the controlled system of Fig. 7 (A) male fertile and long-grained nonglutinous rice male parent HNL-1 hybridization obtain; (B) pollen fertility of F1 and small ear are solid.

The deposit number of described sterile mutantion line is CCTCC P201207, and depositary institution is Chinese Typical Representative culture collection center (being called for short CCTCC), and preservation date is on August 29th, 2012.

Embodiment

Following examples are used for further specifying the present invention, but do not limit the scope of the invention.If do not specialize, used is routine techniques method well-known to those skilled in the art.

Embodiment 1The positional cloning of male sterility of rice mutator gene and functional type fertile gene thereof and functional verification

With 60Co-γ rays mutagenesis paddy rice japonica rice variety 02428, obtain 1 single seat position recessive sporophyte male-sterile mutation body, called after Msl12(Fig. 2).Will Msl12Account for hybridization with the yellow China of rice variety and obtain F ₂Target group.With the insertion/deletion molecule marker of the listed PCR-based of table 1, utilize approximately 10500 strain F ₂Individuality will Msl12Be positioned at the interval (Fig. 3 A) of the 6th chromosomal 43 kb.There is 2 predicted genes (gene number in this interval Os06g006700With Os06g006800) Dna sequencing the analysis showed that, compares with former parent's genome sequence, Msl12 Os06g006800Not variation, and Os06g006700Lacked one section 1479 bp fragment (Fig. 3 B, SEQ ID No.1) that comprise 1 exon and 2 introns.The present invention with this wild-type (functional type) unnamed gene is OsABCG15(SEQ ID No.2, SEQ ID No.3), 454 amino acid whose ABC running (ATP-binding cassette transporter) albumen (SEQ ID No.4) of its coding Its function may be from anther tapetum transportation lipid acid to sporule, the main component pollenin of synthetic pollen wall.With special primer 5 '-CATGTGTGGCCAACCAAAGA-3 and 5 '-GTG GTCTTGCCACTGCC AGA-3 ' different development stage flower pesticide is carried out quantitative RT-PCR and the analysis showed that, OsABCG15Mainly the tetrad phase to mononuclear microspore early expression (Fig. 3 C).

Table 1 location Msl12Used insertion/deletion (insertion/deletion) molecule marker primer

Token name	Primer sequence (5 '---3 ')
		623652	GGTGCGTATGTTTGTTCCAGT, GGATAATATCAGGAGACCCCT
623715	TGTAATGAGTATGAGTTGTAG, TTGAGTCGTTGACATGTGGGA
		625024	GAGTGAGATTGTCTCCTC, GGCACTAAGGCTTTGCA
625051	GTACCCCGAATTCTAGTTTGGA, GACAAATCTATTTATATCCTAC
		625067	TCCACAAGACTGATACCTG, CAACCTTCACTACCACATG
625070	GCTTACCTAAACTAATAG, GTTCCTAACCAACTATAC
		623939	ACCTAATTTTGGGATTGAGAG, GTGGAATGCAGTTTATCTAAAT

In order to verify OsABCG15Function, with special primer 5 '-TTCTT GGTACC(underscore is TG ATTAAAAGGAGAG-3 ' KpnThe I point of contact) and 5 '-GCC AAGCTT(underscore is CGCTTATGCT TACAAGCTGA-3 ' HinD III point of contact) with pcr amplification OsABCG15Full-length cDNA is connected the carrier that rear clone is transformed to Plant Transformation binary vector pCAMBIA1305.1 with corn ubiquitin gene promotor Pubi.This carrier with conversion method for agrobacterium transform by MSL12/ Msl12The seed that heterozygote produces (has 1/4 ratio to be Msl12/msl12The callus of homozygote) inducing.From the T that obtains ₀Transformant is with molecule marker 625051(table 1) filter out 2 Msl12/msl12Homozygote, their anther development is normal and produce fertile pollen (Fig. 3 D).This result proves OsABCG15The target gene with fertility function, mutator gene Osabcg15The afunction of (SEQ ID No.1) causes the sporule in early days can not normal development and degenerate, and produces the non-pollen type abortion.

Embodiment 2From paddy rice separation chemistry inducible genes promotor

The present invention is applied to rice leaf with 0.05% Wocosin 50TK and 0.05% nitrile bacterium azoles mixed aqueous solution, gets the flower pesticide of meiophase to the sporule phase of processing and contrasting behind the 24h, extracts RNA.Utilize the full genomic expression chip of paddy rice (OsAffx) hybridization (being finished by Boao Biological Co., Ltd) examination, the gene of finding 1 gene probe (OsAffx.13615.1.S1_at) representative is very low at the expression level of non-processing sample, and is much higher than non-processing contrast at the expression level of processing sample.Further with the quantitative RT-PCR checking, confirm that its background expression is lower, and Wocosin 50TK or nitrile bacterium azoles can improve its expression level, the expression level higher (Fig. 4) that these 2 kinds of inductors share.

Embodiment 3The structure of the controlled system of rice male fertility

With special primer 5 '-CTTGA GGCCGGCC(underscore is TAAATTATTATTTTTCCAATATTTA-3 ' FseThe I point of contact) and TCA GGTACC(underscore is GATCGGTGATCCCTCCTCAA-3 ' KpnThe I point of contact) from the described promoter sequence of rice genome pcr amplification; With 5 '-GATC GGTACC(underscore is TGATTAAAAGGAGAGA AG-3 ' KpnThe I point of contact) and 5 '-GGA GGATCC(underscore is AGACCTCGCGCA-3 ' BamH I point of contact) pcr amplification wild-type OsABCG15Nearly full-length cDNA encoding sequence; With 5 '-CTCT GGATCC(underscore is TCCTCGCCATGGC-3 ' BamH I point of contact) and 5 '-CCTA CTCGAG(underscore is CTCCCTGCAGGTGAGGA-3 ' XhoThe I point of contact) pcr amplification OsABCG15Small portion cDNA encoding sequence and 3 ' terminator sequence.Restriction enzyme shown in these 3 fragments usefulness is cut out sticky end, connect into recombinant gene expression box structure (Fig. 5), its dna sequence dna is shown in SEQ ID No.6.With this expression cassette sequence clone to (Lin etc. 2003, PNAS, 100, transformation carrier 5962-5967) based on transforming artificial chromosome vector.To contain the carrier of this recombinant gene expression box with agriculture bacillus mediated method (Hiei etc., 1994 Plant J.6,271-282) transform the described male-sterile mutation of importing system, obtain transformant.With transformant and 1 long-grained nonglutinous rice strain TB hybridization, and 3 generations that backcrossed take TB as recurrent parent, select the controlled HNLS-1 of being of male fertile of indica.Contain transgenosis and endogenous mutator gene with primer sets 5 '-CCTGTTCCATCGAGGAGT-3 '/5 '-CTCAACAATGGCCATCTCCA-3 ' and 5 '-CTCGGCCTCCTCTGGTGGAAGT-3 '/5 '-CGGCTGCCGCAGTTGTAGGT-3 ' screening when backcrossing at every turn Osabcg15Individuality as the female parent that backcrosses.

Embodiment 4The breeding of the controlled system of rice male fertility

Flower pesticide meiophase of the controlled system of male fertile to the mononuclear microspore phase, spray application to blade with 0.05% Wocosin 50TK or 0.05% nitrile bacterium azoles or 0.05% Wocosin 50TK+0.05% nitrile bacterium azoles mixed aqueous solution, heavy dressing once after 3 days.The result shows, uses separately the self-fruitful rate of Wocosin 50TK or nitrile bacterium azoles to be about 60%, and the self-fruitful rate that 2 kinds of inductors are used with is about 86%(Fig. 6).

Embodiment 5Controlled system carries out hybrid seeding with the paddy rice male fertile

The controlled system of rice male fertility that the present invention is bred and 1 long-grained nonglutinous rice strain HNLR-1 are aided with when the heading poplar bloassom and manually catch up with pollen to improve hybrid rate in the ratio plantation of 12:2, obtain F1 cenospecies (setting percentage approximately 55%).The pollen of F1 hybrid plant normally can be educated, and self-fruitful rate reaches approximately 90%(Fig. 7).

＜110〉Agricultural University Of South China

＜120〉construction process and the breeding method of the controlled system of a kind of rice male fertility

<160> 6

<210> 1

<211> 5579

<212> DNA

＜213〉paddy rice ( Oryza sativa)

<400> 1

1 tacctgatta aaaggagaga agggcagtct gcttggcgct ctctctctga acctgtcact

61 ctttttttct gtgtctcttg gaggagatga tggagatcag cagcaatgag gagatgatgg

121 agatggccat tgttgagcag ctgcctcctt cctctcatca tctcaatggt ggcagtgttg

181 aggttgacat ggaggaggat catgtgtggc caaccaaaga tggccctctc cctatattcc

241 ttaaggtgtg tatatctatc tcttcttcca tttttcggga gagggccatc tttggttggg

301 tatgcgcgaa aacagatcaa gtttatcctt gttgatgttc aagaaagtgt tttaatccct

361 cgtttatggt tatgaaaaat tatgaaaaca ataaatagat tatccctata agcttttata

421 ggtaagtgga tacatatgtg catgtttgta ggtatgtgaa aagattaatc agaatgctta

481 cacatgttga tgttctccct atgtagtgtg tgtatatatg tgcatgtttg atgtttgtag

541 caactgaaca atttagttct actaagcaga gtttgaaaaa gatcgatatt actaccagga

601 tttattaaga tactaaaggt tttaccgtga ttaatcatga aatcatgaaa aaaagtttgt

661 attaattatt tcttatgcat tttatagagt ctaattttga actcagagat gcaaaaaatg

721 ccaaacaaag gaaacgacct gaaatagaca tacttaagga gggaaggtac aagttagttg

781 gttggcaatt tgcatgtctc attgctcaac agtttcttat ctaattgcaa aaacttcttg

841 catggtgttt ttacttcttt ggcatgcaat atagctaaca aaaaaggagc aaattcctgg

901 tctaaatttt tgcttgatat ataaatattt ttttttggaa agtgcagttt gagaatgtgg

961 agtacaaggt gaagctgact ccaaagaacc cactaacagc tgcaagggtg gcatttgcat

1021 ctcacaagag cactgaggat cagggcagct gcaagcacat cctcaagggg ataggaggca

1081 gtgttgaccc tggtgagatc ctggcactga tgggcccatc tggcagtggc aagaccacgc

1141 tgctcaagat acttggaggc aggctcagtg gtggtgtcaa gggccagatc acctacaatg

1201 acacccccta cagtccctgc ctcaaaagaa ggtattccct ctatttcata ttataagtcg

1261 ttttgacttt ttcttattta aacattatta agtttaacta agtttataaa aatagcaatg

1321 ttttaaacac caaattagtt tcattaaatt tagcatcgaa tatattttga taatatgttt

1381 gtttaattct tttgtgttaa aaatattact atatttttct ataaacttac ttaaacgtaa

1441 agaaatttaa ctagaaaaaa aagttaaaat gacttataat atgaaataga gagagtaact

1501 gtataaagtc atagtggata ttaattagta tgatttatgt aatgagaaag gtccggggtc

1561 ttccgactag cacgataagg tgtgggttag ttgatcaagt tcaagcctca tctctcttaa

1621 taaattttga tataaaagtt atttctctca tatctagtgt ttttttttat ttatggtagt

1681 tattgtaaga ccataaggta tgggttaggc cctgtttagt ttccaaaaac ttttcgaaaa

1741 aacatcacat cgaatcttta gacacatgta tggatcatta aatatagata aaaataaaaa

1801 ctaattacac agtttgtatg taaatcgcga gacgaatctt ttgagcctaa ttagcccatg

1861 attagccata agtgttacag taactcacat gtactaatgc cggcttaatt aggctcaaaa

1921 cattcgtctc gcggtttggc gagttatgaa attagttttt tcattcgtgt ccgaaaaccc

1981 cttccgacat ccggtcaaac gtccgatgtg acacccaaaa attttcattt caccaactaa

2041 ataggccctt agttattgta agatagaatt tttgcatagt tatgctatct ttcgtaaact

2101 agtggagtag attgagtaaa accagtatgt cttcaaagag aatttacagg cacgcaaatg

2161 actgacaaac tgcttagtgt ttactgcaat cttcagataa gagagaacat gtattggcat

2221 gccaaattaa gcagtgtagt tgcattgttc tgcaggtatc aattaaagtg gaaaaattaa

2281 gtaatcaaga ctaattattt tcttttgatg aaaacaggat tggatttgtg acacaggacg

2341 acgtcctttt ccctcagttg acagtggagg agacccttgt gttcgctgcc ttcttgagac

2401 tccccgctcg catgtcaaag cagcagaagc gcgacagagt tgacgccatc ataactgagc

2461 taaatctaga gaggtctgta agtatatttt catcaaagga aaaaaaaaac tacaccgatt

2521 ttactaatat aagttgtcaa accaacaatc tgcagcttaa cacaaaccca cgtgaagcaa

2581 aatagcatac aaaataaaat catgactaat agcataaatc tgtttttttt ctgaaattcg

2641 aataagaaaa tgcaaagaaa cgcaaatatc gcatcttaaa gtacagtggt gcattagaat

2701 tactcttgat ttttctcgac caacctacat gacataccta ctgaacgtgc actttcattt

2761 caaaagagaa attttacagt tcttaaagag ttattatatt ttgtagtgca aatcaaaatt

2821 tacattagaa aaaaaatgat atcttttaac ggtcacaaaa ttactcatct taaaaatggt

2881 gggtcatacg gcaatggtat acccattgaa cagtgtttac gatttcggaa aattttggac

2941 cctggcacaa aactacttca ctgaattatt tttccctttt ttttcatgaa tttgatcgaa

3001 aatttgttca aaacctaata aatagttttt aaatatccaa tatctcggaa aatttcgcta

3061 cccaggaccc acgacacaaa tgctgaaaac gaaaaggact acctattaaa cttttggtac

3121 atttataact ttgaatctta cataattttc aactaataga tatatagccc gttttaaatg

3181 aaatagaaaa aaaagagaca aacatgtcaa aaaaaaaacc gtaaatctaa cttaaaataa

3241 aatgttgtga aaaaaattct aatgtttgta cacgattgca aaactctgca ggtgccggca

3301 caccaagatc ggcggcgcgt tcgtgcgcgg cgtgtcgggc ggcgagagga agcggacgag

3361 catcgggtac gagatcctcg tcgacccgtc gctgctgctc ctcgacgagc ccacctcggg

3421 cctcgactcc acgtcggcgg cgaagctcct cgtcgtgctc cgccgcctcg ccaggtcggc

3481 ggcccgccgg acggtgatca ccaccatcca ccagccctcc agccggatgt tccacatgtt

3541 cgacaagctg ctgctcgtcg ccgagggcca cgccatctac cacggcggcg cccgcggctg

3601 catgcgccac ttcgccgccc tcggcttctc ccccggcatc gccatgaacc ccgccgagtt

3661 cctcctcgac ctcgccaccg gcaacctcga cggcatctcc tcccccgcct ccctcctcct

3721 cccctccgcc gccgccgcct cgccggactc ccccgagttc aggtcccacg tcatcaaggt

3781 atgtgcgtgt ctcgtgtcga gggcccaaga atcactctca tggcgttgtg ggtgcagtac

3841 ttgcaggcga ggcacagggc ggccggcgag gaggaggcgg cggccgcggc ggcgagggag

3901 ggcggcggcg gaggtggcgc ggggagggat gaggcggcga agcagctgag aatggcggtg

3961 aggatgagga aggataggcg gggcggcatc ggctggctgg agcagttcac cgtgctgtcg

4021 cggcgcacgt tccgggagcg cgccgccgac tacctcgaca agatgcgcct cgcccagtcc

4081 gtcggcgtcg ccctcctcct cggcctcctc tggtggaagt cccagacctc caacgaggcc

4141 cagctccgtg accaagtatg tacacttttc acaccaaata agctcggata aaaatgaaat

4201 tgaaatttgg gataattttg tttggattga acaaaaaaca ttgcagcata taccgaagtt

4261 cataaggtgg ctcaagtacg tgtcgttcat gcactacggg ttcaacctgc tgctgaaggc

4321 gcagtaccac ggccacctga cctacaactg cggcagccgc ggcggctgcc agcggctgca

4381 gtcctcgccg tcgttcggca ccgtcgacct cgacggcggc atgcgcgagg tctggatcct

4441 cctcgccatg gccgtcgcct accgcctcct cgcctacctc tgcctccgca agcggatcag

4501 cctcatgccc ttgtagtcca tcgatctgtc agatcaggat cagttggttc ggggaagaag

4561 acgactgatg tggtagtgaa ttgcaattgc gattgatgat ggtgaatggg ccattgttgg

4621 tttgggtgct gtgaattgtt tcaaacttga gttcttttct ttatttgaga agtatttgag

4681 gcttgtctgc ttagcaagtt gggaaataat caaccccatc attttagcat tcagcttgta

4741 agcataagcg aagatttatt taaaacttat ttttaaagtt aattttaggt atcttttcgt

4801 agtttatttt ctagcattta ctttttaatt tgctgagcat gtatattaaa gttttacgta

4861 taattttttt taaaattatt aataagttgt ttgtataagc gattagtctg tctcgtcgtc

4921 gtgacaaaaa gaaaaaccga tgagatggtt gggagccgat taaggttatt gttttcctcg

4981 aaaagagaag gtggagggga tggggtgaat ttaaatctcc ctgcaaaacc atttttggct

5041 ttgagctcaa aatttctcat tttccgtttg taatggacat agtagtatgt tctcctcagg

5101 gcctttgccc tattaggccc aaatctcctg cccgcaaaaa atgggctgac aacgtcacga

5161 accacgaacc gcgccgtaaa tgggccaaaa ataccaaggc ccaaatccta cagagcccaa

5221 agtagagggc cataatatgg gcctagaaat tcaacggccc gctccaatga gaagtggact

5281 cggagcggga ttcccccacc aaatccgttt cgacctcaga aaatacgcct ccgatcaggc

5341 gtttacgcac actactaata ttgacgagaa agccacctcc tctctctcgc tcgctccgct

5401 cttcttgaca aggaagcaaa agccgccgcc gccgacgccg acgagagagg agagagagat

5461 cgccgccgac gtcgcaggag ggggaggggg agatggcggc ggagggggag gacgcggcgg

5521 ccgcgcgacg ccgcgcggcg gccaccgact acaggaagaa gctcctcacc tgcagggag

<210> 2

<211> 7058

<212> DNA

＜213〉paddy rice ( Oryza sativa)

<400> 2

1 tacctgatta aaaggagaga agggcagtct gcttggcgct ctctctctga acctgtcact

61 ctttttttct gtgtctcttg gaggagatga tggagatcag cagcaatgag gagatgatgg

121 agatggccat tgttgagcag ctgcctcctt cctctcatca tctcaatggt ggcagtgttg

181 aggttgacat ggaggaggat catgtgtggc caaccaaaga tggccctctc cctatattcc

241 ttaaggtgtg tatatctatc tcttcttcca tttttcggga gagggccatc tttggttggg

301 tatgcgcgaa aacagatcaa gtttatcctt gttgatgttc aagaaagtgt tttaatccct

361 cgtttatggt tatgaaaaat tatgaaaaca ataaatagat tatccctata agcttttata

421 ggtaagtgga tacatatgtg catgtttgta ggtatgtgaa aagattaatc agaatgctta

481 cacatgttga tgttctccct atgtagtgtg tgtatatatg tgcatgtttg atgtttgtag

541 caactgaaca atttagttct actaagcaga gtttgaaaaa gatcgatatt actaccagga

601 tttattaaga tactaaaggt tttaccgtga ttaatcatga aatcatgaaa aaaagtttgt

661 attaattatt tcttatgcat tttatagagt ctaattttga actcagagat gcaaaaaatg

721 ccaaacaaag gaaacgacct gaaatagaca tacttaagga gggaaggtac aagttagttg

781 gttggcaatt tgcatgtctc attgctcaac agtttcttat ctaattgcaa aaacttcttg

841 catggtgttt ttacttcttt ggcatgcaat atagctaaca aaaaaggagc aaattcctgg

901 tctaaatttt tgcttgatat ataaatattt ttttttggaa agtgcagttt gagaatgtgg

961 agtacaaggt gaagctgact ccaaagaacc cactaacagc tgcaagggtg gcatttgcat

1021 ctcacaagag cactgaggat cagggcagct gcaagcacat cctcaagggg ataggaggca

1081 gtgttgaccc tggtgagatc ctggcactga tgggcccatc tggcagtggc aagaccacgc

1141 tgctcaagat acttggaggc aggctcagtg gtggtgtcaa gggccagatc acctacaatg

1201 acacccccta cagtccctgc ctcaaaagaa ggtattccct ctatttcata ttataagtcg

1261 ttttgacttt ttcttattta aacattatta agtttaacta agtttataaa aatagcaatg

1321 ttttaaacac caaattagtt tcattaaatt tagcatcgaa tatattttga taatatgttt

1381 gtttaattct tttgtgttaa aaatattact atatttttct ataaacttac ttaaacgtaa

1441 agaaatttaa ctagaaaaaa aagttaaaat gacttataat atgaaataga gagagtaact

1501 gtataaagtc atagtggata ttaattagta tgatttatgt aatgagaaag gtccggggtc

1561 ttccgactag cacgataagg tgtgggttag ttgatcaagt tcaagcctca tctctcttaa

1621 taaattttga tataaaagtt atttctctca tatctagtgt ttttttttat ttatggtagt

1681 tattgtaaga ccataaggta tgggttaggc cctgtttagt ttccaaaaac ttttcgaaaa

1741 aacatcacat cgaatcttta gacacatgta tggatcatta aatatagata aaaataaaaa

1801 ctaattacac agtttgtatg taaatcgcga gacgaatctt ttgagcctaa ttagcccatg

1861 attagccata agtgttacag taactcacat gtactaatgc cggcttaatt aggctcaaaa

1921 cattcgtctc gcggtttggc gagttatgaa attagttttt tcattcgtgt ccgaaaaccc

1981 cttccgacat ccggtcaaac gtccgatgtg acacccaaaa attttcattt caccaactaa

2041 ataggccctt agttattgta agatagaatt tttgcatagt tatgctatct ttcgtaaact

2101 agtggagtag attgagtaaa accagtatgt cttcaaagag aatttacagg cacgcaaatg

2161 actgacaaac tgcttagtgt ttactgcaat cttcagataa gagagaacat gtattggcat

2221 gccaaattaa gcagtgtagt tgcattgttc tgcaggtatc aattaaagtg gaaaaattaa

2281 gtaatcaaga ctaattattt tcttttgatg aaaacaggat tggatttgtg acacaggacg

2341 acgtcctttt ccctcagttg acagtggagg agacccttgt gttcgctgcc ttcttgagac

2401 tccccgctcg catgtcaaag cagcagaagc gcgacagagt tgacgccatc ataactgagc

2461 taaatctaga gaggtctgta agtatatttt catcaaagga aaaaaaaaac tacaccgatt

2521 ttactaatat aagttgtcaa accaacaatc tgcagcttaa cacaaaccca cgtgaagcaa

2581 aatagcatac aaaataaaat catgactaat agcataaatc tgtttttttt ctgaaattcg

2641 aataagaaaa tgcaaagaaa cgcaaatatc gcatcttaaa gtacagtggt gcattagaat

2701 tactcttgat ttttctcgac caacctacat gacataccta ctgaacgtgc actttcattt

2761 caaaagagaa attttacagt tcttaaagag ttattatatt ttgtagtgca aatcaaaatt

2821 tacattagaa aaaaaatgat atcttttaac ggtcacaaaa ttactcatct taaaaatggt

2881 gggtcatacg gcaatggtat acccattgaa cagtgtttac gatttcggaa aattttggac

2941 cctggcacaa aactacttca ctgaattatt tttccctttt ttttcatgaa tttgatcgaa

3001 aatttgttca aaacctaata aatagttttt aaatatccaa tatctcggaa aatttcgcta

3061 cccaggaccc acgacacaaa tgctgaaaac gaaaaggact acctattaaa cttttggtac

3121 atttataact ttgaatctta cataattttc aactaataga tatatagccc gttttaaatg

3181 aaatagaaaa aaaagagaca aacatgtcaa aaaaaaaacc gtaaatctaa cttaaaataa

3241 aatgttgtga aaaaaattct aatgtttgta cacgattgca aaactctgca ggtgccggca

3301 caccaagatc ggcggcgcgt tcgtgcgcgg cgtgtcgggc ggcgagagga agcggacgag

3361 catcgggtac gagatcctcg tcgacccgtc gctgctgctc ctcgacgagc ccacctcggg

3421 cctcgactcc acgtcggcgg cgaagctcct cgtcgtgctc cgccgcctcg ccaggtcggc

3481 ggcccgccgg acggtgatca ccaccatcca ccagccctcc agccggatgt tccacatgtt

3541 cgacaagctg ctgctcgtcg ccgagggcca cgccatctac cacggcggcg cccgcggctg

3601 catgcgccac ttcgccgccc tcggcttctc ccccggcatc gccatgaacc ccgccgagtt

3661 cctcctcgac ctcgccaccg gcaacctcga cggcatctcc tcccccgcct ccctcctcct

3721 cccctccgcc gccgccgcct cgccggactc ccccgagttc aggtcccacg tcatcaaggt

3781 atgtgcgtgt ctcgtgtcga gggcccaaga atcactctca tggcgttgtg ggtgcagtac

3841 ttgcaggcga ggcacagggc ggccggcgag gaggaggcgg cggccgcggc ggcgagggag

3901 ggcggcggcg gaggtggcgc ggggagggat gaggcggcga agcagctgag aatggcggtg

3961 aggatgagga aggataggcg gggcggcatc ggctggctgg agcagttcac cgtgctgtcg

4021 cggcgcacgt tccgggagcg cgccgccgac tacctcgaca agatgcgcct cgcccagtcc

4081 gtcggcgtcg ccctcctcct cggcctcctc tggtggaagt cccagacctc caacgaggcc

4141 cagctccgtg accaagtatg tacactagct tcttcttcct cctctcgaca ccgccattgc

4201 tgacgtcatc aagaactcaa actgtccgat caagaacaca tacacaaacc caccctctcc

4261 ttcttcctcc tcctctcgac accgccattg ctgacgccat tgtcaagaac atacattcct

4321 cttcttcctc ctcctctcga caccgccatt gctgacgtca tcaagaactc aaactgtccg

4381 gtcaagaaca cacaccctct tcttcttcct cctctcgata tcgccatttt caagaacata

4441 cactcctctt cttctttctc ctcctttcga caccgccatt gctgacgtca tcaagaactc

4501 aaactgttcg atcaagaaca tacacataaa ctcctcttct tcctcctcct ctcgccacca

4561 ccattgctga cgtcatcaat aactcaaaac acacacctct tcttcctcct cctcctctcg

4621 acaccaccat tctcaagagt caagaacata cactcctcat cttcttcctc ctcctcctcc

4681 ttgcacagtt gcaccgccat cggcaagaag tcgaggtgat caagagtaat atgtgtgcgt

4741 ttgcaggtgg ggttgatatt ctacatctgc atattctgga cgtcgtcgtc gctgttcggg

4801 tcggtgtacg tgttcccgtt cgagaagctg tacctggtga aggagaggaa ggcggacatg

4861 tacaggctga gcgcctacta cgcgagcagc acggtgtgcg acgcggtgcc gcacgtcgtg

4921 tacccggtgc tcttcacggc catcctctac ttcatggccg acctgcgccg caccgtgccc

4981 tgcttctgcc tcaccctcct cgccaccctc ctcatcgtcc tcaccagcca gggcaccggc

5041 gagctgctcg gcgccgccat cctcagcgtc aagcgcgccg gcgtcatggc ctcgctcgtc

5101 ctcatgctct tcctcctcac cggcggctac tacgtccagg tgaatctcac aaatatcatc

5161 ttctgatttc tgaattttgg ttctcgatca ctttcccgtg ttctaaaaca tggtttaaat

5221 gttgaagaaa tcaaaagtat tttggaagga cggatagaag tgaaattttg gactagaaag

5281 cacaaaatta tcttcttcta gtttctgaat tttgcttatc acaaacatgg ttataatatt

5341 gagtaaatta gaaacatttc ttcttttaga aaaaaaaaca aaaagtattt cagaaacaga

5401 gtttgaacaa gcaatttgtt tggctgaatt taaacatgtt ctactcaaat ttaaaaaaaa

5461 ctattttttt cggttaaaat aatatctggg aggccatata cccaaaattt ctaaaattcc

5521 tttccgaaaa tttcaaaaat aaatttgctc cgaaatgtga acgaacaggg ccaaaaaaaa

5581 cacacaaaat attacatatc attgtgcatg catcgactat ttatcgacat tatattccta

5641 acttttttca caccaaataa gctcggataa aaatgaaatt gaaatttggg ataattttgt

5701 ttggattgaa caaaaaacat tgcagcatat accgaagttc ataaggtggc tcaagtacgt

5761 gtcgttcatg cactacgggt tcaacctgct gctgaaggcg cagtaccacg gccacctgac

5821 ctacaactgc ggcagccgcg gcggctgcca gcggctgcag tcctcgccgt cgttcggcac

5881 cgtcgacctc gacggcggca tgcgcgaggt ctggatcctc ctcgccatgg ccgtcgccta

5941 ccgcctcctc gcctacctct gcctccgcaa gcggatcagc ctcatgccct tgtagtccat

6001 cgatctgtca gatcaggatc agttggttcg gggaagaaga cgactgatgt ggtagtgaat

6061 tgcaattgcg attgatgatg gtgaatgggc cattgttggt ttgggtgctg tgaattgttt

6121 caaacttgag ttcttttctt tatttgagaa gtatttgagg cttgtctgct tagcaagttg

6181 ggaaataatc aaccccatca ttttagcatt cagcttgtaa gcataagcga agatttattt

6241 aaaacttatt tttaaagtta attttaggta tcttttcgta gtttattttc tagcatttac

6301 tttttaattt gctgagcatg tatattaaag ttttacgtat aatttttttt aaaattatta

6361 ataagttgtt tgtataagcg attagtctgt ctcgtcgtcg tgacaaaaag aaaaaccgat

6421 gagatggttg ggagccgatt aaggttattg ttttcctcga aaagagaagg tggaggggat

6481 ggggtgaatt taaatctccc tgcaaaacca tttttggctt tgagctcaaa atttctcatt

6541 ttccgtttgt aatggacata gtagtatgtt ctcctcaggg cctttgccct attaggccca

6601 aatctcctgc ccgcaaaaaa tgggctgaca acgtcacgaa ccacgaaccg cgccgtaaat

6661 gggccaaaaa taccaaggcc caaatcctac agagcccaaa gtagagggcc ataatatggg

6721 cctagaaatt caacggcccg ctccaatgag aagtggactc ggagcgggat tcccccacca

6781 aatccgtttc gacctcagaa aatacgcctc cgatcaggcg tttacgcaca ctactaatat

6841 tgacgagaaa gccacctcct ctctctcgct cgctccgctc ttcttgacaa ggaagcaaaa

6901 gccgccgccg ccgacgccga cgagagagga gagagagatc gccgccgacg tcgcaggagg

6961 gggaggggga gatggcggcg gagggggagg acgcggcggc cgcgcgacgc cgcgcggcgg

7021 ccaccgacta caggaagaag ctcctcacct gcagggag

<210> 3

<211> 2067

<212> DNA

＜213〉paddy rice ( Oryza sativa)

<400> 3

1 atgatggaga tcagcagcaa tgaggagatg atggagatgg ccattgttga gcagctgcct

61 ccttcctctc atcatctcaa tggtggcagt gttgaggttg acatggagga ggatcatgtg

121 tggccaacca aagatggccc tctccctata ttccttaagt ttgagaatgt ggagtacaag

181 gtgaagctga ctccaaagaa cccactaaca gctgcaaggg tggcatttgc atctcacaag

241 agcactgagg atcagggcag ctgcaagcac atcctcaagg ggataggagg cagtgttgac

301 cctggtgaga tcctggcact gatgggccca tctggcagtg gcaagaccac gctgctcaag

361 atacttggag gcaggctcag tggtggtgtc aagggccaga tcacctacaa tgacaccccc

421 tacagtccct gcctcaaaag aaggattgga tttgtgacac aggacgacgt ccttttccct

481 cagttgacag tggaggagac ccttgtgttc gctgccttct tgagactccc cgctcgcatg

541 tcaaagcagc agaagcgcga cagagttgac gccatcataa ctgagctaaa tctagagagg

601 tgccggcaca ccaagatcgg cggcgcgttc gtgcgcggcg tgtcgggcgg cgagaggaag

661 cggacgagca tcgggtacga gatcctcgtc gacccgtcgc tgctgctcct cgacgagccc

721 acctcgggcc tcgactccac gtcggcggcg aagctcctcg tcgtgctccg ccgcctcgcc

781 aggtcggcgg cccgccggac ggtgatcacc accatccacc agccctccag ccggatgttc

841 cacatgttcg acaagctgct gctcgtcgcc gagggccacg ccatctacca cggcggcgcc

901 cgcggctgca tgcgccactt cgccgccctc ggcttctccc ccggcatcgc catgaacccc

961 gccgagttcc tcctcgacct cgccaccggc aacctcgacg gcatctcctc ccccgcctcc

1021 ctcctcctcc cctccgccgc cgccgcctcg ccggactccc ccgagttcag gtcccacgtc

1081 atcaagtact tgcaggcgag gcacagggcg gccggcgagg aggaggcggc ggccgcggcg

1141 gcgagggagg gcggcggcgg aggtggcgcg gggagggatg aggcggcgaa gcagctgaga

1201 atggcggtga ggatgaggaa ggataggcgg ggcggcatcg gctggctgga gcagttcacc

1261 gtgctgtcgc ggcgcacgtt ccgggagcgc gccgccgact acctcgacaa gatgcgcctc

1321 gcccagtccg tcggcgtcgc cctcctcctc ggcctcctct ggtggaagtc ccagacctcc

1381 aacgaggccc agctccgtga ccaagtgggg ttgatattct acatctgcat attctggacg

1441 tcgtcgtcgc tgttcgggtc ggtgtacgtg ttcccgttcg agaagctgta cctggtgaag

1501 gagaggaagg cggacatgta caggctgagc gcctactacg cgagcagcac ggtgtgcgac

1561 gcggtgccgc acgtcgtgta cccggtgctc ttcacggcca tcctctactt catggccgac

1621 ctgcgccgca ccgtgccctg cttctgcctc accctcctcg ccaccctcct catcgtcctc

1681 accagccagg gcaccggcga gctgctcggc gccgccatcc tcagcgtcaa gcgcgccggc

1741 gtcatggcct cgctcgtcct catgctcttc ctcctcaccg gcggctacta cgtccagcat

1801 ataccgaagt tcataaggtg gctcaagtac gtgtcgttca tgcactacgg gttcaacctg

1861 ctgctgaagg cgcagtacca cggccacctg acctacaact gcggcagccg cggcggctgc

1921 cagcggctgc agtcctcgcc gtcgttcggc accgtcgacc tcgacggcgg catgcgcgag

1981 gtctggatcc tcctcgccat ggccgtcgcc taccgcctcc tcgcctacct ctgcctccgc

2041 aagcggatca gcctcatgcc cttgtag

<210> 4

<211> 688

<212> PRT

＜213〉paddy rice ( Oryza sativa)

<400> 4

1 MMEISSNEEM MEMAIVEQLP PSSHHLNGGS VEVDMEEDHV WPTKDGPLPI FLKFENVEYK

61 VKLTPKNPLT AARVAFASHK STEDQGSCKH ILKGIGGSVD PGEILALMGP SGSGKTTLLK

121 ILGGRLSGGV KGQITYNDTP YSPCLKRRIG FVTQDDVLFP QLTVEETLVF AAFLRLPARM

181 SKQQKRDRVD AIITELNLER CRHTKIGGAF VRGVSGGERK RTSIGYEILV DPSLLLLDEP

241 TSGLDSTSAA KLLVVLRRLA RSAARRTVIT TIHQPSSRMF HMFDKLLLVA EGHAIYHGGA

301 RGCMRHFAAL GFSPGIAMNP AEFLLDLATG NLDGISSPAS LLLPSAAAAS PDSPEFRSHV

361 IKYLQARHRA AGEEEAAAAA AREGGGGGGA GRDEAAKQLR MAVRMRKDRR GGIGWLEQFT

421 VLSRRTFRER AADYLDKMRL AQSVGVALLL GLLWWKSQTS NEAQLRDQVG LIFYICIFWT

481 SSSLFGSVYV FPFEKLYLVK ERKADMYRLS AYYASSTVCD AVPHVVYPVL FTAILYFMAD

541 LRRTVPCFCL TLLATLLIVL TSQGTGELLG AAILSVKRAG VMASLVLMLF LLTGGYYVQH

601 IPKFIRWLKY VSFMHYGFNL LLKAQYHGHL TYNCGSRGGC QRLQSSPSFG TVDLDGGMRE

661 VWILLAMAVA YRLLAYLCLR KRISLMPL

<210> 5

<211> 2805

<212> DNA

＜213〉paddy rice ( Oryza sativa)

<400> 5

1 taaattattt ttccaatatt tattttttta aaattttaaa tttcgaatta taaatttatt

61 tctatatgga cttctatttt ttttcaattt caaattttaa ttagttctaa attatataat

121 ggtgtggact ctaatacttt cttttaatat ttattattat taattctgaa tttcagctat

181 ttaaaattgt atttctatat ggactctatt attctttttt aatccaagtt tttgatattt

241 ctaaatttta tttcaacata gactcttctt aaaattttct tcatttttat tccaaatttt

301 agatatatat taaattatat ttatatttat aaatagtttt attttcatct aggtagttga

361 agagaattct ttattctgaa tttcagatat attgaaatat atttccattt gaactctatt

421 tttttctaat taatatggaa atttgtagaa agtggaagca aatatggtgg cctttttata

481 ttagactaag atatactatt atagacatat aaatgcgtag agtgtgcagg tatgaccgta

541 tgaacatgcc attagagatt tgatttgttg caacggggag aatagatcga gataagcaat

601 gaaaccaata cctcttacgg acatgagcac ttgtgatttg tattatacac ggttactgta

661 gcccagctta ggtttttttc ccttggaaaa ggcttccaag ctactaatca ttctatgcag

721 ctgtccgatc ggacacattt ttttttctaa aaaaagtcct tatatacaaa aaattttcct

781 tatatatttt ttattctgct tatttctata tggactctaa tctctacttt tagttttctt

841 atcttcttaa attctgaatt ctcattagtt ctattgtcta ccggtatgga ctctagtatt

901 atattcctat attctatatt tttaatccga atttcagcta tttttaaatt gtatattcct

961 atatggactc tgttttttct ttttctctga ttaatatgag aatttctagg ctataagagc

1021 aaacgtggag gcttcttttt ctattccttt aataagttaa ctagcatagt gacccgcgca

1081 gattgcgcgg ctagcatcat tatagtttct ctcatataat agcatatata tatttctcat

1141 tatattaaaa tgaaaatata atttgaaatt ttgcaataac tttacgaaac aactaatgtg

1201 tagtattcat attgtatttt atatatgtgt tagttattaa ttatttttaa tatcaaattt

1261 aagttatttg taaattatat atattcctat atggactcta gactcgtctt ttaatattta

1321 tttttttaat tatgaatttt tattatttct gattgtattt ctacgtggac actaaactca

1381 tctttcaata ttctttaatt ttttatttca aatttcagtt agtattccta tattgacttt

1441 gcttcttccc atttttttta attttaaatt ttagttattt gtaaattata tttttatacg

1501 gactctgaat actactttta attttattat gtttattccc aattttagtt agttttaaat

1561 tcttatatgg actctatact ctacttctaa tattcctttt tttaattcca aatttctatt

1621 tttttcgtaa ttgtatttat atgtggactc tatactctac ttctaatatt ccatattttt

1681 aattccgaat ttctattatt tcctaattgt attttctata tggactctgt actctacttc

1741 taaaagcacg aacaaacaaa atacattgga ttgtctttgc tatatgaagc atataacttc

1801 gagtttcttt cattctacac accattcata tttttgcgag tacattttta ttatatatgt

1861 agcctgtaat aacttttcca ttattgctaa taaaatacgt ttattagcaa taatagtttt

1921 cagaatttat taaaaaagag ggactctaaa cattcaatta aaactggaaa acaccatatc

1981 tttaatttat acttaattta taagacatat cttttaaaca aactaagtca aactcctctc

2041 aagataataa taaaaaaaat aaatcttata gtaataaatt aaatattata tagtttaaag

2101 ctaataaata ttttgcaaaa tttcaaataa tgtcgatgaa caaaatttga agagaaataa

2161 tacttttgaa gcatataggc cgggtcattc ggttgatatt ttatccttat aaatttctca

2221 aacatatcgt acaatacatg cccgcgtgaa tgcacgggct aatttcctag ttatatgaaa

2281 acaaataaaa ttagttatag atgacgggag acaataaaag aaatctacga tatataggat

2341 tattttatgg acttgctgaa ggaaggtggg cccaaatatg ggtcatgtag caaatgattg

2401 ttggagcaag gcccagccca aggtagcgta catccagacg aattccctag cttgcggata

2461 ctgacgctcc gaaatgcgct ggtgctggaa gctgtggaag gaaggctctc gagtctggaa

2521 gccgcatcgc gctttctccg ctccacctcc acgatccaac agatgggctg caaccccaaa

2581 agagcgggaa atgttgagaa gcctctggaa cacctgcgat ccgtccatcg tcttcctgtt

2641 ccatcgagga gtatatatat atatctgtcc gtccgtccta cttgtcaaat ccaatcgatc

2701 catctctgca cagctgcact tgcatttcag ccagcgacaa gaaagcacca aatctctttg

2761 cattcaagca gcaggcaaca ttgttgagga gggatcaccg atcgg

<210> 6

<211> 6035

<212> DNA

＜213〉paddy rice ( Oryza sativa)

<400> 6

1 ggccggccta aattattttt ccaatattta tttttttaaa attttaaatt tcgaattata

61 aatttatttc tatatggact tctatttttt ttcaatttca aattttaatt agttctaaat

121 tatataatgg tgtggactct aatactttct tttaatattt attattatta attctgaatt

181 tcagctattt aaaattgtat ttctatatgg actctattat tcttttttaa tccaagtttt

241 tgatatttct aaattttatt tcaacataga ctcttcttaa aattttcttc atttttattc

301 caaattttag atatatatta aattatattt atatttataa atagttttat tttcatctag

361 gtagttgaag agaattcttt attctgaatt tcagatatat tgaaatatat ttccatttga

421 actctatttt tttctaatta atatggaaat ttgtagaaag tggaagcaaa tatggtggcc

481 tttttatatt agactaagat atactattat agacatataa atgcgtagag tgtgcaggta

541 tgaccgtatg aacatgccat tagagatttg atttgttgca acggggagaa tagatcgaga

601 taagcaatga aaccaatacc tcttacggac atgagcactt gtgatttgta ttatacacgg

661 ttactgtagc ccagcttagg tttttttccc ttggaaaagg cttccaagct actaatcatt

721 ctatgcagct gtccgatcgg acacattttt ttttctaaaa aaagtcctta tatacaaaaa

781 attttcctta tatatttttt attctgctta tttctatatg gactctaatc tctactttta

841 gttttcttat cttcttaaat tctgaattct cattagttct attgtctacc ggtatggact

901 ctagtattat attcctatat tctatatttt taatccgaat ttcagctatt tttaaattgt

961 atattcctat atggactctg ttttttcttt ttctctgatt aatatgagaa tttctaggct

1021 ataagagcaa acgtggaggc ttctttttct attcctttaa taagttaact agcatagtga

1081 cccgcgcaga ttgcgcggct agcatcatta tagtttctct catataatag catatatata

1141 tttctcatta tattaaaatg aaaatataat ttgaaatttt gcaataactt tacgaaacaa

1201 ctaatgtgta gtattcatat tgtattttat atatgtgtta gttattaatt atttttaata

1261 tcaaatttaa gttatttgta aattatatat attcctatat ggactctaga ctcgtctttt

1321 aatatttatt tttttaatta tgaattttta ttatttctga ttgtatttct acgtggacac

1381 taaactcatc tttcaatatt ctttaatttt ttatttcaaa tttcagttag tattcctata

1441 ttgactttgc ttcttcccat tttttttaat tttaaatttt agttatttgt aaattatatt

1501 tttatacgga ctctgaatac tacttttaat tttattatgt ttattcccaa ttttagttag

1561 ttttaaattc ttatatggac tctatactct acttctaata ttcctttttt taattccaaa

1621 tttctatttt tttcgtaatt gtatttatat gtggactcta tactctactt ctaatattcc

1681 atatttttaa ttccgaattt ctattatttc ctaattgtat tttctatatg gactctgtac

1741 tctacttcta aaagcacgaa caaacaaaat acattggatt gtctttgcta tatgaagcat

1801 ataacttcga gtttctttca ttctacacac cattcatatt tttgcgagta catttttatt

1861 atatatgtag cctgtaataa cttttccatt attgctaata aaatacgttt attagcaata

1921 atagttttca gaatttatta aaaaagaggg actctaaaca ttcaattaaa actggaaaac

1981 accatatctt taatttatac ttaatttata agacatatct tttaaacaaa ctaagtcaaa

2041 ctcctctcaa gataataata aaaaaaataa atcttatagt aataaattaa atattatata

2101 gtttaaagct aataaatatt ttgcaaaatt tcaaataatg tcgatgaaca aaatttgaag

2161 agaaataata cttttgaagc atataggccg ggtcattcgg ttgatatttt atccttataa

2221 atttctcaaa catatcgtac aatacatgcc cgcgtgaatg cacgggctaa tttcctagtt

2281 atatgaaaac aaataaaatt agttatagat gacgggagac aataaaagaa atctacgata

2341 tataggatta ttttatggac ttgctgaagg aaggtgggcc caaatatggg tcatgtagca

2401 aatgattgtt ggagcaaggc ccagcccaag gtagcgtaca tccagacgaa ttccctagct

2461 tgcggatact gacgctccga aatgcgctgg tgctggaagc tgtggaagga aggctctcga

2521 gtctggaagc cgcatcgcgc tttctccgct ccacctccac gatccaacag atgggctgca

2581 accccaaaag agcgggaaat gttgagaagc ctctggaaca cctgcgatcc gtccatcgtc

2641 ttcctgttcc atcgaggagt atatatatat atctgtccgt ccgtcctact tgtcaaatcc

2701 aatcgatcca tctctgcaca gctgcacttg catttcagcc agcgacaaga aagcaccaaa

2761 tctctttgca ttcaagcagc aggcaacatt gttgaggagg gatcaccgat cggtacctga

2821 ttaaaaggag agaagggcag tctgcttggc gctctctctc tgaacctgtc actctttttt

2881 tctgtgtctc ttggaggaga tgatggagat cagcagcaat gaggagatga tggagatggc

2941 cattgttgag cagctgcctc cttcctctca tcatctcaat ggtggcagtg ttgaggttga

3001 catggaggag gatcatgtgt ggccaaccaa agatggccct ctccctatat tccttaagtt

3061 tgagaatgtg gagtacaagg tgaagctgac tccaaagaac ccactaacag ctgcaagggt

3121 ggcatttgca tctcacaaga gcactgagga tcagggcagc tgcaagcaca tcctcaaggg

3181 gataggaggc agtgttgacc ctggtgagat cctggcactg atgggcccat ctggcagtgg

3241 caagaccacg ctgctcaaga tacttggagg caggctcagt ggtggtgtca agggccagat

3301 cacctacaat gacaccccct acagtccctg cctcaaaaga aggattggat ttgtgacaca

3361 ggacgacgtc cttttccctc agttgacagt ggaggagacc cttgtgttcg ctgccttctt

3421 gagactcccc gctcgcatgt caaagcagca gaagcgcgac agagttgacg ccatcataac

3481 tgagctaaat ctagagaggt gccggcacac caagatcggc ggcgcgttcg tgcgcggcgt

3541 gtcgggcggc gagaggaagc ggacgagcat cgggtacgag atcctcgtcg acccgtcgct

3601 gctgctcctc gacgagccca cctcgggcct cgactccacg tcggcggcga agctcctcgt

3661 cgtgctccgc cgcctcgcca ggtcggcggc ccgccggacg gtgatcacca ccatccacca

3721 gccctccagc cggatgttcc acatgttcga caagctgctg ctcgtcgccg agggccacgc

3781 catctaccac ggcggcgccc gcggctgcat gcgccacttc gccgccctcg gcttctcccc

3841 cggcatcgcc atgaaccccg ccgagttcct cctcgacctc gccaccggca acctcgacgg

3901 catctcctcc cccgcctccc tcctcctccc ctccgccgcc gccgcctcgc cggactcccc

3961 cgagttcagg tcccacgtca tcaagtactt gcaggcgagg cacagggcgg ccggcgagga

4021 ggaggcggcg gccgcggcgg cgagggaggg cggcggcgga ggtggcgcgg ggagggatga

4081 ggcggcgaag cagctgagaa tggcggtgag gatgaggaag gataggcggg gcggcatcgg

4141 ctggctggag cagttcaccg tgctgtcgcg gcgcacgttc cgggagcgcg ccgccgacta

4201 cctcgacaag atgcgcctcg cccagtccgt cggcgtcgcc ctcctcctcg gcctcctctg

4261 gtggaagtcc cagacctcca acgaggccca gctccgtgac caagtggggt tgatattcta

4321 catctgcata ttctggacgt cgtcgtcgct gttcgggtcg gtgtacgtgt tcccgttcga

4381 gaagctgtac ctggtgaagg agaggaaggc ggacatgtac aggctgagcg cctactacgc

4441 gagcagcacg gtgtgcgacg cggtgccgca cgtcgtgtac ccggtgctct tcacggccat

4501 cctctacttc atggccgacc tgcgccgcac cgtgccctgc ttctgcctca ccctcctcgc

4561 caccctcctc atcgtcctca ccagccaggg caccggcgag ctgctcggcg ccgccatcct

4621 cagcgtcaag cgcgccggcg tcatggcctc gctcgtcctc atgctcttcc tcctcaccgg

4681 cggctactac gtccagcata taccgaagtt cataaggtgg ctcaagtacg tgtcgttcat

4741 gcactacggg ttcaacctgc tgctgaaggc gcagtaccac ggccacctga cctacaactg

4801 cggcagccgc ggcggctgcc agcggctgca gtcctcgccg tcgttcggca ccgtcgacct

4861 cgacggcggc atgcgcgagg tctggatcct cctcgccatg gccgtcgcct accgcctcct

4921 cgcctacctc tgcctccgca agcggatcag cctcatgccc ttgtagtcca tcgatctgtc

4981 agatcaggat cagttggttc ggggaagaag acgactgatg tggtagtgaa ttgcaattgc

5041 gattgatgat ggtgaatggg ccattgttgg tttgggtgct gtgaattgtt tcaaacttga

5101 gttcttttct ttatttgaga agtatttgag gcttgtctgc ttagcaagtt gggaaataat

5161 caaccccatc attttagcat tcagcttgta agcataagcg aagatttatt taaaacttat

5221 ttttaaagtt aattttaggt atcttttcgt agtttatttt ctagcattta ctttttaatt

5281 tgctgagcat gtatattaaa gttttacgta taattttttt taaaattatt aataagttgt

5341 ttgtataagc gattagtctg tctcgtcgtc gtgacaaaaa gaaaaaccga tgagatggtt

5401 gggagccgat taaggttatt gttttcctcg aaaagagaag gtggagggga tggggtgaat

5461 ttaaatctcc ctgcaaaacc atttttggct ttgagctcaa aatttctcat tttccgtttg

5521 taatggacat agtagtatgt tctcctcagg gcctttgccc tattaggccc aaatctcctg

5581 cccgcaaaaa atgggctgac aacgtcacga accacgaacc gcgccgtaaa tgggccaaaa

5641 ataccaaggc ccaaatccta cagagcccaa agtagagggc cataatatgg gcctagaaat

5701 tcaacggccc gctccaatga gaagtggact cggagcggga ttcccccacc aaatccgttt

5761 cgacctcaga aaatacgcct ccgatcaggc gtttacgcac actactaata ttgacgagaa

5821 agccacctcc tctctctcgc tcgctccgct cttcttgaca aggaagcaaa agccgccgcc

5881 gccgacgccg acgagagagg agagagagat cgccgccgac gtcgcaggag ggggaggggg

5941 agatggcggc ggagggggag gacgcggcgg ccgcgcgacg ccgcgcggcg gccaccgact

6001 acaggaagaa gctcctcacc tgcagggagc tcgag

Claims (15)

1. the construction process of the controlled system of rice male fertility comprises:

(a) the sterile mutantion line of acquisition rice male fertile gene and corresponding male fertile gene;

(b) make up the male fertile gene expression cassette conversion carrier of being controlled by inducible promoter;

(c) transform described sterile mutantion line with described expression cassette conversion carrier, obtain the controlled system of rice male fertility.

2. construction process according to claim 1, wherein said male sterility of rice sudden change is the recessive sterile mutantion line that spontaneous mutation or induced mutations produce.

3. construction process according to claim 1, wherein said male sterility of rice sudden change is sporophyte type male-sterile mutation system.

4. construction process according to claim 1, wherein said male fertile gene is the gene of the pollen fertility that can recover described male sterile line, this gene is the functional type allelotrope of the sudden change fertile gene of described male sterile line.

5. construction process according to claim 1, described inducible promoter is chemically inducible promoter.

6. construction process according to claim 1, wherein said male-sterile mutation are that deposit number is the male-sterile mutation system of CCTCC P201207, and the genomic dna sequence of its afunction mutant fertile gene is shown in SEQ ID No.1.

7. construction process according to claim 1, the genomic dna sequence of wherein said male fertile gene is shown in SEQ ID No.2, or the cDNA sequence of described male fertile gene is shown in SEQ ID No.3.

8. method according to claim 7, the aminoacid sequence of the albumen of wherein said male fertile gene coding is shown in SEQ ID No.4.

9. method according to claim 5, the dna sequence dna of wherein said chemically inducible promoter is shown in SEQ ID No.5.

10. breeding method, it comprises:

(a) apply inductor to the controlled system of rice male fertility claimed in claim 1, so that the functional type male fertile gene is expressed, to recover pollen fertility, carry out self propagated; Or

(b) under field conditions (factors) the controlled system of rice male fertility claimed in claim 1 is planted by suitable proportion with the male parent line that normally can educate, thereby hybridize the acquisition cenospecies with male parent.

11. breeding method according to claim 10, wherein said inductor contain as the Wocosin 50TK of effective constituent or nitrile bacterium azoles or both combinations.

12. breeding method according to claim 10 wherein in step (a), applies inductor in the anther development phase to the controlled system of described rice male fertility.

13. breeding method according to claim 12, wherein the anther development phase is that meiophase is to the microspore development phase.

14. a recombinant gene expression box, its nucleotide sequence is shown in SEQ ID No.6.

15. a conversion carrier, it comprises the described recombinant gene expression box of claim 14.

Images