CN116254271A

CN116254271A - Rice G1 gene mutant G1-1437 and molecular marker and application thereof

Info

Publication number: CN116254271A
Application number: CN202111501853.XA
Authority: CN
Inventors: 李京琳; 董叶红; 罗凡; 李新鹏; 曾翔; 吴永忠; 黄培劲
Original assignee: Hainan Bolian Rice Gene Technology Co ltd
Current assignee: Hainan Bolian Rice Gene Technology Co ltd
Priority date: 2021-12-09
Filing date: 2021-12-09
Publication date: 2023-06-13

Abstract

The invention relates to the technical field of genetic engineering, in particular to a rice G1 gene mutant G1-1437 and a molecular marker and application thereof. The rice G1 gene mutant G1-1437 provided by the invention takes a rice G1 gene as a reference sequence, and the nucleotide sequence of the rice G1 gene is shown as SEQ ID NO. 8; the gene mutant g1-1437 comprises a mutation site for mutating 112 th base C into base T. The mutation causes rice glume protection homology to be converted into glume substances, and can be used as a phenotype screening marker of transgenic rice. The invention also provides a molecular marker identification method of the mutant, which has good application prospect in transferring new germplasm.

Description

Rice G1 gene mutant G1-1437 and molecular marker and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a rice G1 gene mutant G1-1437 and a molecular marker and application thereof.

Background

Rice is the main grain crop in the world, the yield of which is important for grain safety, and the development of spikelet is one of the important yield traits. Unlike dicots, the small ears of rice have a unique glume structure and are therefore considered model crops for monocots. The small ear of rice consists of three small flowers, wherein the small flowers at the top end are complete flowers, and two small flowers at the bottom end degenerate into short and small glume-protecting organoids. The formation of spikelets is finely regulated by a range of genes, the most clear of current research being the "ABCDE" regulatory model of dicotyledonous plants. Despite the tremendous differences between monocots and dicots, several studies have shown that monocots have a similar "ABCDE" regulatory model as dicots. The corresponding 5 genes have been cloned in rice, most of which are MADS-box genes, such as the A-type genes RAP1B (OsMADS 14) and RAP1A (OsMADS 15) determining the characteristics of the peanut tissue, which are homologous to the AP1 gene of Arabidopsis thaliana, belonging to the FUL type; osMADS14 mutation may cause a shorter flowering phase, while OsMADS15 mutation causes an elongation of the inner and outer glumes. In the B-type gene, osMADS2 and OsMADS4 of rice are homologous to PI (PSEUDOGENE) of Arabidopsis thaliana, and OsMADS16 (SPW 1) is homologous to AP3, and both have the function of controlling the development of pulp and stamens. Class C genes are involved in stamen and carpel formation, where OsMADS3, osMADS58 are homologous to Arabidopsis AG, while DROOPING LEAF (DL) is homologous to CRC. Only OsMADS13 was identified as a class D gene, mainly involved in the formation of carpels and ovules. The E-type genes are more in types, such as OsMADS7 (OsMADS 45) and OsMADS8 (OsMADS 24) which are homologous to Arabidopsis thaliana SEP; osMADS5 (OsM 5) and OsMADS34 homologous to AGL6, and OsMADS1/LEAFY HULL STERILE 1 (LHS 1) homologous to LOFSEP. The five genes cooperate to regulate the development of flower organs, lay a foundation for elucidating the development mechanism of the rice flower organs, and the mutation of the five genes also creates rice seeds with various appearance phenotypes.

Glume protection is a characteristic floral organ of rice, generally considered as a degenerated floret, and few reports on this aspect are available because mutants thereof are more difficult to obtain. Currently, the genes related to glume development which have been cloned are mainly G1/ELE, osMADS34 and OsEG1.OsMADS34 and OsEG1 are pleiotropic genes, and the glume protection of mutants is also changed in addition to the homologous transformation into an elongated palea structure. And G1 is a single-effect gene, the mutant thereof has obviously prolonged glume protection, other agronomic characters are normal, and the yield and the quality are not affected, so G1 is a good phenotypic mark. The characteristics that the yield is not affected, but the phenotype is obviously different can be utilized to carry out seed sorting, auxiliary breeding, gene linkage marking and the like on rice, so that the development of various floral organ mutant materials is quite significant.

Disclosure of Invention

The invention aims to provide a rice G1 gene mutant G1-1437 and a molecular identification method and application thereof.

The invention firstly discovers a natural variant flower organ mutant in the field, and the small flower structure of the natural variant flower organ mutant is obviously different from that of a wild type, and the natural variant flower organ mutant is mainly characterized in that the glume protection is prolonged and is flush with the palea. F is obtained by selfing ₁ And for F ₁ The strain is identified morphologically, histochemically and genetically, and then the corresponding mutant gene is obtained through map-based cloning and DNA sequencing.

Based on the findings, the invention provides the following technical scheme:

the invention provides a rice G1 gene mutant G1-1437, which takes a rice G1 gene as a reference sequence, wherein the nucleotide sequence of the rice G1 gene is shown as SEQ ID NO. 8; the gene mutant g1-1437 comprises a mutation site for mutating 112 th base C into base T.

The mutant is characterized in that a C base at 112 th position of a G1 gene coding region is replaced by a T base, so that a codon CAG for glutamine is converted into a stop codon TAG. The mutated G1 is designated G1-1437.

Specifically, the gene mutant g1-1437 contains a nucleotide sequence shown as SEQ ID NO. 1.

The rice G1 gene mutant G1-1437 provided by the invention is characterized in that a C base at 112 th site of a rice G1 gene is replaced by a T base, the mutation site is positioned on a coding region of a gene LOC_Os07G04670, and the nucleotide sequence of the mutation site is shown as SEQ ID No. 1.

The invention also provides a biological material containing the gene mutant g1-1437, wherein the biological material comprises an expression cassette, a vector or a host cell.

The expression cassette may be a DNA fragment obtained by ligating the gene mutant with an element regulating the transcription or expression thereof.

The vector may be a cloning vector or an expression vector.

The host cell may be a microbial cell or a non-reproductive plant cell.

The invention also provides the application of the gene mutant g1-1437 or the biological material in any one of the following aspects:

(1) Application in rice glume-protecting homologous transformation into glume organoids;

(2) Application in preparing transgenic rice; such as the application in the preparation of transgenic rice with recessive abnormal glume protection;

(3) The application in rice improved breeding and seed production;

(4) Use as a phenotypic selectable marker for transgenic rice;

(5) The application of the method in the glume-protecting extension of the small flower structure of the rice flower spike.

The invention also provides a molecular marker for detecting the gene mutant g1-1437, wherein the molecular marker is a nucleotide sequence containing 112 th polymorphism of the sequence shown as SEQ ID NO.1 as C/T.

The invention also provides a primer for detecting the molecular marker, which comprises the primer shown in SEQ ID NO. 2-3.

The invention provides a molecular marker for detecting rice G1 gene mutant G1-1437, which can detect the mutation that a C base at 112 th position of a G1 gene is replaced by a T base. Preferably, the molecular marker can be obtained by combining PCR amplification and SnaBI cleavage by using the following primers, wherein the nucleotide sequences of the primer pairs are as follows:

upstream primer 1437_f: GGGACTGGCAGACCTTTACG (SEQ ID NO. 2),

downstream primer 1437_r: GTCTTGCCGAAGCGGTCGAGGT. (shown as SEQ ID NO. 3).

The invention also provides a reagent or a kit containing the primer.

And the application of the molecular marker or the primer or the reagent or the kit in detecting the gene mutant g1-1437 or the rice glume-protecting dysplasia.

The invention also provides a method for identifying the gene mutant g1-1437 or rice glume-protecting dysplasia, which comprises the following steps:

amplifying the G1 gene fragment of the rice to be detected by adopting the primer, the reagent or the kit, and cutting the amplified fragment by using SnaBI endonuclease.

In the method, if the length of the amplified fragment after cutting is 118bp, the rice to be detected does not contain the gene mutant g1-1437 and the rice glume protection development is normal; if the length of the amplified fragment after cutting is 99bp, the rice to be detected contains the gene mutant g1-1437 and abnormal rice glume protection development. That is, if the product is 19bp shorter than the fragment of wild type 1437 by cleavage at SnaBI enzyme after amplification with the above primer, it indicates that the rice G1 gene mutant G1-1437 exists in the plant to be examined.

Specifically, in the method of the present invention, the amplified fragment is cleaved with SnaBI endonuclease at 37℃and finally the cleavage product is detected with 6% polyacrylamide gel.

The invention has the beneficial effects that:

the rice G1 gene mutant provided by the invention is a natural variant strain found in the field, and one C base at the 112 th position of a coding region is replaced by a T base. The mutation causes the rice glume protection to be obviously elongated without affecting the quality and the yield, and can be used for seed sorting, auxiliary breeding, gene linkage marking and the like of rice. The invention provides a molecular marker identification method of the mutant, which has good application prospect in transferring new germplasm.

Drawings

FIG. 1 is a graph showing the comparison of the plant types of wild type plants and g1-1437 mutants in example 1 with the ear types; in the figure, A is a plant type comparison chart, and B is an ear type comparison chart.

FIG. 2 is a graph of the glume (A in the figure) and stamen (B in the figure) and pistil (C in the figure) of the g1-1437 mutant of example 1.

FIG. 3 is a graph showing the observation result of iodine staining of the g1-1437 mutant pollen.

FIG. 4 is a schematic diagram showing the mutation sites of the G1-1437 mutant G1 gene in example 1.

FIG. 5 is an alignment of the protein sequences of the G1 gene of the wild type and the G1-1437 mutant in example 1, and the difference amino acid residue sequences are shown in black areas.

FIG. 6 is a photograph of an electrophoresis of the SnaBI enzyme-digested product after PCR of wild-type 1437, G1-1437 and randomly selected 31 conventional rice variety G1 gene mutation sites in example 2. Lanes 1-33 are in order: g1-1437, wild type 1437, zhonghua 11, nong 32, huazhan, zhongxiang yellow, huanghua, yuzhen, wushan wire, lvyingzhan, yujingfeng wire, guangdong new, wushan wire, yuenongzhi wire, ivory, mei Xiang No.2, japanese fine, lianjing No. 7, lian Oryza 1, zheng Han, yue Japonica oil, guangjingjia wire, guangjia Li, wufeng B, agricultural land cultivation 58, daghua No.2, gufeng, heli oil, gui Nong, nan Gui Zhan, buddha, jinnong wire.

FIG. 7 is a technical scheme of hybridization transfer of example 3.

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated; the reagents used in the examples were all commercially available unless otherwise specified.

Example 1 acquisition and identification of Rice G1 Gene mutant G1-1437

1. Acquisition of g1-1437 mutant

In summer 2019, a natural variant strain is found in the filial generation of Huazhan and Taifeng B with the number of 1437, and F is obtained by bagging and selfing ₁ Planting F7 months of the next year ₁ In the Hainan Luo Niushan field, 300 plants are total. After transplanting, carefully observing in the tillering stage, booting stage, heading stage, blooming stage, grouting stage and the like, selecting a plant line with stable phenotype for selfing, and collecting and storing single plants.

2. Floret phenotype and genetic analysis

The g1-1437 mutant was observed in the field, with no difference in plant height, spike length, leaf color, etc. from the wild type (FIG. 1), while the floret glume-protecting length was longer than the wild type (see Table 1 for specific data), mostly flush with the palea. Collecting flowering stage florets in field, taking anthers out with forceps, and adding iodine-potassium iodide solution (0.6% KI,0.3% I) ₂ W/w), the anthers were gently squeezed, dropped onto a slide, covered with a cover slip, observed under a microscope for pollen iodination and photographed. Both wild-type and mutant pollen were blue-black, indicating that male fertility was unaffected (FIG. 3). The bagging selfing and the fruiting rate statistics show that the selfing fruiting rate of the mutant is 85.6%, and the difference between the selfing fruiting rate and the wild type 86.2% is not obvious, so that the female function of the mutant is normal. The wild type and the g1-1437 mutant were counted for grain number, tillering number and individual yield (see Table 1 for specific data), respectively, and the results showed that the difference between the wild type and the g1-1437 mutant in 3 agronomic traits was not significant, indicating that the yield and the like were not affected.

Planting F ₂ And (3) observing abnormal conditions of flower organs of the generation 563, wherein 419 flowers are normal in development, 144 flowers are abnormal in organ (the glume-protecting length of the floret is longer than that of the wild type), and the 3:1 separation is met, so that the abnormal flower spike character is controlled by a single recessive gene.

TABLE 1 g1-1437 mutant vs. wild-type agronomic trait

	Wild type	g1-1437
			Glume length (cm)	0.13±0.43	0.73±0.2
Spike and grain number (grain)	179.0±12	181.6±8.6
			Tillering (individual)	11.3±2.3	9.6±2.4
Yield of single plant (gram)	48.90±5.75	46.95±6.58

3. Leaf sampling and DNA extraction

The method for extracting rice genome DNA by adopting CTAB method comprises the following specific steps: rice leaves 3cm long were taken and extracted in 800. Mu.L of buffer [1.5% (w/v) CTAB,1.05mol/L NaCl,75mmol/L Tris-HCl (pH 8.0), 15mmol/L EDTA (pH 8.0)]Is collected in a 1.5mL centrifuge tube. Water bath at 65 ℃ for 30min, and mixing evenly in a reverse way. 800. Mu.L of chloroform to isoamyl alcohol (volume ratio 24:1) was added and mixed by inversion for 15min. Centrifuge at 12000r/min for 10min at room temperature. The supernatant was pipetted into a new 1.5mL centrifuge tube, 2 volumes of 95% ethanol were added, mixed well and precipitated at-20℃for 30min. Centrifuge at 12000r/min for 15min. The 95% ethanol was decanted and the precipitate was washed with 75% ethanol. Pouring out 75% ethanol, drying, adding 100 μl sterilized ddH ₂ O dissolves DNA.

4. PCR reaction and product recovery

Primers were designed to amplify wild-type 1437 and G1-1437 mutant DNA based on the genomic sequence of the G1 gene.

The primer pair sequences used to amplify G1 are shown in Table 2 below.

TABLE 2 primer pair sequences for amplification of G1

The PCR reaction system is as follows: mu.L of 10 Xreaction buffer, 0.25. Mu.L of 10mM dNTP, 0.25. Mu.L of 10. Mu.M forward primer and 0.25. Mu.L of 10. Mu.M reverse primer, 0.5U Taq enzyme, 1. Mu.L of 10 ng/. Mu.L of template DNA, and ultra pure water were added to make the total volume up to 10. Mu.L. The PCR reaction procedure was: denaturation at 94 ℃ for 5min, followed by the following cycles: denaturation at 95℃for 20s, renaturation at 60℃for 30s, extension at 72℃for 30s,30 cycles. After the circulation is finished, the reaction is finished by supplementing and extending for 5min at 72 ℃. Preparing 1.5% agarose gel, and performing electrophoresis for 30min under an electric field of 5V/cm; the PCR product was recovered using a commercial DNA gel recovery kit.

5. DNA and amino acid sequence analysis

The obtained PCR product DNA of the rice wild type and mutant was sequenced by an ABI3730 sequencer, and the forward primer and the reverse primer in Table 2 were used as sequencing primers, respectively. Splicing the bidirectional sequencing results by using common DNA sequence analysis software DNAman 6.0; the mutant gene of the rice G1 gene is named as G1-1437, the full-length nucleotide sequence of the G1-1437 mutant G1 gene is shown as SEQ ID NO.1, the mutant gene consists of 959 bases, the wild type and the mutant sequences are aligned, one base C at the 112 th base T of the genome sequence of the G1 gene is replaced by one base T, and the mutation site is positioned on a coding region (see FIG. 4). The protein sequence analysis alignment shows that the mutation causes premature translation termination, resulting in protein truncation and inactivation (see FIG. 5, the amino acid sequence differences between the G1-1437 mutant and the wild-type G1 protein are shown in black areas).

EXAMPLE 2 design of mutation site detection primer and genotype-mutation site verification

Gene specific primers were designed based on sequences flanking the mutation site obtained in example 1:

upstream primer 1437_f: GGGACTGGCAGACCTTTACG (shown as SEQ ID NO. 2)

Downstream primer 1437_r: GTCTTGCCGAAGCGGTCGAGGT. (shown as SEQ ID NO. 3).

If the product is 19bp shorter than the fragment of wild type 1437 after amplification with the above primers, it will be marked that rice G1 gene mutant G1-1437 is present in the plant to be tested. 31 common rice varieties and 1437 mutant g1-1437 and 1437 wild type are randomly selected, and leaf DNA is extracted, and the method is the same as in example 1. The DNA of the above plants was amplified with 1437_F and 1437_R. The PCR reaction system and procedure were the same as in example 1.

The amplified product was digested with SnaBI as follows: according to PCR amplification product 10 u L, nuclease water 18 u L,10 x Buffer R2 u L, snaBI 1-2 u L, mixing the reaction, micro centrifugal for several seconds, at 37 degrees C1-2 hours incubation, finally at 80 degrees C20 minutes termination reaction. The digested product was electrophoretically separated on a 6% polyacrylamide gel. The polyacrylamide gel electrophoresis method is as follows:

(1) Preparing polyacrylamide gel: 80mL of 6% PA gum, 250. Mu.L (winter)/125. Mu.L (summer) of 10% ammonium persulfate, and 80. Mu.L of tetramethyl ethylenediamine (TEMED). Shaking and pouring the glue. Repeatedly scrubbing the glass plate with a detergent, scrubbing with alcohol and airing. After coating the recess plate with 2% Repel Silane in a fume hood, the plate was wiped clean with alcohol and dried, and another plate was coated with 1.5mL of 0.5% Bing Silane (7.5. Mu.L Binding Silane and 7.5. Mu.L glacial acetic acid were added to a 1.5mL centrifuge tube, supplementing 95% ethanol to 1.5 mL). In the operation process, the two glass plates are prevented from being polluted, and the glass plates are assembled and glued after being thoroughly dried.

(2) Pre-electrophoresis: after the gel is fixed, the comb is taken out, gel on the comb is washed off, and especially the joint is required to be cleaned. The lower cell (cathode) of the electrophoresis tank was filled with an electrode buffer of 1 XTBE, the polymerized gel plate was placed in the electrophoresis tank, and the upper cell was filled with an electrode buffer of 0.5 XTBE. Constant power 40W-65W, pre-electrophoresis for about 30min. Removing urea and bubbles deposited on the rubber surface by using a suction pipe, and inserting the comb.

(3) Electrophoresis: adding 5 μl of 5×loading Buffer into the amplified product, mixing, denaturing at 95deg.C for 5min, immediately transferring to ice, cooling, sucking 1.5-3 μl, and adding into the sample well; and (3) performing electrophoresis with constant power of 40-65W until bromophenol blue reaches the bottom of the electrophoresis tank. And adjusting the electrophoresis time according to the molecular weight of the SSR amplification product and the discernable degree of the difference bands.

(4) Silver staining and developing, putting a glass plate with glue into a 10% glacial acetic acid fixing solution, and oscillating for about 30min at 65r/min until the dimethylbenzonitrile is completely decolorized; washing with distilled water for 2 times, each time for 5min; placing the washed rubber plate into a newly prepared staining solution (2 g of silver nitrate and 3mL of 37% formaldehyde are added into 2L of water) and shaking for 30min at 65 r/min; placing the dyed rubber plate into distilled water to be washed for 5s, and immediately taking out to develop; rapidly transferring the rubber plate to a developing solution (30 g of sodium hydroxide and 10ml of 37% formaldehyde are added into 2L of water) precooled at 4 ℃ and gently shaking until streaks appear; washing with distilled water for 2 times each for 2min; and (5) naturally drying at room temperature, and photographing to preserve the image.

The electrophoresis results are shown in FIG. 6, all normal glume-protecting rice varieties are digested after amplification, the electrophoresis bands of the products are 118bp, and only the electrophoresis bands of mutants g1-1437 are 99bp. This result indicates that the mutation site described in example 1 (substitution of a C base at base 112 of the coding region sequence of the G1 gene with a T base) is truly present and associated with a long glume-protecting phenotype. This result, combined with the mutant phenotype, mutation site, and known phenotypic descriptions, may infer that the abnormal spike phenotype of the g1-1437 mutant is caused by the mutation described in example 1.

EXAMPLE 3 hybrid transfer of mutant genes

The abnormal spike gene G1 of the G1-1437 mutant was transferred by hybridization to other rice genetic backgrounds according to the procedure of FIG. 7:

(1) hybridization: hybridization with g1-1437 as female parent and receptor paddy rice material (RP) as male parent to obtain F ₁ Seed;

(2) the first round of backcross:

F ₁ f is obtained after sowing ₁ Plants and methods of making the sameF is to F ₁ Crossing the plant with recurrent parent to obtain BC ₁ Seed;

③BC ₁ abnormal tassel gene selection (foreground selection):

seeding BC ₁ Seed, obtaining at least 500 seedlings, collecting each individual leaf at the seedling stage, extracting DNA by the method described in the example 1, amplifying, enzyme cutting and electrophoresis by using the primer pair (1437_F and 1437_R) listed in the example 2, selecting the individual with heterozygous genotype, continuing to plant, and discarding the individual with homozygous wild type;

(4) BC1 background selection:

identifying the single plant selected in the step (3) by adopting a group (such as 100 or 200 or the like) of molecular markers (such as SSR, SNP, EST, RFLP, AFLP, RAPD, SCAR markers, which can be but are not limited to) with polymorphism between the g1-1437 mutant and recurrent parent and are uniformly distributed on the genome, and selecting a material with high similarity (such as more than 88 percent similarity or 2 percent medium selection rate or the like) with the recurrent parent;

(5) and (3) backcrossing in the second round: pollinating recurrent parent with the single plant selected in the step (4) as male parent to obtain BC ₂ Seed;

⑥BC ₂ foreground and background selection of (a): repeating steps (3) to (4) for selected materials, selecting BC having a similarity to the recurrent parent higher than a selection criterion (e.g., a similarity greater than 98%, or a 2% selectivity, etc.) ₂ Generating plants;

(7) obtaining BC by selfing ₂ F ₂ Seed: for BC selected in step (6) ₂ Selfing the plants to obtain BC ₂ F ₂ Seed;

⑧BC ₂ F ₂ is selected from the group consisting of: the BC obtained in the step (7) is subjected to ₂ F ₂ Sowing seeds to obtain more than 500 seedlings, collecting leaves at the seedling stage, extracting DNA by the method described in the example 1, amplifying and electrophoresis by using the primer pairs (1437_F and 1437_R) listed in the example 2, selecting single plants with homozygous mutants and heterozygotes, continuously cultivating, and discarding the single plants with homozygous wild type;

⑨BC ₂ F ₂ background selection and application of (c): and (3) carrying out background screening on the single plants selected in the step (8) according to the method of the step (4), and selecting single plants with 100% background homozygosity. If the 1437_F/1437_R primer pair of the selected single plant is amplified and digested with the homozygous mutant, the single plant is the final target material, and can be further hybridized with recurrent parent hybridization preservation materials or other rice materials. If the selected single plant is a hybrid band type, the method can be directly used for preserving germplasm or obtaining the flower spike abnormal plant through selfing.

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hainan Beunder Rice Gene technology Co., ltd

<120> a rice G1 gene mutant G1-1437 and molecular marker and application thereof

<130> KHP211123247.3

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 959

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgtcgtcgt cgtccgctgc cgcgctgggc tccgacgacg gctgctcgcc ggcggagctg 60

cggccgagcc ggtacgagtc gcagaagcgc cgggactggc agaccttcac gtagtacctc 120

gccgcgcacc gcccgccgct cgagctccgc cgctgcagcg gcgcccacgt cctcgagttc 180

ctccgctacc tcgaccgctt cggcaagacg cgcgtccacg agccgccgtg cccgtcgtac 240

ggcggccgct cgccgtccgc cgccggcccg gtcgccgccg ccgccgccgc atgccagtgc 300

ccgctgcgcc aggcgtgggg cagcctcgac gcgctcgtcg gccgcctccg cgccgcctac 360

gacgagcgcc acggccgcgc cggggagccc gacgccggcg cgggcgccgg cgcggtcgcc 420

accgacagta cctcctcctc ctccgccgcc gccgccaacc ccttcgccgc gcgcgccgtg 480

aggctgtacc tgcgcgacgt ccgcgacgcg caggccatgg cgcgcggcat ctcctaccac 540

aagaagaaga agcgcagggg cggcaacagg aacggcgccc gcggcggcgg tggcggcggc 600

gcgcgcgcgg gagtgaacga cggcgacgcg acggcgccgc cggtggcggt gaccccgggg 660

ctgcctctgc cgccgctgcc accgtgcctc aacggtgtgc cgttcgagta ctgcgacttc 720

gggagcgtcc tcgggggagc acatggcgcc catggcggcc atggcggcgg cggcggcggc 780

ttctacggcg ccggcgtcta cttgccattt ctgtacaaca ccttcagtta gttagctagc 840

tagctagttc gtcgtgtatt tgtctgtgct tctcactgtg gttgcttcag tgtactagct 900

agctacatgt gtgatgtgtc tgcatcttgt gatcatcttg atctgtgctt tgatgctga 959

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gggactggca gacctttacg 20

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gtcttgccga agcggtcgag gt 22

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

aatctaaact gttaggaagc ggag 24

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gcgcaggtac agcctcacg 19

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tcgccaccga cagtacctc 19

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gcacgaacat aacgcaatcg ac 22

<210> 8

<211> 1039

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atgtcgtcgt cgtccgctgc cgcgctgggc tccgacgacg gctgctcgcc ggcggagctg 60

cggccgagcc ggtacgagtc gcagaagcgc cgggactggc agaccttcac gcagtacctc 120

gccgcgcacc gcccgccgct cgagctccgc cgctgcagcg gcgcccacgt cctcgagttc 180

ctccgctacc tcgaccgctt cggcaagacg cgcgtccacg agccgccgtg cccgtcgtac 240

ggcggccgct cgccgtccgc cgccggcccg gtcgccgccg ccgccgccgc atgccagtgc 300

ccgctgcgcc aggcgtgggg cagcctcgac gcgctcgtcg gccgcctccg cgccgcctac 360

gacgagcgcc acggccgcgc cggggagccc gacgccggcg cgggcgccgg cgcggtcgcc 420

accgacagta cctcctcctc ctccgccgcc gccgccaacc ccttcgccgc gcgcgccgtg 480

aggctgtacc tgcgcgacgt ccgcgacgcg caggccatgg cgcgcggcat ctcctaccac 540

aagaagaaga agcgcagggg cggcaacagg aacggcgccc gcggcggcgg tggcggcggc 600

gcgcgcgcgg gagtgaacga cggcgacgcg acggcgccgc cggtggcggt gaccccgggg 660

ctgcctctgc cgccgctgcc accgtgcctc aacggtgtgc cgttcgagta ctgcgacttc 720

gggagcgtcc tcgggggagc acatggcgcc catggcggcc atggcggcgg cggcggcggc 780

ttctacggcg ccggcgtcta cttgccattt ctgtacaaca ccttcagtta gttagctagc 840

tagctagttc gtcgtgtatt tgtctgtgct tctcactgtg gttgcttcag tgtactagct 900

agctacatgt gtgatgtgtc tgcatcttgt gatcatcttg atctgtgctt tgatgctgat 960

cgatccagca tatccgtacg tgttcgttcc gttgcttcgg atcttaatta actaatttaa 1020

ttgtgctaat taattttgt 1039

Claims

1. The rice G1 gene mutant G1-1437 is characterized in that a rice G1 gene is taken as a reference sequence, and the nucleotide sequence of the rice G1 gene is shown as SEQ ID NO. 8; the gene mutant g1-1437 comprises a mutation site for mutating 112 th base C into base T.

2. The gene mutant g1-1437 of claim 1, which comprises a nucleotide sequence as set forth in SEQ ID No. 1.

3. A biological material comprising the gene mutant g1-1437 of claim 1 or 2, said biological material comprising an expression cassette, a vector or a host cell.

4. Use of the genetic mutant g1-1437 of claim 1 or 2 or the biomaterial of claim 3 in any one of the following aspects:

(2) Application in preparing transgenic rice;

(3) The application in rice improved breeding and seed production;

(4) Use as a phenotypic selectable marker for transgenic rice;

5. A molecular marker for detecting the gene mutant g1-1437 according to claim 1 or 2, wherein the molecular marker is a nucleotide sequence containing a polymorphism C/T at position 112 of the sequence shown in SEQ ID No. 1.

6. A primer for detecting a molecular marker according to claim 5, which comprises the primer shown in SEQ ID NO. 2-3.

7. A reagent or kit comprising the primer according to claim 6.

8. Use of the molecular marker of claim 5 or the primer of claim 6 or the reagent or kit of claim 7 for detecting the genetic mutant g1-1437 or rice glume dysplasia.

9. A method for identifying the genetic mutant g1-1437 or rice glume dysplasia of claim 1 or 2, comprising:

amplifying the G1 gene fragment of the rice to be tested using the primer of claim 6 or the reagent or kit of claim 7, and cleaving the amplified fragment with SnaBI endonuclease.

10. The method according to claim 9, wherein if the length of the amplified fragment after cleavage is 118bp, the rice to be tested does not contain the gene mutant g1-1437 and the rice glume protection is normally developed; if the length of the amplified fragment after cutting is 99bp, the rice to be detected contains the gene mutant g1-1437 and abnormal rice glume protection development.