CN111825752B

CN111825752B - Rice spikelet clustering mutant and molecular identification method and application thereof

Info

Publication number: CN111825752B
Application number: CN202010658850.6A
Authority: CN
Inventors: 龙湍; 唐杰; 曾翔; 吴永忠; 黄培劲
Original assignee: Hainan Bolian Rice Gene Technology Co ltd
Current assignee: Hainan Bolian Rice Gene Technology Co ltd
Priority date: 2020-07-09
Filing date: 2020-07-09
Publication date: 2021-10-01
Anticipated expiration: 2040-07-09
Also published as: CN111825752A

Abstract

The invention relates to the technical field of plant molecular biology, in particular to a rice panicle cluster mutant and a molecular identification method and application thereof. The invention provides a rice SPED1 protein mutant, which takes an amino acid sequence of a wild rice SPED1 protein as a reference sequence, asparagine at the 519 th position of the mutant is mutated into serine, the amino acid sequence of the mutant is shown as SEQ ID NO.1, and a genome nucleotide sequence is shown as SEQ ID NO. 2. The mutant is a partial dominant mutant, the homozygous genotype and the heterozygous genotype can cause the cluster growth of spikelets at the top of the branch stems of rice plants, and the heterozygous genotype can also improve the maturing rate of rice. The mutant can be used for improving the maturing rate of hybrid rice and cultivating ornamental rice.

Description

Rice spikelet clustering mutant and molecular identification method and application thereof

Technical Field

The invention relates to the technical field of plant molecular biology, in particular to a rice panicle cluster mutant and a molecular identification method and application thereof.

Background

Rice (Oryza sativa) is one of the most important food crops in the world, and is also a model plant of Poaceae and monocotyledons. The spikelet is a unique structural unit of the inflorescence of the gramineae and has the biological function of flowering and fructification. The development process and the molecular regulation mechanism of the rice spikelets are deeply researched, so that the development process and the molecular basis of the rice inflorescence are easily understood, and the method has important significance for improving the yield and the quality of rice.

The inflorescence of rice is also called spike, and belongs to a complex inflorescence. The spike consists of a main spike stalk, a primary branch stalk, a secondary branch stalk, a spikelet stalk and a spikelet. The retrogressive growing point from the neck node of the spike to the top end of the spike is the spike stalk, and the spike stalk is generally provided with 8-15 spike nodes. The neck node of the ear is the lowest ear node, the growing point of the degraded ear top is the highest ear node, and each ear node is provided with a branch. The branch which is separated from the primary branch is called secondary branch. Besides the secondary branches, 4-7 spikelet branches can be scattered on the part close to the top end of each primary branch. 2-4 small ear stems can be scattered on each secondary branch stem. A spikelet is grown at the end of the spikelet stalk. Each spikelet can differentiate 3 glume flowers, but 2 spikelets can degenerate in the development process to form glume protection, which is called incomplete flower; the remaining flower is a complete flower which can blossom and fruit. Therefore, each spikelet has only 1 normal glume flower.

At present, many genes controlling development of rice SPIKELET have been cloned, such as SUPERNUMERARY BRACT (SNB), MULTI-FLORET SPIKELET1(MFS1), TONGARI-BOUSHI 1(TOB1), FON4, and the like. After the genes are mutated, the number of florets in spikelets is increased, and a new potential approach is provided for rice breeding aiming at increasing the number of grains per spike. However, the spikelets of snb, mfs1, tob1 and fon4 mutants show many other flower organ defects besides the flowering character, and cannot be directly applied to production.

Spikelet clustering is a mutation character, and refers to the phenomenon that a plurality of spikelets which are scattered originally and are close to the top end of a primary branch or a secondary branch are tightly gathered together to grow and develop due to the shortening of the branch and/or the spikelet shaft. SPED1 is a gene that regulates panicle clustering (Jiang G, Xiao Y, ZHao J, Yin D, ZHao X, Zhu L, ZHai W (2014) Regulation of affinity clustering within a novel path enclosing the pentatricopeptide repeat protein SPED1-D. genetics 197: 1395: 1407). The small ear cluster rice is different from the one-flower multi-ovary cluster rice: the one-flower multi-ovary clustered rice has a plurality of ovaries in one glume flower to generate a plurality of grains of rice, broken rice is easy to generate after rice milling, and therefore, the one-flower multi-ovary clustered rice has no practical value; and the complete flowers in each spikelet of the cluster rice with the spikelets have healthy glume and male and female flower organs, can normally bloom and bear fruits, and the grains are full and uniform in size and high in bearing rate. The spikelet cluster mutation can be directly applied to production, and can also be used as a new germplasm resource to be utilized in rice breeding.

Disclosure of Invention

The invention aims to provide a rice SPED1 protein mutant causing a spikelet clustering character, a coding gene, a molecular marker and application thereof.

The invention discovers a mutant of rice SPED1 protein, wherein the mutant is mutated into serine at the 519 th site compared with wild type SPED1 protein, the mutant is a partial dominant mutation, and can influence the development of rice spikelets and stalks and the spatial distribution of spikelets on the spikes, so that spikelets are clustered, spikelets are more flowering, the spikelets, the stalks and the spike length are shortened, and the grain number and the seed setting rate of the rice are improved.

The invention provides the following technical scheme:

in a first aspect of the present invention, a rice SPED1 protein mutant is provided, having an amino acid sequence of a wild type rice SPED1 protein as a reference sequence, the mutant comprising a mutation site wherein asparagine is mutated to serine at position 519.

The Genbank accession number of the wild type rice SPED1 protein described above is LOC _ Os06g 39650.

Specifically, the mutant has any one of the following amino acid sequences (1) to (3):

(1) an amino acid sequence shown as SEQ ID NO. 1;

(2) the corresponding protein obtained by substituting, deleting or inserting one or more amino acids in the amino acid sequence shown in SEQ ID NO.1 has the function of causing the rice to generate the spikelet cluster property and is derived from the amino acid sequence of the rice;

(3) has at least 90 percent of homology with the amino acid sequence shown in SEQ ID NO.1, has the function of causing the rice to generate the panicle cluster property and is derived from the rice corresponding to the protein.

In a second aspect, the present invention provides a nucleic acid encoding the rice SPED1 protein mutant.

Given the amino acid sequence of the rice SPED1 protein mutant, one skilled in the art can obtain the nucleotide sequence of a nucleic acid encoding a rice SPED1 protein mutant according to codon rules.

Optionally, the nucleic acid has a nucleotide sequence shown as SEQ ID NO. 2. The nucleotide sequence shown in SEQ ID NO.2 is the genomic nucleotide sequence of the SPED1 protein mutant.

The invention also provides rice SPED1 gene allelic mutant SPED1-1 (shown as SEQ ID NO. 2), which is characterized in that rice SPED1 gene generates a SNP mutation from A to G at 1556 th basic group of a coding region, so that 519 th amino acid residue of the coded protein is mutated from asparagine to serine.

A third aspect of the invention is to provide a biological material comprising said nucleic acid, said biological material being an expression cassette, a vector or a host cell.

The expression cassette can be a DNA fragment that links a nucleic acid encoding a mutant rice SPED1 protein to elements that regulate its transcription or expression.

The vector may be a cloning vector or an expression vector.

The host cell may be a microbial cell or a non-reproductive plant cell.

In a fourth aspect, the present invention provides rice, rice tissue or rice cells comprising the nucleic acid.

In a fifth aspect, the present invention provides a rice SPED1 protein mutant, a nucleic acid encoding the mutant, or a biological material comprising the nucleic acid for use in modulating any one of the following rice traits:

(1) clustering the small spikes;

(2) long spikelet stalk, long branch stalk or long spike;

(3) the grain number of the ears;

(4) setting percentage;

(5) the weight of the granules.

The above (1) to (2) are specifically: the rice has the heterozygosis or homozygosis genotype of the rice SPED1 protein mutant, so that the rice has the spikelet clustering character, the spikelet stem length and/or branch stem length of the rice is shortened, and the spike length of the rice is shortened.

The above (3) is specifically: reduction of panicle number in rice by conferring a heterozygous genotype for the rice SPED1 protein mutant; alternatively, the grain number per ear of rice is increased by conferring on rice a homozygous genotype for the rice SPED1 protein mutant.

The above (4) is specifically: increasing the maturing rate of rice by having rice with a heterozygous genotype for the rice SPED1 protein mutant; alternatively, the rice setting percentage is decreased by conferring the rice with a homozygous genotype for the rice SPED1 protein mutant.

The above (5) is specifically: the single grain weight of rice is reduced by conferring the rice with a homozygous genotype for the rice SPED1 protein mutant.

The sixth aspect of the present invention provides the use of a rice SPED1 protein mutant or a nucleic acid encoding the mutant or a biological material containing the nucleic acid in the breeding of rice having any of the following traits or in germplasm resource improvement:

(1) clustering the small spikes;

(2) the small ear stem length, the branch stem length or the ear length is shortened;

(3) the grain number of the grains per ear is changed;

(4) the maturing rate is changed;

(5) the grain weight is reduced.

The above (3) is specifically: reduction of panicle number in rice by conferring a heterozygous genotype for the rice SPED1 protein mutant; alternatively, the panicle number of rice is increased by conferring on rice a homozygous genotype for the rice SPED1 protein mutant.

In a seventh aspect, the present invention provides a method for producing improved rice, the method comprising: expressing the rice SPED1 protein mutant in rice.

The improved rice has any one of the following traits:

(1) clustering the small spikes;

(3) the grain number of the grains per ear is changed;

(4) the maturing rate is changed;

(5) the grain weight is reduced.

Preferably, the rice SPED1 protein mutant is expressed from rice by gene editing, crossing, backcrossing, selfing, or asexual propagation.

The spikelet clustering is specifically clustering of spikelets at the top of plant branches.

In an eighth aspect, the present invention provides a molecular marker for detecting the rice SPED1 protein mutant or a nucleic acid thereof, wherein the molecular marker is a DNA fragment containing a site with polymorphism A/G at position 96 of the sequence shown in SEQ ID NO. 6.

Specifically, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 6.

The ninth aspect of the invention provides a primer for amplifying the molecular marker, which comprises an upstream primer shown in SEQ ID NO.3-4 and a downstream primer shown in SEQ ID NO. 5.

The upstream primer sped1-1_ F1: AAAAAAAACTCAATCAAGCTACACCCT GAAC (SEQ ID NO. 3);

the upstream primer sped1-1_ F2: CTCAATCAAGCTACACCCTGCAG (SEQ ID NO. 4);

downstream primer sped1-1_ R: GAATTTGCTCATGTCTAATGTA (SEQ ID NO. 5).

The tenth aspect of the present invention provides any one of the following uses of the molecular marker or the primer:

(1) detecting whether rice contains the rice SPED1 protein mutant or a nucleic acid thereof;

(2) preparing the rice with the small ear cluster character.

In the application, the upstream primer shown in SEQ ID NO.3-4 and the downstream primer shown in SEQ ID NO.5 are used for PCR amplification, if only a 126bp product can be amplified, the rice to be detected is the homozygous genotype of the gene corresponding to the rice SPED1 protein mutant, and the phenotype is 2 or more than 2 spikelets clustered at the tail end of a branch; if the product of 118bp can be amplified, the rice to be detected does not carry the corresponding gene of the rice SPED1 protein mutant, and the phenotype is that the spikelets at the tail ends of the branches do not cluster; if products of 126bp and 118bp can be amplified simultaneously, the rice to be detected is a heterozygous genotype of the corresponding gene of the rice SPED1 protein mutant, and the phenotype is that the tail end of a branch has no more than 2 spikelets and clusters.

The invention has the following beneficial effects:

(1) the invention provides a novel rice spikelet clusterin mutant sped1-1 and a molecular marker and detection method thereof, and provides a novel method for breeding rice with clusterin character.

(2) The speed of the sped1-1 heterozygous genotype can be improved under the condition of not influencing the grain weight obviously, and a new method is provided for improving the yield of the hybrid rice.

Drawings

FIG. 1 shows the phenotype of panicles in the yellow-ripe stage of wild type rice and sped1-1 mutant in example 2 of the present invention; wherein A is the phenotype of a wild-type spikelet; b is the phenotype that 2 spikelets cluster at the tail end of the branch when the sped1-1 mutant is heterozygous; c is the phenotype of 3 spikelets clustered at the tail end of the branch when the sped1-1 mutant is homozygous genotype.

FIG. 2 is a map of the cloned map of sped1-1 gene in example 5 of the present invention.

FIG. 3 is a peak diagram showing the sequencing result of the sped1-1 gene in example 7 of the present invention; wherein A is the heterozygous genotype of 2 spikelets clustered at the tail end of a branch, and B is the homozygous mutant genotype of 3 spikelets clustered at the tail end of the branch.

FIG. 4 is a schematic diagram showing the mutation site and amino acid residue changes of the sped1-1 mutant gene in example 7.

FIG. 5 is a schematic diagram of the design concept of mutation site molecular markers and their amplification primers in example 8 of the present invention.

FIG. 6 is a electrophoretogram showing coseparation and confirmation of sped1-1 gene in example 8 of the present invention, wherein 2 flowers and 3 flowers represent the cluster 2 ear mutant and cluster 3 ear mutant, respectively, MH63 represents Minghui 63, and ZH11 represents Zhonghua No. 11.

FIG. 7 is a schematic diagram showing the technical scheme of hybridization transfer of sped1-1 gene in example 9 of the present invention, wherein RP represents the recipient rice material.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

The experimental procedures used in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 obtaining of Rice panicle Cluster mutant sped1-1

A naturally variant rice panicle cluster mutant is obtained by screening in 2016 and is named as panicle cluster rice. Through planting and phenotype observation of early and late construction in 2017, the mutation is a heritable mutation. And (3) carrying out late breeding in 2017, carrying out reciprocal crossing on the panicle cluster rice with Minghui 63, Nipponbare and 93-11 to obtain F1 generation hybrid seeds, and carrying out early breeding and sowing F1 hybrid seeds in 2018, wherein all the hybrid seeds are found to be 2 panicles clustered at the tail ends of the branches, and the panicle clustering character is partially dominant. An F2 population is sown late in 2018, and by investigating phenotype separation of the F2 generation, the population can be found to be capable of separating various phenotypes such as a wild type, 2 spikelets clustered at the tail ends of branches, 3 spikelets, 4 spikelets, 5 spikelets and more than 5 spikelets. According to the difference of the number of clusters of spikelets, the seeds are harvested by single plants, and the plants are planted in 2019. From the pedigree, the genetic segregation ratio of one F3 population was found to conform to mendelian's law of inheritance, and this F3 population was used for analysis in subsequent examples.

Example 2 phenotypic analysis of Rice panicle Cluster mutant F3 population

In the F3 population obtained in example 1, glume and male and female floral organs of each seed of the small ear cluster rice are healthy and can normally raise flowers and fruit, the grains are full and slender, and the appearance and size of each cluster of rice are the same as those of a single grain. Compared with wild rice (A in FIG. 1), the speed 1-1 heterozygous mutant generally only clusters 2 spikelets at the end of the primary branch (B in FIG. 1), and the speed 1-1 homozygous mutant generally clusters 2-3 spikelets at the end of the primary and secondary branches, with more than 3 spikes (C in FIG. 1). The cluster growth of spikelets is mainly caused by the fact that the branch stalks and spikelet stalks in the mutant are obviously shortened compared with the wild type.

Example 3 genetic analysis of rice sped1-1 Gene

Among the F3 population obtained in example 1, 73 plants having 2 spikelets clustered at the end of a branch, 41 plants having 3 spikelets clustered at the end of a branch, 42 wild-type plants, wild-type: clustering 2 ears: the separation ratio of the clustered 3 spikes is 1:2:1 (X)²＝0.15，P>0.05). The results show that in the F3 population, the spikelet clustering character is a partial dominant character and is controlled by a single sped1-1 gene, and the plant with 2 spikelets clustered at the tail end of a branch is of a sped1-1 heterozygous genotype.

Example 4 race analysis of Rice spikelet Cluster mutant sped1-1

In order to specifically analyze the value of spikelet clustering on the utilization of planting resources, 5 individuals were randomly selected from the wild type, clustered 2 spikelets and clustered 3 spikelet plants isolated from the F3 population obtained in example 1 for each phenotype to perform seed test analysis on agronomic traits such as tillering, spike length, spike grain number, kernel number, and single grain weight (Table 1). As can be seen from Table 1, the mutant increased slightly in the number of effective ears as compared with the wild type. While the panicle length of the clustered 2 spikelet plant is shorter than that of the wild type in the panicle length aspect, and the panicle length of the clustered 3 spikelet plant is shorter than that of the clustered 2 spikelet plant, mainly because the spikelets of the mutant are more closely planted and the branch stalks and spikelet stalks are shorter. In the aspect of the grain number of the cluster, the grain number difference of the cluster 2 spikelets among the single plants is larger, so that the average grain number of the cluster is reduced compared with that of the wild type, and the average grain number of the cluster 3 spikelet plants is slightly increased compared with that of the wild type, which shows that the cluster character has the effect of increasing the grain number of the cluster to a certain extent. In the aspect of the number of the seeds, the number of the seeds/panicle can be seen, the effective seed setting rate of a wild type plant is 64.8%, the effective seed setting rate of a cluster 2 spikelet plant is 68.8%, and the effective seed setting rate of a cluster 3 spikelet plant is 59.0%, which indicates that the cluster 2 spikelet plant has the highest seed setting rate, and suggests that the sped1-1 heterozygous genotype has the potential for improving the seed setting rate in the hybrid rice combination breeding. In terms of single grain weight, the clustered 3 spikelet plants are significantly reduced compared to the wild type, but the clustered 2 spikelet plants are not significantly different from the wild type.

TABLE 1 agronomic traits test analysis

Example 5 mapping of Rice panicle Cluster mutant sped1-1 Gene

Using the F3 population obtained in example 1 as a mapping population, the sped1-1 gene was mapped using the map-based cloning method (FIG. 2). The population was used to initially localize sped1-1 at a distance of about 4Mb between chromosome 6 SSR markers 6.215 and 6.263, followed by the development of closely linked markers RM20270, RM20300, RM20316, RM20343, RM20356, RM20361, 6.246, RM20424 between 2 markers, and sped1-1 co-segregates with SSR markers RM20316 and RM 20343. The number of the crossover individuals between the sped1-1 gene and the 8 markers is 3, 2, 0, 2, 1 and 5. According to literature reports, a gene SPED1 controlling the panicle cluster growth trait is located in the section where SPED1-1 is located. The sequences of the labeled primer pairs used for localization are shown in Table 2.

TABLE 2 primer pair sequences for mapping sped1-1

Example 6 candidate Gene sequencing

DNA of rice leaves is extracted by a CTAB method, the concentration of the DNA is detected by a Nanodrop2000, and the DNA is diluted to 10ng/L to be used as a PCR template. Primers for the candidate gene, SPED1, were used to amplify DNA from wild type and clustered 3 spikelet plants.

The primer pair sequences used to amplify SPED1 are shown in Table 3:

TABLE 3 primer pair sequences for amplification of sped1-1

The PCR reaction system is as follows: mu.L of 10 × reaction buffer, 0.25. mu.L dNTP, 0.25. mu.L of forward primer and 0.25. mu.L of reverse primer, 0.5UTaq enzyme, 1. mu.L of 10 ng/. mu.L template DNA, and ultrapure water were added to make up the total volume to 10. mu.L.

The PCR reaction program is: denaturation at 94-98 ℃ for 1-3min, then the following cycles were performed: denaturation at 95 ℃ for 20s, renaturation at 53-58 ℃ for 20s, extension at 72 ℃ for 30s, and 30-40 cycles. And (3) after the circulation is finished, performing additional extension at 72 ℃ for 3-10min, and finishing the reaction.

Preparing 1.5% agarose gel, and performing electrophoresis for 30min under an electric field of 5V/cm; and recovering the PCR product by using a DNA gel recovery kit.

Example 7 DNA sequence analysis of sped1-1 Gene

The PCR product DNAs of the wild type and the mutant recovered in example 6 were sequenced by using ABI3730 sequencer, and the sequencing primers used were a forward primer and a reverse primer, respectively. The results of the bidirectional sequencing were spliced using the common DNA sequence analysis software dnaman6.0. The sequencing peak map is shown in FIG. 3, A in FIG. 3 is the sequencing peak of the clustered 2 ear mutant, B in FIG. 3 is the sequencing peak map of the clustered 3 ear mutant, and the wild type and the mutant sequences are compared to find that the A base, which is combined in the 1556 th base of the genome sequence of the sped1-1 gene in the sequencing of the clustered 3 ear mutant, is replaced by 1G base (the genome nucleotide sequence of the sped1-1 gene is shown in SEQ ID NO. 2); the mutation site is located on an exon, and protein sequence analysis alignment shows that the mutation causes amino acid change, so that the 519 th asparagine in the wild type is replaced by serine in the cluster 3 ear mutant (the amino acid sequence of the protein coded by the sped1-1 gene is shown as SEQ ID NO. 1). While the clustered 2 ear mutant is heterozygous at the site, which is consistent with the genetic analysis result. Mutation sites and amino acid residue changes of SPED1-1 mutant SPED1 gene are shown in FIG. 4.

Example 8 design and coseparation identification of molecular markers for mutation sites

Gene-specific primers were designed based on the sequences flanking the mutation site obtained in example 7 (FIG. 5): the forward primer sped1-1_ F1 has the nucleotide sequence shown in SEQ ID NO. 3; the forward primer sped1-1_ F2 has the nucleotide sequence shown in SEQ ID NO. 4; the reverse primer sped1-1_ R has the nucleotide sequence shown in SEQ ID No. 5.

MH63, ZH11, 93-11, the cluster 2 ear mutant and the cluster 3 ear mutant were amplified with the above primer pairs under the PCR reaction conditions described in example 6.

The amplification products were electrophoretically separated on a 12% polyacrylamide gel. The polyacrylamide gel electrophoresis method is as follows:

(1) preparing polyacrylamide gel: 80mL of 12% PA gum, 250 μ L (winter)/125 μ L (summer) of 10% ammonium persulfate, and 80 μ L of Tetramethylethylenediamine (TEMED). Shaking up and pouring glue. Repeatedly scrubbing the glass plate with detergent, and scrubbing and drying with alcohol. After 2% repal Silane was applied to the well in the fume hood, wiped with alcohol, dried, and the other plate was coated with 1.5mL of 0.5% Binding Silane (7.5. mu.L Binding Silane and 7.5. mu.L glacial acetic acid were added to a 1.5mL centrifuge tube to make up 95% ethanol to 1.5 mL). In the operation process, the two glass plates are prevented from being polluted by each other, and the glass plates are assembled and glue-filled after being thoroughly dried.

(2) Pre-electrophoresis: after the gel is solidified, the comb is taken out, the gel on the upper side is washed off, and particularly, the seam is required to be washed. First, 1 XTBE electrode buffer was placed in the lower part of the electrophoresis chamber (cathode), the polymerized gel plate was placed in the electrophoresis chamber, and 0.5 XTBE electrode buffer was injected into the upper part of the electrophoresis chamber. Constant power 40W-65W, and pre-electrophoresis for about 30 min. Removing urea and air bubbles deposited on the rubber surface by a suction pipe, and inserting into a comb.

(3) Electrophoresis: adding 5 mul of 5 XLoading Buffer into the amplification product, mixing, then denaturing at 95 ℃ for 5 minutes, immediately transferring to ice for cooling, sucking 1.5-3 mul and adding into a Loading hole; electrophoresis was carried out at a constant power of 40W-65W until bromophenol blue reached the bottom of the electrophoresis chamber. And adjusting the electrophoresis time according to the molecular weight of the SSR amplification product and the identification degree of the differential band type.

(4) Silver staining and developing, namely putting a glass plate with glue into 10% glacial acetic acid fixing solution, and oscillating for about 30min at a speed of 65r/min until the tolunitrile is completely decolorized; washing with distilled water for 5min for 2 times; placing the washed rubber plate into newly prepared dyeing liquid (2L of water is added with 2g of silver nitrate and 3mL of 37% formaldehyde) and shaking for 30min at a speed of 65 r/min; putting the dyed rubber plate into distilled water for washing for 5s, and immediately taking out for developing; rapidly transferring the rubber plate to a developing solution (30 g of sodium hydroxide and 10ml of 37% formaldehyde are added into 2L of water) precooled at 4 ℃ and gently shaking until the rubber plate appears with stripes; placing the rubber plate in 10% glacial acetic acid fixing solution until no bubbles are generated; washing with distilled water for 2 times, each for 2 min; after natural drying at room temperature, the images were photographed and stored.

The results are shown in FIG. 6, the amplification products of wild type MH63 and 9311 are 118bp, which is 8bp shorter than the amplification product 126bp of the clustered 3 ear mutant; the amplification product of the clustered 2 ear has two band types of mutation 126bp and wild type 118bp, and is consistent with the sequencing result. The results indicate that the mutation site described in example 7 was co-isolated with the clustered 3 ear mutant. This result combined with the mutant phenotype, mutation site, and phenotype description in the published literature (Jiang G, Xiaog Y, ZHao J, Yin D, ZHao X, Zhu L, ZHai W (2014) Regulation of the evolution strategy in the rice plant through a novel path enclosing the pentatricopeptide repeat protein encoded 1-D. genetics 197:1395-1407) it was concluded that the phenotype of the double-grain cluster rice cluster 3 ear mutant was caused by the mutation described in example 7.

Example 9 Cross-over transformation of sped1-1 mutant Gene

The sped1-1 gene can be transferred into other rice genetic backgrounds by crossing according to the steps shown in FIG. 7:

(1) and (3) hybridization:

crossing with a seed 1-1 homozygous plant serving as a male parent and a recurrent parent such as Minghui 63 to obtain F1 seeds;

(2) first round of backcross:

f1 plants are obtained after F1 is sown, and backcross is carried out on the F1 plants and recurrent parents to obtain BC1F1 seeds;

(3) BC1F1 foreground selection:

sowing BC1F1 seeds to obtain not less than 100 seedlings, collecting each individual leaf blade at the seedling stage, extracting DNA by the method described in example 6, amplifying and electrophoresing the primer pairs (sped1-1_ F1, sped1-1_ F2 and sped1-1_ R) listed in example 8, and selecting individual plants homozygous for sped1-1 genotype to continue planting;

(4) BC1F1 background selection:

identifying the individuals selected in the step (3) by using a group (for example, 100, or 200, etc.) of molecular markers (which can be but are not limited to SSR, SNP, EST, RFLP, AFLP, RAPD, SCAR, etc.) which are polymorphic and are uniformly distributed on the genome between the sped1-1 and the recurrent parent, and selecting materials with high similarity (for example, more than 88% similarity, or 2% selection rate, etc.) with the recurrent parent;

(5) and (3) carrying out second round backcrossing: pollinating the recurrent parent by using the single plant selected in the step (4) as a male parent to obtain BC2F1 seeds;

(6) foreground and background selection for BC2F 1: repeating the operations from the step (3) to the step (4) on the selected material, and selecting BC2F1 generation plants with the similarity higher than the selection standard (such as the similarity is more than 98 percent, or the 2 percent selection rate and the like) with the recurrent parent;

(7) selfing to obtain BC2F2 seeds: selfing the BC2F2 plant selected in the step (6) to obtain BC2F2 seeds.

(8) Phenotypic characterization of BC2F2 population: and planting a BC2F2 population, and selecting a population with the characteristics which are tidy and most similar to the recurrent parent phenotype but with the cluster spikelet characteristics as a selected backcross transformation line.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hainan Borax Rice Gene science and technology Co., Ltd

<120> paddy rice small ear cluster growth mutant and molecular identification method and application thereof

<130> KHP201112961.3

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 530

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Met Ala Ala Ala Arg Arg Gly His Gly Met Pro Leu Trp Glu

1 5 10 15

Cys Asn Val Leu Ile Arg Thr Leu Ala Arg Arg Gly Ser Phe Ala Arg

20 25 30

Val Met Ala Val Tyr Tyr Asp Leu Arg Ala Arg Gly Leu Val Ala Asp

35 40 45

Ser Phe Thr Tyr Pro Phe Val Leu Arg Ala Val Gly Val Leu Lys Leu

50 55 60

Ser Val Glu Gly Arg Lys Ala His Ala Ala Ala Val Lys Thr Gly Phe

65 70 75 80

Arg Trp Asp Ala Tyr Thr Gly Ser Ser Leu Met Glu Met Tyr Thr Met

85 90 95

Leu Gly Arg Val Asp Ile Ala Arg Lys Val Phe Asp Glu Met Pro Ser

100 105 110

Arg Ala Leu Val Leu Trp Asn Met Met Val Arg Cys Tyr Ile Arg Cys

115 120 125

Gly Trp Tyr Ser Ala Ala Val Ala Leu Ser Glu Gln Met Glu Arg Ser

130 135 140

Gly Val Thr Pro Asp Arg Val Thr Leu Val Thr Ala Val Thr Ala Cys

145 150 155 160

Ser Arg Ala Arg Asp Leu Ser Leu Gly Arg Arg Ile His Val Tyr Met

165 170 175

Asp Asn Val Phe Gly Phe Asn Leu Pro Val Ala Asn Ala Leu Leu Asp

180 185 190

Met Tyr Thr Lys Asn Asp Cys Leu Glu Glu Ala Val Lys Leu Phe Glu

195 200 205

Gln Met Pro Ala Arg Asn Ile Ile Ser Trp Thr Ile Leu Val Ser Gly

210 215 220

Tyr Gly Leu Ala Gly Gln Leu Asp Lys Ala Arg Val Leu Phe Asn Gln

225 230 235 240

Cys Lys Glu Lys Asp Leu Ile Leu Trp Thr Ala Met Ile Asn Ala Cys

245 250 255

Val Gln His Gly Cys Phe Glu Glu Ala Leu Thr Leu Phe Arg Asp Met

260 265 270

Gln Met Gln Arg Val Glu Pro Asp Arg Phe Thr Val Val Thr Leu Leu

275 280 285

Thr Cys Cys Ala Asn Leu Gly Ala Leu Asp Gln Gly Glu Trp Ile His

290 295 300

Gln Tyr Ala Glu Gln Arg Lys Met Lys Ile Asp Ala Val Leu Gly Thr

305 310 315 320

Ala Leu Ile Asp Met Tyr Ser Lys Cys Gly His Ile Glu Lys Ser Leu

325 330 335

Glu Val Phe Trp Arg Met Gln Gly Arg Asp Ala Thr Ala Trp Thr Ala

340 345 350

Ile Ile Cys Gly Leu Ala Thr Asn Gly Gln Ala Gly Arg Ala Leu Glu

355 360 365

Leu Phe Gln Asp Met Gln Arg Ser Lys Val Lys Pro Asp Gly Val Thr

370 375 380

Phe Ile Gly Val Leu Ser Ala Cys Cys His Gly Gly Leu Val Asp Glu

385 390 395 400

Gly Arg Lys Gln Phe His Ala Met Arg Glu Val Tyr Gln Ile Glu Pro

405 410 415

Arg Val Glu His Tyr Ser Cys Leu Val Asn Leu Leu Gly Arg Ala Gly

420 425 430

Leu Leu Asp Glu Ala Glu Arg Leu Ile Gly Asp Val Pro Ile Asn Lys

435 440 445

Asp Ala Met Pro Leu Phe Gly Ala Leu Leu Thr Ala Cys Lys Ala His

450 455 460

Gly Asn Val Glu Met Ser Glu Arg Leu Thr Lys Arg Ile Cys Glu Gln

465 470 475 480

Asp Ser Gln Ile Thr Asp Val Asn Leu Leu Met Ser Asn Val Tyr Ala

485 490 495

Thr Ala Ser Arg Trp Glu Asp Val Ile Arg Val Arg Gly Lys Met Ala

500 505 510

His Pro Thr Val Lys Lys Ser Ala Gly Cys Ser Leu Ile Glu Val Lys

515 520 525

Gly Tyr

530

<210> 2

<211> 2160

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcaatgg cggcggcgag gaggggccac gggatgccgc tctgggagtg caacgtgctg 60

atcaggacgc tggcgaggcg ggggagcttc gcgcgcgtca tggcggtgta ctacgacctc 120

cgcgcgcggg gactcgtggc ggacagcttc acctacccgt tcgtgctcag ggccgtcggg 180

gtcctcaagc tgtcggtcga ggggcgcaag gcgcacgcgg ccgctgtcaa gaccgggttc 240

cggtgggacg cctacaccgg gagctcgctg atggagatgt acacgatgct ggggcgcgtg 300

gacatcgcgc ggaaggtgtt cgacgaaatg ccgagtaggg cgctggtgct gtggaacatg 360

atggtcaggt gctacatcag gtgcgggtgg tactcggcgg cagttgcttt gtctgaacag 420

atggagagaa gcggtgtcac acctgacagg gtgacgttgg tgacggcggt gacggcgtgc 480

tctagagcaa gggacctgag cttgggaagg aggattcatg tgtacatgga taacgtcttc 540

ggtttcaatc tgccagttgc aaatgctctg ctggacatgt acacgaagaa tgattgcttg 600

gaagaggcgg tgaaattgtt cgagcaaatg cctgcgagga acataatttc ttggaccata 660

cttgtgtcgg gatatggcct tgctgggcag ctggacaagg ccagagtgct cttcaaccag 720

tgcaaagaga aggatctaat tctgtggact gcaatgatca atgcgtgtgt gcaacacgga 780

tgcttcgagg aggcgctgac attgttccga gatatgcaga tgcaacgggt tgagccagac 840

aggttcactg ttgtcactct cctgacatgc tgtgccaatc ttggcgctct tgatcaaggt 900

gaatggattc accagtatgc tgaacaaagg aaaatgaaga tcgatgcagt cctaggcacc 960

gcattgattg acatgtattc taaatgtggg cacattgaga agtctctaga ggtcttctgg 1020

cgaatgcaag gcagagatgc cacagcttgg actgccatca tctgtgggct ggccacaaat 1080

ggtcaggctg gtagagctct tgaactgttt caagatatgc agagaagtaa agttaagccc 1140

gacggtgtta cgtttattgg ggtgctaagt gcatgctgcc atggtggctt ggttgatgaa 1200

ggccggaagc agttccatgc aatgagggag gtttatcaga tagaaccaag agttgaacac 1260

tatagctgcc ttgtgaacct cctaggtcgt gctggtctac tagatgaagc tgagaggttg 1320

atcggtgacg ttccaattaa caaggatgct atgccactgt ttggtgcact cctcactgct 1380

tgcaaggctc atgggaatgt tgagatgagt gaacggttaa ccaaacgaat ctgtgagcaa 1440

gattcccaaa ttactgatgt gaatttgctc atgtctaatg tatatgcaac agcaagtaga 1500

tgggaggatg tgataagggt acggggcaag atggcacacc ctactgtcaa gaagagtgca 1560

gggtgtagct tgattgaggt gaaggggtac tgaggagttg ttgaagcata taatgcttgg 1620

acaaaggaat tgttgaagca tccattagtt tgactggacc aacagaagca tgatcaatca 1680

ctggaagccg tttcattagc aattttgaag aaccttgtct gaacagacat tcgagtgatc 1740

aggcttgtac agttagttaa tttgaggact actgaacttc agctagcttg tttcaggctt 1800

gtagcagagc tggatttttt ttactcttgc caggaaatgg aacacggttc tgcagatgaa 1860

aaaacaaggt tagacaccaa tgccagtagt attttttttt ctgttgttgc ctatgcctat 1920

cagtgcagat gattatatct aatgtgcaac cataacttct taacaatgga tggacgaaca 1980

ttatcatcgc agcatgattc tgtcatttgt cagcttgtta aaaatgctat acttggattt 2040

tcagtttgct cttgttgatg tattcagcat atccactcaa aactcactaa cacataaaac 2100

atcactttga agtgaatgca atatttattt atggaagaag gttcatctgc aagtcacagt 2160

<210> 3

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaaaaaact caatcaagct acaccctgaa c 31

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctcaatcaag ctacaccctg cag 23

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaatttgctc atgtctaatg ta 22

<210> 6

<211> 118

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaatttgctc atgtctaatg tatatgcaac agcaagtaga tgggaggatg tgataagggt 60

acggggcaag atggcacacc ctactgtcaa gaagaatgca gggtgtagct tgattgag 118

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atactgcctt attctctgta agcac 25

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ataatactac acattaaacg gaggg 25

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acaggttcac tgcgagtttg c 21

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccacacactt gctccttctt cc 22

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ccgtcgtcta gccatttact gc 22

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agaaccactg gcatctcatc acc 23

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cgtcctccag gaaaccctgt aagc 24

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cagaaactcg ccgaagcaga gc 22

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gaagacgacg aagcagcaga gg 22

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggttgtcgtc ctccttctga cc 22

<210> 17

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ttaccaggct tcctctcttg acc 23

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccacgtcacc cagaaactaa tcc 23

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cttgaaattt gtgcggaggt tgc 23

<210> 20

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gatgtcacca tcacggagaa ttagg 25

<210> 21

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atggcacaac aaaaagtagt agaac 25

<210> 22

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

acgaagagtc cttatgtata cgttg 25

<210> 23

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cctacagcag ctacagggtt tcttgg 26

<210> 24

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

cctctgaatc gttggatttg ataccc 26

<210> 25

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gggaagtata tgatgaaaga ggag 24

<210> 26

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

agatctaaca tatcccatat agccc 25

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

atactgcctt attctctgta agcac 25

<210> 28

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

acaggttcac tgcgagtttg c 21

<210> 29

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ccgtcgtcta gccatttact gc 22

<210> 30

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cgtcctccag gaaaccctgt aagc 24

Claims

1. A rice SPED1 protein mutant, wherein the amino acid sequence of the mutant is set forth in SEQ ID No. 1.

2. Nucleic acid encoding the mutant of claim 1.

3. The nucleic acid of claim 2, wherein the nucleic acid has the nucleotide sequence set forth in SEQ ID No. 2.

4. Biomaterial comprising a nucleic acid according to claim 2 or 3, characterized in that the biomaterial is an expression cassette, a vector or a microbial cell.

5. Use of the mutant of claim 1 or the nucleic acid of claim 2 or 3 or the biomaterial of claim 4 for modulating any one of the following traits in rice:

(1) clustering the small spikes;

(2) long spikelet stalk, long branch stalk or long spike;

(3) the grain number of the ears;

(4) setting percentage;

(5) the weight of the granules.

6. A method for producing an improved rice plant, which comprises allowing the rice plant to express the mutant according to claim 1;

the improved rice has any one of the following traits:

(1) clustering the small spikes;

(2) long spikelet stalk, long branch stalk or short spike length

(3) The grain number of the grains per ear is changed;

(4) the maturing rate is changed;

(5) the grain weight is reduced.

7. The method of claim 6, wherein the mutant of claim 1 is expressed in rice by gene editing, crossing, backcrossing, selfing or asexual propagation.

8. Primer for detecting nucleic acid according to claim 2 or 3, comprising an upstream primer shown in SEQ ID No.3 to 4 and a downstream primer shown in SEQ ID No. 5.

9. The use of the primers of claim 8, wherein:

(1) detecting whether rice contains the nucleic acid of claim 2 or 3;

(2) preparing the rice with the small ear cluster character.

10. The use according to claim 9, characterized in that the upstream primer shown in SEQ ID No.3-4 and the downstream primer shown in SEQ ID No.5 are used for PCR amplification; if only 126bp of product can be amplified, the rice to be detected is homozygous genotype of the corresponding gene of the mutant of claim 1, and the phenotype is that 2 or more spikes cluster at the tail end of the branch; if the product of 118bp can be amplified, the rice to be detected does not carry the corresponding gene of the mutant of claim 1, and the phenotype is that clusters do not occur in spikelets at the tail ends of the branches; if products of 126bp and 118bp can be amplified simultaneously, the rice to be detected is a heterozygous genotype of the corresponding gene of the mutant as claimed in claim 1, and the phenotype is that the tail end of a branch has no more than 2 spikelets and clusters.