CN112679591B - Application of substances inhibiting OaGS3 gene expression in regulating grain length of tetraploid wild rice - Google Patents

Abstract

The invention provides application of a substance for regulating an OaGS3 gene in regulating and controlling the yield/seed length of tetraploid wild rice. The specific embodiment of the invention proves that the increase of the grain length can be realized by editing the gene OaGS3, so that the tetraploid wild rice with higher yield is bred, and the domestication and utilization of the tetraploid wild rice are promoted.

Description

Substances that inhibit OaGS3 gene expression in regulating grain length in tetraploid wild rice Applications

technical field

The invention belongs to the field of biotechnology, and in particular relates to the application of a substance inhibiting OaGS3 gene expression in regulating the grain length of tetraploid wild rice.

Background technique

Rice is one of the most important food crops in the world. High and stable rice yields are of great significance to ensuring world food security. However, the intensification of urbanization has led to a sharp decrease in arable land, frequent extreme weather has increased the risk of stable grain production, and the increase in crop yield brought about by traditional breeding techniques has been slow. The issue of food security has become increasingly prominent and has gradually become a new challenge for people.

The tall tetraploid wild rice O.alta is a perennial allotetraploid rice, mainly distributed in South America. Compared with diploid cultivated rice, tetraploid high-stalk tetraploid wild rice has many advantages such as large biomass, perennial growth, strong regeneration ability, and strong stress adaptability. But without artificial domestication, the grain is small, and the thousand-grain weight is only 8.79 grams. The genome editing technology increases the grain length of the high-stalk tetraploid wild rice to increase the grain weight, and at the same time combines many advantages of the high-stalk tetraploid wild rice to achieve the purpose of increasing yield.

Contents of the invention

The technical problem to be solved by the invention is how to increase the yield of tetraploid wild rice.

In order to solve the above technical problems, the present invention provides the application of substances that inhibit OaGS3 gene expression in increasing the yield or grain length of tetraploid wild rice. The OaGS3 gene encodes the OaGS3 protein, and the OaGS3 protein is the following A1, A2 or A3 of protein:

A1. The amino acid sequence is a protein with the amino acid sequence shown in any one of Sequence 5 and Sequence 6 in the Sequence Listing;

A2. The amino acid sequence shown in any one of Sequence 5 and Sequence 6 in the sequence listing is 80% identical to the protein shown in A1) through the substitution and/or deletion and/or addition of one or several amino acid residues Proteins that are identical to the above and have the same function;

A3. A fusion protein obtained by linking protein tags at the N-terminus or/and C-terminus of A1) or A2).

In the above application, sequence 5 in the sequence listing consists of 221 amino acid residues, and sequence 6 in the sequence listing consists of 211 amino acid residues.

In the above applications, identity refers to the identity of amino acid sequences. Amino acid sequence identities can be determined using homology search sites on the Internet, such as the BLAST webpage of the NCBI homepage. For example, in advanced BLAST2.1, by using blastp as the program, set the Expect value to 10, set all Filters to OFF, use BLOSUM62 as Matrix, and set Gap existence cost, Perresidue gap cost and Lambda ratio to 11 respectively , 1 and 0.85 (the default value) and search for the identity of a pair of amino acid sequences for calculation, and then the value (%) of the identity can be obtained.

In the above application, the above 80% identity may be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

In the above application, the OaGS3 gene can specifically be the gene shown in E1 or E2 as follows:

E1, the coding sequence (ORF) of the coding strand is the DNA molecule shown in sequence 3 or sequence 4 in the sequence listing;

E2. The nucleotide sequence is the DNA molecule shown in Sequence 1 or Sequence 2 in the sequence listing.

In the above application, the inhibition of OaGS3 gene expression can be achieved by chemical mutagenesis, physical mutagenesis, RNAi, genome-directed editing or homologous recombination on the OaGS3 gene in tetraploid wild rice.

In the above-mentioned application, the genome fixed-point editing can adopt zinc finger nuclease technology (Zinc finger nuclease, ZFN), transcription activator-like effector nuclease technology (Transcription activator-like effector nuclease, TALEN), clustered regularly spaced short loops The repetitive sequence and its related system technology (Clustered regularly interspaced shortpalindromic repeats/CRISPR associated, CRISPR/Cas9 system), as well as other technologies that can realize genome-specific editing.

In the above application, the targeted editing of the genome can be realized by means of the CRISPR/Cas9 system. In the CRISPR/Cas9 system, its target sequence is the XXX sequence located on any nucleotide sequence including XXXNGG in the OaGS3 gene; wherein, XXX is any 19-20bp nucleotide sequence in the DNA molecular sequence, N It is any one nucleotide in A, T, G, C.

The specific target sequence can be the sequence shown in the 392nd-411th position of the sequence 1 in the sequence listing or the sequence shown in the 579th-598th position in the sequence 2.

In the above application, the substance may be a CRISPR/Cas9 system;

The CRISPR/Cas9 system includes the following 1) or 2):

1) sgRNA, the sgRNA target is the sequence shown in the 392nd-411th position in sequence 1 or the 579th-598th position in sequence 2;

2) A CRISPR/Cas9 vector expressing the sgRNA.

In a specific embodiment of the present invention, the recombinant vector of the CRISPR/Cas9 system includes the recombinant vector VK005-OaGS3gRNA; the recombinant vector VK005-OaGS3gRNA contains an sgRNA expression cassette and a Cas9 coding gene, and can express sgRNA and Cas9.

The present invention also provides a method for breeding tetraploid wild rice (O.alta) with higher yield, comprising the following steps: inhibiting the expression of the OaGS3 gene in the recipient tetraploid wild rice to obtain a yield higher than that of the recipient. Tetraploid Oryza sativa is the object of Tetraploid Oryza sativa.

The present invention also provides a method for breeding tetraploid wild rice (O.alta) with a longer grain length, comprising the steps of: inhibiting the expression of the OaGS3 gene in the recipient tetraploid wild rice to obtain a grain length longer than the Recipient Tetraploid Oryzae Oryzae Tetraploid Oryzae of Purpose.

In the above method, the tetraploid wild rice of interest is the tetraploid wild rice that satisfies the following conditions: both the CC subgenome and the DD subgenome are mutated in the target region of the sgRNA.

In the above method, the target tetraploid wild rice is understood to include not only the first to second generation transgenic tetraploid wild rice, but also its progeny. For the transgenic tetraploid wild rice, the gene can be inherited in this species, and the gene can also be transferred into other varieties of the same species by conventional breeding techniques. The transgenic tetraploid wild rice includes seeds, callus, whole plants and cells.

In order to solve the above technical problems, the present invention also provides a reagent for increasing the yield or grain length of tetraploid wild rice, the active ingredient of which is to inhibit the expression of the gene encoding the OaGS3 protein and reduce the abundance of the OaGS3 protein , and/or knock out the gene encoding the OaGS3 protein.

Among the above reagents, the substance is a CRISPR/Cas9 system;

The CRISPR/Cas9 system includes the following 1) or 2):

1) sgRNA, the sgRNA target is the sequence shown in the 392nd-411th position in sequence 1 or the 579th-598th position in sequence 2;

2) A CRISPR/Cas9 vector expressing the sgRNA.

The active components of the above reagents may also contain other biological components or/and non-biological components, and those skilled in the art can determine the other active components of the above reagents according to the effect of increasing the yield or grain length of tetraploid wild rice.

The present invention also protects the CRISPR/Cas9 system, and the CRISPR/Cas9 system includes the following 1) or 2):

1) sgRNA, the sgRNA target is the sequence shown in the 392nd-411th position in sequence 1 or the 579th-598th position in sequence 2;

2) A CRISPR/Cas9 vector expressing the sgRNA.

The present invention also provides any application of the following Y1-Y5:

Y1, the application of the above-mentioned application in the domestication and breeding of tetraploid wild rice;

Y2, the application of the above-mentioned method in the domestication and breeding of tetraploid wild rice;

Y3, application of the above-mentioned reagents in the domestication and breeding of tetraploid wild rice;

Y4. Application of the above-mentioned CRISPR/Cas9 system in domestication and breeding of tetraploid wild rice;

Y5. Application of the above-mentioned substance regulating OaGS3 gene in rice breeding.

The invention provides the application of the substance regulating OaGS3 gene in regulating the yield/grain length of tetraploid wild rice. The specific examples of the present invention prove that by editing the gene OaGS3, the grain length can be increased, thereby breeding tetraploid wild rice with higher yield, and promoting the domestication and utilization of tetraploid wild rice.

Description of drawings

Figure 1 is a map of OaGS3 gene target sites in O.alta in Example 1 of the present invention.

Fig. 2 is a construction diagram of VK005-OaGS3 gRNA in Example 1 of the present invention.

Fig. 3 is the result bands of partial T0 amplification of OaGS3-CC and OaGS3-DD in Example 2 of the present invention.

Fig. 4 is a diagram showing the mutation sequencing results of some genome edited T0 materials in Example 2 of the present invention. Among them, O.alta is the wild type, and T0-1 and T0-2 are genome editing T0 material plants.

Fig. 5 is a photo of some genome editing materials and wild-type grain length phenotypes in Example 2 of the present invention. Among them, O.alta is the wild type, and T0-1 and T0-2 are genome editing material strains.

Fig. 6 is a graph showing statistical results of partial genome editing materials and wild-type grain length data in Example 2 of the present invention. Among them, O.alta is the wild type, and T0-1 and T0-2 are genome editing material strains. The data shown in the figure are the mean ± standard deviation, the number of repetitions is 20, ** represents the significance analysis result is P<0.01.

Detailed ways

The following examples serve to illustrate the invention, but do not limit the scope of the invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

The binary vector VK005-01 is the Cas9/gRNA Vector in the Plant Cas9/gRNA Plasmid Construction Kit (Product No.: VK005-01) of Beijing Weishang Lide Biotechnology Co., Ltd.

The tetraploid wild rice in the following examples is the tetraploid wild rice Oryza alta 2007-24, which is the high-stalk tetraploid wild rice germplasm material (O.alta Swallen, the chromosome set is CCDD, and the number is YD-7900), the public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences or the National Germplasm Nanning Tetraploid Wild Rice Garden. Document 1: Liang Yuntao et al., Research on Induction and Differentiation of Callus of Tall Tetraploid Wild Rice, Southwest Agricultural Journal, 2014, 27(3), 905-909.

The transcript used in the following examples is T01, which is only used as an example and does not limit the editing site in application. If not otherwise specified, examples were carried out according to conventional experimental conditions or product specification conditions.

In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA glycosides.

Example 1, Selection of Tetraploid OaGS3 Target Site and Construction of CRISPR/Cas9 Gene Editing Vector

1. Selection of target sequence

The tetraploid tall-stalked tetraploid wild rice Oryza alta is an allotetraploid, and most genes have copies in the CC and DD subgenomes. Through comparative analysis, there are two homologous genes of OaGS3 in Oryza alta, the gene located on chromosome 3 of the CC subgenome is named OaGS3-CC, and the gene located on chromosome 3 of the DD subgenome is named OaGS3-DD (The nucleotide sequence is shown in sequence 2).

OaGS3-CC consists of 5926 nucleotides, and its nucleotide sequence is shown in SEQ ID NO:1. Its CDS sequence is shown in sequence 3, and the encoded protein sequence is shown in sequence 5.

OaGS3-DD consists of 6193 nucleotides, and its nucleotide sequence is shown in SEQ ID NO:2. Its CDS sequence is shown in sequence 4, and the encoded protein sequence is shown in sequence 6.

As shown in Figure 1, the target sequence is selected on the first exon conserved region of OaGS3-CC and OaGS3-DD, and the specific sequences are as follows:

Target sequence: 5'-CCGGCAGCGCCCGACCCCTG-3' (as shown in the 392nd-411th position of sequence 1 or as shown in the 579th-598th position of sequence 2);

The sgRNA designed according to the target sequence was denoted as OaGS3-sgRNA.

2. Construction of recombinant plasmids

Synthesize the following single-stranded primers with the adapter sequence (underlined part):

(波浪线指示的序列为靶序列，下划线指示的序列为接头序列)；VK005-OaGS3-F:

(the sequence indicated by the wavy line is the target sequence, and the sequence indicated by the underline is the linker sequence);

(波浪线指示的序列与Target site 1反向互补，下划线指示的序列为接头序列)。VK005-OaGS3-R:

(The sequence indicated by the wavy line is reverse complementary to Target site 1, and the sequence indicated by the underline is the linker sequence).

VK005-OaGS3-F and VK005-OaGS3-R undergo primer annealing to form Oligo dimers. The binary vector VK005-01 was single digested with BspQI, gel purified to recover a carrier fragment of about 17kb, and was ligated with the above-mentioned Oligo dimer under the action of T4 ligase to obtain a recombinant vector for sequencing with the following sequencing primers:

VK005 primer: 5'-GCCATGAATAGGTCTATGACC-3'.

The positive plasmid structure verified by sequencing is shown in Figure 2, that is, the sgRNA expression cassette was correctly inserted at the restriction site of BspQI, and the positive plasmid was named VK005-OaGS3gRNA. VK005-OaGS3gRNA contains sgRNA expression cassette and Cas9 coding gene, and can express sgRNA and Cas9.

Embodiment 2, transformation tetraploid rice callus and phenotypic identification

1. Breeding OaGS3 gene knockout tetraploid wild rice O.alta plants

The plasmid VK005-OaGS3gRNA obtained in Example 1 was transformed into Agrobacterium EHA105 by electric shock method, and the callus of tetraploid wild rice O. alta was infected with Agrobacterium, and the above callus was cultivated to obtain transformed plantlets. Genomic DNA of transformed shoots was extracted, and OaGS3-CC and OaGS3-DD were amplified with specific primers.

The primer pair used to amplify OaGS3-CC consists of OaGS3-CC-F and OaGS3-CC-R:

OaGS3-CC-F:5'-CCTCCGCCATTTATAATCCA-3';

OaGS3-CC-R: 5'-TATGCATTCGTGGTTTCAGC-3'.

The primer pair used to amplify OaGS3-DD consists of OaGS3-DD-F and OaGS3-DD-R:

OaGS3-DD-F:5'-GCTGCCTTTCCATCATCATT-3';

OaGS3-DD-R: 5'-ATGTTGGGCCATGCATATTT-3'.

The electropherogram of the amplified product is shown in Figure 3. Genome editing materials were selected and sequenced to determine the type of mutation. Part of the results are shown in Figure 4. OaGS3-CC and OaGS3-DD have frameshift mutations, resulting in changes in protein sequences and destruction of protein functions. The transformed seedlings containing the gene editing mutation are the transgenic tetraploid wild rice of the T0 generation (numbered T0-1, T0-2).

2. Phenotype of tetraploid wild rice O.alta with OaGS3 gene knockout

The T0 generation T0-1 strain and T0-2 strain were sowed in the field of the Hainan Experimental Base of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and the grains were harvested at the maturity stage under normal agronomic management. For length statistics, at least 3 biological repetitions are guaranteed.

See Figure 6 for the photos of the grain length of each strain. It was found that the gene-edited strain T0-1 strain and T0-2 strain had significantly longer grain length than the wild type.

Therefore, in the tetraploid wild rice Oryza alta, the rapid domestication of the grain can be realized by editing the gene OaGS3, making the grain of the tetraploid wild rice Oryza alta longer, and improving the yield potential of the tetraploid wild rice with high stalk.

The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention, and without unnecessary experiments, the present invention can be practiced in a wider range under equivalent parameters, concentrations and conditions. While specific embodiments of the invention have been shown, it should be understood that the invention can be further modified. In a word, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by using conventional techniques known in the art and departing from the disclosed scope of this application. Applications of some of the essential features are possible within the scope of the appended claims below.

sequence listing

<110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences

<120> Application of Substances Inhibiting OaGS3 Gene Expression in Regulating Grain Length of Tetraploid Wild Rice

<130>GNCSY210457

<160> 6

<170> SIP Sequence Listing 1.0

<210> 1

<211> 5926

<212>DNA

<213> Wild rice (Oryza alta)

<400> 1

gcccactctc tcccctccat cattacttgc ccaaaaacgg caatcgatcc ccttggcctg 60

cttccatcca tccatgtgct cctcctccgc catttataat ccaccttact ccttatctcc 120

cagctccgtc ttccccgctg ctagctccaa ctgatcaaaa cagctagcta gctgctgcag 180

cgccggcccc tacctaccct accctactgc tcctactcat cgtcatcgtc ccggccccta 240

tatatagctg cacctctctc tctctctcca tatatactcc tctcgtttta gagtagcagt 300

agtagtagag ctcatcactt catctccatc ggagtgaata agtgatatgg caatggcggc 360

ggcggcggcg gcgccccggc ccaagtcgcc gccggcagcg cccgacccct gcggccgcca 420

ccgcctccag ctcgccgtcg acgcgctcca ccgcgagatc ggattcctcg aggtacaaat 480

atctatgtag tatatcagta ccattcatag ttcttgctac aaaaacaaaa caaaacaaaa 540

caaaaacatc tttcgtacaa atatctgtcg aatcatttgc ttctgcatgc atcactctca 600

ccttaagttt tccccagctt aaaaccactc cttttatctt catttttcct tttcttgaac 660

cgaactcatt tcatcttcat atactactct tagcatgcac cattttcttc tttcagtccc 720

ccaatactga tcctctcttc ccagccaaat cattaacacg aataagctta atcaaacaag 780

ttgatcaact gatgatcgaa tgaaacaaaa caaaaccgat cgaataggag tcaatgatac 840

cacctatagc tgaaaccacg aatgcatagc ttacctctac tcgatctgtt gactgttcaa 900

cactgcacta agacaccagt taataagccg attaattaaa ccattaaatg agcttaaccg 960

gcggctagct tcctcttcct ctgggcccgt gcggatcgta ccatcggttt gcgcgttcct 1020

ccacccaaac tctctgcctt gttattccct ttgtctacat gcatttgcat catcatcaca 1080

tcaccactac gtttcaattg gattttggtg gtctccaacc atatcatatt gctttttttt 1140

cttctctact acaatctcta gcggttttgt ggagtactaa agaaaacaac taactagcca 1200

gggtttgacg tctaatcaat tggtgatttt gttaatttca cctactattt tagactttac 1260

aggtcttcga gctatactac gatttatcga tgccatgcat caatcgatgc tggtccacgc 1320

tagtttctga gttatgacta gctcttttaa ttgggcttca cctacttaat taattaacca 1380

gtggctgcgt catttattga ccaacattgt catgttaccc caactgattt tttttataaa 1440

aaaactacca ccggatatat tattagttcg tgtatgtatc tgctcaagca gcgcatgcat 1500

atagtttttc gtgacacaaa atatgtactg tatgctcaaa agatctgttg ggattgtcat 1560

attcgccatt ataattaaaa tggtgatgcc cagctttttt tttctccaat aatttattgg 1620

cttaatttcc tgtgctgtta ggagtaaagc tattaattag caccattttt aaagcttcta 1680

aaatctaaat aaagtacgac actgcaacct tactgtatat gctgtgtttg ttcattagca 1740

gtggcagtac ttgctgtcta gctttaaatg ttttgggtgt taaaatatcc cccagacatc 1800

acctgaaaag ttgacaggct aaacacatgc tcatttccca cgtttactta aattaactcg 1860

aataaacaat tactccttct gtttcggaat ataaagaatt ttagataaat gtaacatatc 1920

ctactattac aaatctgaaa aaaaaacctg ttcaaattcg taatactagg atatcatatt 1980

tattcaaaat tcgttatatt ttgagatgta gggagtaata tttcttgcag ggtgaaataa 2040

attcaatcga agggatccac gctgcctcca gatgctgcag agagtaagat agccctgctg 2100

tttctttttg tacttcgatt tcttctcgtc tttagtaccc ttcccatgca ttcgcaaaat 2160

atacttacct cagtttttgg tcatggatag atgaccttcg accgttatct ttgtaagcat 2220

cttcaataaa aatagcttta aatgcagggt attaggtata tactttcaat tgcaaatgta 2280

atgtacagca tattgattct aaaaccttga caaatcaaag taaaaaaacc gaacatttga 2340

tttctggacg ttgggagtttttttttcttt catcttttac aaatgagtac gttgtggaat 2400

catattgtgc aagcttttga gtctaattag gtatgagata ctatctacta gttgcttgag 2460

gtaaaacaaa atgtaattag gttacattta ctaaactgaa catttagtaa tgttttgtta 2520

aataacggta atttcaatgc atgcatgtcc tcccgtaaaa acagtgcaca gactgttcaa 2580

aaagtcattg cacaataact attcacatgg aactgtgaaa agtatatata ttggaacttt 2640

ctagatcctt ttgggaacat gggaaaagcc aagtcacgcg tggaatccct attccctgtg 2700

ttccttttga aaggatccag ttaagctaga actgaaaatt gtactactac tgagatgaaa 2760

ttactgcagg agcagaaagg ggggaaacct gtaaattaaa caagcctcaa aattcaacat 2820

cagcaaccga ctcatctagt gttcctgtgt tatgaaccag ccggcaacta tgcctctatg 2880

tagtgcattg aagcacctta acaatctatg gcggtcggtt ggaaacctca tataaatacc 2940

aaatttttta accggcatct cattagcaac actgatggag agaactaaag ttgtcggctt 3000

agaaaccaga caccttttag gtttcaaaaa taaaaaaaaa tactgactcg atgcatcgtc 3060

ttgaatctag ccgatgcttc gagcagcccc atcgccccga gaggacgact cccattctaa 3120

tatcatggac atggtaatac ataaatttac gaccagcaca tatgaaataa ccgaattaat 3180

tagttcagag tacttccact ttcgaatctt gtagaacttc tttcctttcg gaaacaaaag 3240

gggggaagaa ggaggtaaca acaaagggaa ccgagaacaa aataaatatg ccgatgtaca 3300

cgagcatgaa aatttaaaaa tctcacagga aaggagatca taaataaaga accaagaacc 3360

agctcactcg gtccagattc atgctcgtta gctagcttcc atgtagcaag aaggcacgca 3420

gccatcgcac atagtgtttg caatttcggc agccactaaa atttccgtgg ttgccgaaat 3480

tttgaaaaat tcatgaacgg tgttttctga ccttttttgt ttgaaatctt aacatatttt 3540

gactgaattt aaacaaattt cgaccaaatt cacaaatatt tgaaaaaaac caataatttc 3600

aggggggtgtttgatcttgc cggtaggatc cgaaatttca aaccatgatc gcacgcttca 3660

ccgcttgtct gcatcgacgc agctactggc catgggaagc ctccccatgc aaccaagctt 3720

cactgagagg ccgcacccct accgaccgag gagaggtggc cgccgcggag aggagggccg 3780

tcgccatcgc gtcgccagtt agaggcaagc cgtcaccttg gcgtggccgc gtagaggagg 3840

gccgctgctg tcgtgtcgcg atcgtcatcg tcggcttggc ttggagaggt ggagagatgg 3900

aggagaggagat aaggtgagag agatgagaga aaatattctg acggcttgtt tggcaacttg 3960

agggaagagg attgggagtt tagacgggaa aattgatggt gagatctgtc gatgggttat 4020

acctgcaaac cgtattcgga agatatcggg gtacgctggt actagggcct acacaatatc 4080

gtatcaagca ctcagagaca aatgtttata cgagttcaag ccctactcca gtttatatgg 4140

attatggatg gaacaccaca aggattacaa taggaaaaca taacaaccta tctaatttgc 4200

cgactaggat ccaccaagaa tggcccaacg agatctaatc gacgaatacg actgcggctt 4260

cctccgggtt gcttctcgct gtggttggtg gttaactccc tagggggcct tgtatttata 4320

ttgatcgctg cctttctctt caagtagaac tcaacaagac atatttggat acgagcctga 4380

ggagacctta tcttctttga ataggacttt aacaccttct gttccgagaa gataatttcc 4440

ttttatcctt gccgtatttt cttaattaaa ggtaccttcc cctatatttt taggtatatg 4500

gtattcgtat actccatgaa tctatgtatg gagatatgtt ttatccttta ccctgaaaag 4560

attaatctga gaatttgatt tttagtctca atctcttatt tgatagagat ggtgagaatt 4620

gatagagagt ttagttgaac attagatttt aaatgaaaat agaaggttga gatttgttta 4680

gacaaagtaa aggaggaatt ctctcttaat taccaccctc ttcccaggta ttagaaagaa 4740

gagagttcct cctgaatttc ctatccccat cccactacaa ctcccatatc tttcaaccaa 4800

acagaacatt taatagcctc atccctttaa acttttaatc cctttcaaaa actccctcca 4860

accaaacgga ccgcgaggag ataagagatg gatggtggag ataaggtcgc gctggtaagc 4920

ggggtccacg gtgatttttt tctccaccg tgttgctgct gcaattctat gtcggctaat 4980

aaaaaaatca gcatctatag tttctttatt tgtcccattg ttttaaaaaa ccgtacttat 5040

aataaatggt gtttttaataaaccagtacc tataaaatgt tataggtgtc ggtttttgat 5100

tttagattca tgtgaggagt cgagtaggcc agaaatagct tcatatttca tatatgcctg 5160

ttcaaggcat atatgaaggt gtccgttatt aggggttttg tagtaatgtt tgttggaatt 5220

aatcacttgt atattatgaa accgatggct ggcgaaactt tgtcaattgt gggcggtaag 5280

ctcacctaaa gcaaattgtt caaaacaagg ttaaagatga attttattaa tggattttgg 5340

tttggaaaaa ttttgtaggg ttgacgaatt catcggaaga actcccgaac cattcataac 5400

gatgtatgaa ttttcaggtc gagaatttgt ctttaacttg gcacaactgt tactttttct 5460

tattaattct ctgtttacaa gcagttcatc cgagaagcga agtcatgatc attctcacca 5520

cttttggaag aagtttcggt acttacttga ttcccggatc ttaatgtacg tatgcatctg 5580

cactgcgcta attattattt acaaaactga actatttaat aaacactaca aaatatttaa 5640

cttgcaaagt acatatttaa tcagggatt agtaaaccca ttccaatcta atgtcaccat 5700

atctgcatgc acggtccaca tggatgctgg tgtattaatt tctttttgtg ctagaatgga 5760

cgttttattt tcaattgtcg ttagtataca cctttacgca tcatctctct cctgcgcatt 5820

tgagaaaact tcttcctttg atgatagacg tggtcttatt cttcagtttg atttagtttc 5880

agatagaata aatattgttt attacktagt ttctctcctt cagtaa 5926

<210> 2

<211> 6193

<212>DNA

<213> Wild rice (Oryza alta)

<400> 2

acggctctga tccccgcggc gcagcggatc tagtccggat gggcagacga gacgagacga 60

gatgagatag atactagatc cgtccccgac aatctttcaa gccccgtggc cgtccctcct 120

ctgctcgatg tgccacgcct ctcagccttg ctgcctttcc atcatcatta ttcattcacg 180

cccaaagccc aaagcaattc acctctctct ctcgcacgaa tcgatagata cctgtaattt 240

cccccccgga aaagaaaaga gcggccattt ttctctcccc tccatcatta cttgcccaaa 300

aacggcaatc cctcctcccc catcgcctgc ttccatccat gtgcctccac cacctccgtc 360

ttccctccga ctgatcaaag cagctgctat cgctgctgca gcgccggcca tgcccgccct 420

ctagccccta cctaccctac cctaccctac tcggctactc ctactcctat atataccgtc 480

ctctctctct ctctctctct tgcgatatat ttcaagactc cagcgcgctc tccatcggag 540

tgatggcaat ggcggcggcg ccccggccca agtcgccgcc ggcagcgccc gacccctgcg 600

gccgccaccg cctccagctc gccgtcgacg cgctccaccg cgagatcgga ttcctcgagg 660

tacaacaata tccaatgtct tatcattccc tactccttct cttgcttcaa aaaaacatgt 720

cgtccatacc tcatattcat acacgtacgc tttttgctat cgctctctcc atgttttccc 780

aaccttaaaa accatcatgc atcatttgct tcttccgttc gacaaatcat ttgattatagag 840

aagtttaaaa cattggaaca acaaatatgc atggcccaac attgctcctc tcgatctctt 900

ccctcagcca aattaacacg aacaaactta accaaacaag ttcaaccaac gatcggatag 960

gagtcaacca gcgctagcta gctgatgaac tagctagcaa gtccgttgac tgttcaacac 1020

taattaaggc accagttaat aagccgatta attaaacaat tatatgagct taacgggcgg 1080

ctagcttcgt cctctgggtc cgtgcggatc gtaccatcgg tttgcgcgtt cctccaccaa 1140

aactctctgc cttgttattc cctttgccta ggagcacata catttgcatg catcatcatc 1200

acatcaccag ttttaattgg attttaattt ggcggtctcc aaccatatca tattggtttt 1260

gttctctata ctagagtact ataatctcta gcggttttgt ggaactaaga aattataatt 1320

agccagggtt tgttaaccaa ttggtggttt agtttgttaa ttttagctag tactaggatt 1380

ttagacttag aggtcttcga gctactacta cgatatattg atgccatgca tcaatcgatg 1440

ctggtccatg ctagtttctg actagccctc ttaattgggc ttgacctact taattaatta 1500

accagtggct gcgtcactca ttgaccaaca ttgtcatgtt accccggactg atattttttt 1560

tataaaaaaa actaccaccg gtcgatatat tattatagttag tgtatatatc tgctcaagca 1620

gcgcatgcac atggattttc gtcaaacaaa atatgtactg tatgctcaat gcatctgtgg 1680

gacgattgtc atattcgcct ttataattaa aatggtggtg cccagttgtt ttttttctcc 1740

aataatttat tgacttaaat ttcctgttct gttaggagta aaactattaa ttagcaccat 1800

tttaaaagtt tctaaaatct taataaagta tatgacactg caaccttact gtatatatat 1860

gttgtgtttg ttcattagca gtggcagtac ttgctgtcta actttaaatg ttttgggcgt 1920

taaaatatcc cccagacatc acctgaaaag ttgacaggct aaacacatgc ccatctccct 1980

cgtttactta aattaattcg aacaaacaac tatttcttgc agggtgaaat aaattcaatc 2040

gaagggatcc acgctgcctc cagatgctgc agagagtaag ttagccctgc tgtttctttt 2100

tgtacttcca tttcttctcg tctttaaact atccgcgacg ctacttactc taaattccta 2160

ctctaaagga atattccatg cctggtcagt gagattcctt actctatatc aaatcttccg 2220

cgctcgtgtt tactctatat cttcctctat aattttttaa ctatattttg aaaagtctat 2280

tttacctcct ccatcccccc aataaaaccc cgcactccta ctgcatcagc ggctcccccc 2340

cccgtcggtt gctccgccac cgccgatccc cctcccccgt gcccgaatcc ccccgccgca 2400

gccgtcgccg aatcccccct cccccagccg catcgcccct ccgccagccg catcggctcc 2460

tcccccgccg cccccgtcgc ccggcgtccc tctccctgcc gcggcttcgt cccgcatcag 2520

ctcctccccc ccgcctgtcg gccttcaccg cgccaacccg catcggctcg gaggcgcgga 2580

ggcggaggag ccgatggggc ggcgcgccgg ggcatcggcg gaggaagggc gtcgtggcgg 2640

atccgccgag ggagagcgct ctccgccgcg ccctccgccg agctctccgc ctcgctcgcc 2700

ctctccgcct cgcttgccct tccgctgtcg ctcgccgctg ctcctgcttc gttcccctcc 2760

tccccttctt ccgtccgtgc gcgggaggga cggacagttg gccgtcgccc gcgcgcgcgg 2820

cctatacagg ctgctacagt gctccgctac ggatagcgga gcactgtagc ccctggacga 2880

tacaggcgcc tttagcggat ggcgctgcag ccgcgccgtc cgctaccgcg gatagatcgc 2940

ggacggcgct gcggatagtc ttagtactct taccatgcat tcacaaaata tacttacctc 3000

ggttgatcat ggatagataa actttgaccg ttatcttttt aagcaacttc aataaaaata 3060

ggtttaaatg cagggtatta ggtatatatt ttcaattgca aatgtaacat acagcattga 3120

ttctaaaaca ttggcaaatc aaagtaaaaa actgaacatt tgatttaatt ctgaacgttg 3180

ggagtatttt ttttcatcat ttacaaatga gtacgttgtg gaattatatt gtgcaagctt 3240

ttgagactaa ttaggttata tgagatacta tctaccaagg ttgtcagtgt cttatgatac 3300

caggatccta ttaaagcgaa acgatattaa tcccatctag tatctaatta tcatagtatc 3360

tcatcttact atttatttcc atatgatcct acgaaatctt aggtagtatc ccgattctac 3420

gatccctctg atcctataaa atattattta aaataaggtg gattgaaaat aatatgaata 3480

aatatactca agtttacata aaaccaatta aatttatcaa aatcaatatt atatgcttta 3540

atttgtacaa catattatat attttatata aaaatgtata ctttctaaaa tctgttagta 3600

ttccgatcct atgatactac caataaaaaa cgattctacc tggtatctcc atatgctatc 3660

tattaggttgc ttgaggtaaa acaaaatgta gttaggttac atttactaaa ctgaacattt 3720

agtaatgttt tgttaaataa cggtaatttc aatgcatgca tgtcctcccg taaaaacagt 3780

gcagagactg ttcaaaaagt cattgcacaa taactattca catggaactg tgaaaagtat 3840

atattggaac ttactagatc cttttgggaa catgggaaaa gccaaagtca cgtgtggaat 3900

ccctattccc tgtgttcttt ttgaaaggat ccagttatgg cccgtttagt tcgcgaaatt 3960

tttttcaaaa acatcacatc aaacgtttga ccgaatgtcg ggaggggttt tcggacacga 4020

atgaaaaaac taatttcacg gttagcctgt aaaccacgag acgaattttt ttgagcctaa 4080

ttaagccgtc aacatgtagg ttactgtagc acttacggct aattatggcg taattatgac 4140

aaaattaggc tcaaaagatt cgtctcgtcg tttacaatcc aactgtgcaa ttagtttctt 4200

tttttatcta tattaatgc ttcatgcatg agtccaaaag tttgatgtga tgtttttggg 4260

gttttcgttt tgggaactaa acaaggcctt agctagaaga gtggaaattg tactactact 4320

gagatgaaat tacagcagga gcagaaaggg ggacaaactg aaaattaaac aagcctcaaa 4380

attcaacatc agcaaccgac tcatctagtg ttcctgtgtt atgaaccagc cggcaactat 4440

gcctctatgt agcgcattga agcaccttaa ctaagggcta tcaaggctgt gttaaactgt 4500

taatggtaca tatgcctttc agtttctgtc tgtactttag gttgctatac atcctatgaa 4560

catgttttct tgtctttctt cttacctcgg ttgaaaaacc catacaaata tcatttttta 4620

actgactact cactaaataa aaagaatcaa atgtgccgat ttaagaactg atgcctttaa 4680

aattttaata ataagaagaa aaataccagt tcgatgcatc gtctcgaatc gaccgaatcg 4740

aaccgatgct tcaaccggcc cccatccctc gagaggacga ctccattct agaaacatgg 4800

acatggtaac acagaaattt tcgaccagca catatgaaat aaccgaatca attagttcag 4860

aatccttcca ctttcgaatc ttgtagaact tctatccttt cggaaacaag agggggaagg 4920

aggaggcaac aacaaagtat gggaactgag aacaaaataa atatgccgat gtacacaagc 4980

atgaaaagtt aaagatctca aaggaaagga gatcataaat caagaaccaa gaaccagctc 5040

actcggtcca gttcatgctc gttagctagc ttccatgtag caagaaggca cgcagccatc 5100

gcacatagtg tttgtaattt cggtagccac cgaaatttcg gtggttaccg aaattttgaa 5160

aaaaatcatg aatttcggtg ttttctgact gatttttttttcaattttaa ctgagtttga 5220

acaaatttgg atcaaattca caaatatttg aaaaaatcca aaaaatttgg ggagatttga 5280

tcgtgccgat agggtccgaa atttcaaacc atgatcgcac acttcaccgc ttgtctgcat 5340

cgacgctggc cgtgggaagc ttccccgtgc aaccaagctt caccgagcgg ccgcacccct 5400

gccgatcgaa ggagaggtgg ccgccgtgga gaggagggcc gctgccgtcg cgtcgccggg 5460

tagaggcaag ccttcacctt ggcgtggccg cagacaggag ggccgctgct gtcgcgtaac 5520

ggccgtcgtc gccggcttgg cttggagagg tggagagaga tggaggagga gatgaggtta 5580

gagagagaga ggagaaagag gtaagaaaat atccagagga gataagagat gcatggtgga 5640

gataacgtcg cgctgggcaa gcgtggtcca cactgattttttccccgccc gtgtcgctgc 5700

tgcaattctg tgctggctaa taaaaaaaat cagataccta taaaatgtta tagatgtcgg 5760

tttttaattt taaactcatg tgagtagtcg ggtggataaa aaatggtctc gtctgccagt 5820

tgaatatgca tatataaaga cgtccactat tagggtttta tagtagttag ttagaattaa 5880

ttagttgcat attaaccaga aggctggcga aactttgtca attgtgggcg ctaatctcac 5940

ctgaagcaaa ttgttcaaaa caaggttaaa gatgattttt attaatgaat tttggcttgg 6000

aaaaattttg tagggttgac gaattcatcg gaagaactcc cgatccattc ataacgatgt 6060

atggattttc aggtcgagaa tttgtctttt aacttggcac aaccgtactt tttcttatta 6120

attctctgtt tacaagcagt tcatcggaga agcgaagtca tgatcattct caccacttat 6180

tgaagaagtt tcg 6193

<210> 3

<211> 666

<212>DNA

<213> Wild rice (Oryza alta)

<400> 3

atggcaatgg cggcggcggc ggcggcgccc cggcccaagt cgccgccggc agcgcccgac 60

ccctgcggcc gccaccgcct ccagctcgcc gtcgacgcgc tccaccgcga gatcggattc 120

ctcgagggtg aaataaattc aatcgaaggg atccacgctg cctccagatg ctgcagagag 180

gttgacgaat tcatcggaag aactcccgaa ccattcataa cgatttcatc cgagaagcga 240

agtcatgatc attctcacca cttttggaag aagtttcggt acttacttga ttcccggatc 300

ttaatgtacg tatgcatctg cactgcgcta attattattt acaaaactga actatttaat 360

aaacactaca aaatatttaa cttgcaaagt acatatttaa tcaggggattt agtaaaccca 420

ttccaatcta atgtcaccat atctgcatgc acggtccaca tggatgctgg tgtattaatt 480

tctttttgtg ctagaatgga cgttttattt tcaattgtcg ttagtataca cctttacgca 540

tcatctctct cctgcgcatt tgagaaaact tcttcctttg atgatagacg tggtcttatt 600

cttcagtttg atttagtttc agatagaata aatattgttt attacttagt ttctctcctt 660

cagtaa 666

<210> 4

<211> 651

<212>DNA

<213> Wild rice (Oryza alta)

<400> 4

atggcggcgg cgccccggcc caagtcgccg ccggcagcgc ccgacccctg cggccgccac 60

cgcctccagc tcgccgtcga cgcgctccac cgcgagatcg gattcctcga gggtgaaata 120

aattcaatcg aagggatcca cgctgcctcc agatgctgca gagaggttga cgaattcatc 180

ggaagaactc ccgatccatt cataacgatt tcatcggaga agcgaagtca tgatcattct 240

caccacttat tgaagaagtt tcggtactta cttgattccc ggatcttaat gtacatatgc 300

atctgcactg tgctaattgg tgtgcattat atggtcgtaa gtcctagtta cttattattt 360

acaaaactga actaataaac actacaaaat atttaacttg caaagtatcc aatctaatgt 420

cactatatct gcatgcatgg tccacatgga cgctggtgta ttattttttt tgtgctagta 480

tggacgtttt attttcaatt gtcgcttagt atacaccgtt acgcatcata tctctcctgc 540

gcatttgaga aaacttcttc ctttgatgat agacgtgggc ttattcttca gtttgattta 600

gtttcagata gaataaatat tgtttaatac ttagtttctc tccttcagta a 651

<210> 5

<211> 221

<212> PRT

<213> Wild rice (Oryza alta)

<400> 5

Met Ala Met Ala Ala Ala Ala Ala Ala Pro Arg Pro Lys Ser Pro Pro

1 5 10 15

Ala Ala Pro Asp Pro Cys Gly Arg His Arg Leu Gln Leu Ala Val Asp

20 25 30

Ala Leu His Arg Glu Ile Gly Phe Leu Glu Gly Glu Ile Asn Ser Ile

35 40 45

Glu Gly Ile His Ala Ala Ser Arg Cys Cys Arg Glu Val Asp Glu Phe

50 55 60

Ile Gly Arg Thr Pro Glu Pro Phe Ile Thr Ile Ser Ser Glu Lys Arg

65 70 75 80

Ser His Asp His Ser His His Phe Trp Lys Lys Phe Arg Tyr Leu Leu

85 90 95

Asp Ser Arg Ile Leu Met Tyr Val Cys Ile Cys Thr Ala Leu Ile Ile

100 105 110

Ile Tyr Lys Thr Glu Leu Phe Asn Lys His Tyr Lys Ile Phe Asn Leu

115 120 125

Gln Ser Thr Tyr Leu Ile Arg Asp Leu Val Asn Pro Phe Gln Ser Asn

130 135 140

Val Thr Ile Ser Ala Cys Thr Val His Met Asp Ala Gly Val Leu Ile

145 150 155 160

Ser Phe Cys Ala Arg Met Asp Val Leu Phe Ser Ile Val Val Ser Ile

165 170 175

His Leu Tyr Ala Ser Ser Leu Ser Cys Ala Phe Glu Lys Thr Ser Ser

180 185 190

Phe Asp Asp Arg Arg Gly Leu Ile Leu Gln Phe Asp Leu Val Ser Asp

195 200 205

Arg Ile Asn Ile Val Tyr Tyr Leu Val Ser Leu Leu Gln

210 215 220

<210> 6

<211> 211

<212> PRT

<213> Wild rice (Oryza alta)

<400> 6

Met Ala Ala Ala Pro Arg Pro Lys Ser Pro Pro Ala Ala Pro Asp Pro

1 5 10 15

Cys Gly Arg His Arg Leu Gln Leu Ala Val Asp Ala Leu His Arg Glu

20 25 30

Ile Gly Phe Leu Glu Gly Glu Ile Asn Ser Ile Glu Gly Ile His Ala

35 40 45

Ala Ser Arg Cys Cys Arg Glu Val Asp Glu Phe Ile Gly Arg Thr Pro

50 55 60

Asp Pro Phe Ile Thr Ile Ser Ser Glu Lys Arg Ser His Asp His Ser

65 70 75 80

His His Leu Leu Lys Lys Phe Arg Tyr Leu Leu Asp Ser Arg Ile Leu

85 90 95

Met Tyr Ile Cys Ile Cys Thr Val Leu Ile Gly Val His Tyr Met Val

100 105 110

Val Ser Pro Ser Tyr Leu Leu Phe Thr Lys Leu Asn Thr Leu Gln Asn

115 120 125

Ile Leu Ala Lys Tyr Pro Ile Cys His Tyr Ile Cys Met His Gly Pro

130 135 140

His Gly Arg Trp Cys Ile Ile Phe Phe Val Leu Val Trp Thr Phe Tyr

145 150 155 160

Phe Gln Leu Ser Leu Ser Ile His Arg Tyr Ala Ser Tyr Leu Ser Cys

165 170 175

Ala Phe Glu Lys Thr Ser Ser Ser Phe Asp Asp Arg Arg Gly Leu Ile Leu

180 185 190

Gln Phe Asp Leu Val Ser Asp Arg Ile Asn Ile Val Tyr Leu Val Ser

195 200 205

Leu Leu Gln

210

Claims (7)

1.OaGS3Application of gene in increasing length of tetraploid wild rice kernel, and is characterized in thatOaGS3The gene encodes an OaGS3 protein, and the OaGS3 protein is the protein of the following A1 or A2:

a1, protein with amino acid sequences shown as a sequence 5 and a sequence 6 in a sequence table;

a2, and a fusion protein obtained by attaching a protein tag to the N-terminus or/and the C-terminus of A1).

2. Use according to claim 1, characterized in that saidOaGS3The gene is specifically a gene shown as the following E1 or E2:

e1, the coding sequence of the coding chain is a DNA molecule shown in a sequence 3 and a sequence 4 in a sequence table;

e2, the nucleotide sequence is DNA molecules shown in a sequence 1 and a sequence 2 in a sequence table.

3. The use according to claim 2, wherein said use is made of tetraploid wild riceOaGS3The gene is subjected to genome site-specific editing, the genome site-specific editing is realized by a CRISPR/Cas9 system, and the target sequence of the CRISPR/Cas9 system is positioned inOaGS3A XXX sequence on the nucleotide sequence of any of the genes including XXXNGG; wherein XXX is any nucleic acid sequence of 19-20bp in the DNA molecule sequence, N is any nucleotide in A, T, G and C.

4. The use of claim 3, wherein the target sequence is a sequence from 392 th to 411 th of sequence 1 in the sequence listing.

5. The use according to any of claims 3-4, wherein the CRISPR/Cas9 system comprises the following 1) or 2):

1) The sgRNA targets are sequences shown as 392 th to 411 th positions of a sequence 1 or 579 th to 598 th positions of a sequence 2;

2) A CRISPR/Cas9 vector expressing the sgRNA.

6. The method for breeding the tetraploid wild rice with the increased kernel length is characterized by comprising the following steps: the method of inhibiting receptor tetraploid wild rice as claimed in claim 1OaGS3Expressing the gene to obtain the target tetraploid wild rice with the seed length longer than that of the receptor tetraploid wild rice.

A CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises 1) or 2) as follows:

1) The sgRNA targets are sequences shown from 392 th to 411 th positions in a sequence 1 or from 579 th to 598 th positions in a sequence 2;

2) A CRISPR/Cas9 vector expressing the sgRNA.

Images