CN108395472A - A kind of gene and its application of control rice class grain length and grain weight - Google Patents
A kind of gene and its application of control rice class grain length and grain weight Download PDFInfo
- Publication number
- CN108395472A CN108395472A CN201810040287.9A CN201810040287A CN108395472A CN 108395472 A CN108395472 A CN 108395472A CN 201810040287 A CN201810040287 A CN 201810040287A CN 108395472 A CN108395472 A CN 108395472A
- Authority
- CN
- China
- Prior art keywords
- grain
- tgw3
- seq
- rice
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a kind of rice long-grain related gene and its applications.Specifically, the present inventor discloses a kind of long grain related gene of rice for the first time by studying the relevant quantitative trait locus of rice class particle shape grain weightTGW3, a kind of serine/threonine phosphokinase of the gene code.Long grain parent Ji money 1560 is compared with short grain parent Huang Huazhan,TGW3Transcript has lacked complete third and fourth exon, causes the TGW3 albumen of 1560 coding of lucky money to lack 110 amino acid sequences, the TGW3 protein three-dimensional structures of prediction change.The invention further relates to the mutains and its coded sequence of the TGW3 of missing protein function, and in transformation crop, increase the application of grain length and crop yield etc..
Description
Technical field
The present invention relates to agriculture fields.Specifically related to the gene and application of a kind of control rice grain grain length and grain weight.
Background technology
The grain size of rice is an important economic characters, and development is by various Genetic signals and adjusts approach
Control and influence, including the influence of parental-origin effects, the adjusting of Plant hormone signal approach, the adjusting of G-protein, and development and generation
Thank to the regulation and control etc. of signal.Rice grain weight is significantly correlated with particle shape, is generally indicated with mass of 1000 kernel, and with grain length, grain is wide, grain is thick and length and width
Than etc. Grain shape traits weighed.Rice grain weight/particle shape is typical quantitative character, by controlled by multiple genes, usually with QTL
(quantitative trait locus) research method carries out genetic analysis.Currently, identified rice grain weight/particle shape
QTL is hundreds of, is distributed on 12 chromosomes of rice (www.gramene.com).Especially grain length, grain are wide has very for rice grain shape
High heritability, some QTL can steadily be detected in different genetic background and environment.As one positioned at rice the 3rd
The main effect QTL GS3 that chromosome centromere nearby controls rice grain length is repeated discovery in different genetic groups and environment.QTL
Stability of the hereditary effect in varying environment and genetic background is significant to kind genetic improvement.
Particle shape and grain principal characteristic shape are rice yield inscapes, are mainly controlled by abiogenous quantitative trait locus, closely
For over ten years, the completion measured in particular with rice whole genome sequence, more and more adjusting and controlling rice particle shapes and grain weight
QTL is parsed by molecular cloning and function, but other than a small amount of QTL/ genes, also has more than 400 adjusting and controlling rice particle shapes and grain
The QTL of weight, is still in the Genes location stage.Therefore, the QTL for controlling the character is cloned and the function of its candidate gene is parsed
It is also far from enough.So far, to the molecular regulation Mechanism Study of rice grain shape and grain weight, still lack a system and deep
Parsing.The present invention clones the gene TGW3 of a control rice grain grain length and grain weight using the method separation of map based cloning, is
Rice high yield and quality breeding provide genetic resources.
Invention content
The object of the present invention is to provide the genes and its application of a kind of control crop kernel and grain weight.
The first aspect of the present invention, provides a kind of polypeptide of the control rice grain length grain weight of separation, which is selected from down
Group：
(1) there is SEQ ID NO:The polypeptide of 2 amino acid sequences；Or
(2) by SEQ ID NO:2 amino acid sequences to be formed by replacing, missing or adding for 1-10 amino acid residue
The polypeptide derived from (1)；Or
(3) amino acid sequence and SEQ ID NO:Homology >=90% of amino acid sequence shown in 2 is (preferably >=95%,
More preferably >=98%), the polypeptide derived from (1).
The second aspect of the present invention, provides a kind of polypeptide of the control rice grain length grain weight of separation, which is selected from down
Group：
(i) there is SEQ ID NO：The polypeptide of 4 amino acid sequences；Or
(ii) by SEQ ID NO：4 amino acid sequences replace, miss or add to be formed by 1-10 amino acid residue
The polypeptide derived from (i)；Or
(iii) amino acid sequence and SEQ ID NO：Amino acid sequence shown in 4 homology >=90% (preferably >=
95%, more preferably >=98%), the polypeptide derived from (i).
The third aspect of the present invention, provides a kind of polynucleotides of separation, and the polynucleotides are selected from the group：
(a) polynucleotides of polypeptide described in first aspect present invention are encoded；
(b) sequence such as SEQ ID NO:Polynucleotides shown in 1；
(c) nucleotide sequence and SEQ ID NO:The polynucleotides of homology >=95% (preferably >=98%) of 1 sequence；
(d) with (a), (b) and (c) described in polynucleotides complementation polynucleotides.
The fourth aspect of the present invention, provides a kind of polynucleotides of separation, and the polynucleotides are selected from the group：
(A) polynucleotides of polypeptide described in second aspect of the present invention are encoded；
(B) sequence such as SEQ ID NO:Polynucleotides shown in 3；
(C) nucleotide sequence and SEQ ID NO:The polynucleotides of homology >=95% (preferably >=98%) of 3 sequences；
(D) polynucleotides of the polynucleotides complementation and described in (A), (B) and (C).
The fifth aspect of the present invention provides a kind of Crop Improvement (it is furthermore preferred that increase the grain length and grain of crop kernel
Method again), this method include：
(I) grain characters of Crop Improvement；
(II) crop cell division is adjusted；
(III) Crop Improvement grain weight and crop yield.
More preferably, the seed Grain shape traits are selected from the group：Grain length, grain are wide, grain is thick.Preference of the present invention
In, the TGW3 genetic fragments obtained in the crop of big grain kind are imported to the crop of granule kind with Marker-assisted selection technology
In, so that crop kernel is become larger heavy.
In another preference of the present invention, have by the method reduction that RNAi, genome editor or gene inactivate
SEQ ID NO:2 and SEQ ID NO：4 expression or activity promote crop kernel to become larger.
Description of the drawings
Following drawings is for illustrating specific embodiments of the present invention, rather than limits and be defined by the claims
The scope of the invention.
Fig. 1 shows the grain ratio of rice TGW3 antisense transgenes plant (AS87, AS88) and receptor kind " in spend 11 "
Compared with.
Compared with Fig. 2 shows the grain of rice TGW3 justice transfer-gen plant (S14, S16) and receptor kind " in spend 11 ".
Fig. 3 is shown obtains TGW3 mutant plants (C65, C70) and receptor kind " in spend 11 " using crispr technologies
Grain compare.
Fig. 4 shows TGW3 near isogenic lines (NIL (TGW3)) and the grain and grain of rice grain length ratio to compareing (Control)
Compared with.
Specific implementation mode
The present inventor is found that a kind of new base of control crop kernel grain length and grain weight for the first time through deeply extensive research
The function of cause, the gene reduces or missing can increase particle shape and increase grain weight.Research confirmation TGW3 gene overexpressions turn base
Because the particle shape of plant becomes smaller, grain is reduced again, the particle shape of the transfer-gen plant of TGW3 genes reduction expression becomes larger, grain increases again.Table
Bright TGW3 genes are of great significance in high-yield breeding of crops, have wide practical use.
Term
" crop " of the present invention includes but not limited to：Rice, wheat, corn, sorghum, soybean etc..
" separation " of the present invention refers to that substance is separated from its primal environment.As natural in active somatic cell
Polynucleotide and polypeptide under state do not isolate and purify, but same polynucleotide or polypeptide are such as from native state
In with being separated in other existing substances, then to isolate and purify.
" the TGW3 albumen or polypeptide of separation " of the present invention refer to the TGW3 albumen substantially free of naturally with
Its relevant other albumen.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthesis polypeptide.The polypeptide of the present invention includes natural
The product of purifying or chemically synthesized product, or generated from protokaryon or eucaryon host by recombinant technique.
" long grain " of the present invention, " big grain " may be used interchangeably.
" TGW3 albumen " of the present invention refers to the SEQ ID NO with TGW3 protein actives：The polypeptide of 2 sequences.
The present invention also provides the polynucleotide sequences of coding TGW3 albumen.The polynucleotides of the present invention can be DNA shapes
Formula or rna form.DNA form includes：DNA, genomic DNA or artificial synthesized DNA.DNA can be coding strand or non-coding
Chain.It the code area of encoding mature polypeptide can be with SEQ ID NO：1 or SEQ ID NO：Coding region sequence shown in 3 it is identical or
It is the variant of degeneracy.
The invention further relates to application of the Marker-assisted selection technology of TGW3 genes in the big grain SOYBEAN IN HIGH-YIELD BREEDING of crops.
The present invention accounts for (granule kind) hybridization structure genetic group, application with 1560 (especially big grain kind) He Huanghua of Ji money
QTL location technologies located the new gene TGW3 of the control rice grain length that one is located at the 3rd chromosome and grain weight, and pass through figure
Position clone technology has cloned the gene.
Main advantages of the present invention are：
(1) a kind of new rice big grain gene isolated for the first time, reducing the expression of the gene or knocking out the gene can make
The seed of crop (such as rice) becomes larger, and increases crop yield.
(2) rice big grain gene TGW3 of the invention can be used as control crop kernel size, improve the yield and quality
One gene is applied to the improvement of variety of crops.
Present invention will be further explained below with reference to specific examples.These embodiments are merely to illustrate the present invention and do not have to
In limiting the scope of the invention.Show the experimental method of dated actual conditions in the following example, usually according to normal condition such as
Sambrook et al., molecular cloning：Lab guide (New York:Cold Spring Harbor Laboratory
Press, 1989) condition described in, or carry out according to the normal condition proposed by manufacturer.
The acquisition of 1 rice big grain gene TGW3 of embodiment
1560 (JZ1560) of Ji money are Large grain rice kind (mass of 1000 kernel are up to 57 grams), and Huang Huazhan (HHZ) is granule rice
Commercial variety (21 grams of mass of 1000 kernel).The present inventor hybridizes structure genetic group with JZ1560 with HHZ, utilizes Molecular mapping
New gene (or QTL) TGW3 of one control rice grain length and grain weight, the gene are located on the 3rd chromosome.Further utilize figure
Position clone technology has cloned the gene, gene order such as SEQ ID NO：1 and SEQ ID NO：Shown in 3, the albumen such as SEQ of coding
ID NO：2 and SEQ ID NO：Shown in 4.
The molecular marker assisted selection breeding of embodiment 2TGW3
PCR Oligonucleolide primers (SEQ ID NO are designed in the present embodiment in TGW3 genes：5 and SEQ ID NO：6),
The DNA that PCR amplification big grain kind and granule kind is carried out with Taq enzyme detects big grain product by 2.5% agarose gel electrophoresis
There are DNA polymorphism (difference), big grain kind component 284bp, granule kind 292bp between kind and granule kind, therefore this draws
Object develops into the molecular labeling that specificity differentiates big grain TGW3 genes and granule TGW3 genes.In big grain kind and granule kind
Rapidly the individual for carrying big grain gene can be picked out with the molecular labeling in filial generation group, it is new to cultivate big grain high yield
Kind.
5 ' end oligonucleotide primer sequences be：
5 '-TAGCCAAAGACCTTATCCA-3 ' (SEQ ID NO：5)；
3 ' end Oligonucleolide primers sequences be：
5 '-TTAATTGTTTGTTCGCCTC-3 ' (SEQ ID NO：6).
Embodiment 3TGW3 Transgenic Rices are tested
Cultivate big grain high-yield variety.The present embodiment uses the double base from plant expression vector pCAMBIA3301 to carry
Body pHB is as Transgenic Rice carrier.The vector encoded one bacterial origin of replication (ori), kalamycin resistance gene
(Kanr), hygromycin gene (Hygr), the termination of herbicide resistance gene (Bar), double CaMV35S promoters, NOS genes
Signal sequence and after restriction enzyme multiple cloning sites (MCS) between the two.In restriction enzyme multiple cloning sites
It place can cDNA sequence structure transgene carrier that is positive or being reversely inserted into TGW3.
The transgenosis plasmid construction of 1.TGW3 justice overexpressions
In the present embodiment, to come from the RNA of granule kind HHZ as template, first chain cDNA is synthesized, this is utilized
The 5 ' of DNA sequence dna and 3 ' end-specificity oligonucleotides are primer, are expanded with KOD-Plus-Neo exo+ polymerases, are obtained
1.275KB full-length cDNA amplification product.The amplified production is cloned into intermediate carrier by way of blunt end cloning
On pEASY-Blunt3 carriers, and multiple recons are sequenced, verify the correctness of sequence.The transition plasmid of the recombination carries
Body is TGW3-pEASY-Blunt3.PCR amplification primer sequence：
5 ' end Oligonucleolide primers sequences be：5’-GCCAAGCTTATGGCCTATTCTGGACTAAG-3’
3 ' end Oligonucleolide primers sequences be：5’-TAAGGATCCGGTGCGCAGCGCCATGAAC-3’
With Hind III and BamH I endonuclease digestion TGW3-pEASY-Blunt3 and Phb carriers, by TGW3-pEASY-
The postdigestive 1.275kb target fragments of Blunt3 are connected in Hind III and BamH the I restriction enzyme sites of final carrier pHB.Even
Object of practicing midwifery converts coli strain T1, and transformant, picking individual colonies are screened on the LB culture mediums of also Kan (50 μ g/ml)
Plasmid is extracted, with Hind III and BamH I digestions, the clone that digestion generates about 1.3kb is selected, with M13 universal primers to this gram
It is grand carry out sequencing detection target fragment sequence it is whether correct.So successfully build pHB-35S-TGW3 plasmids.
The transgenosis plasmid construction of 2.TGW3 antisense overexpressions
Using the RNA for coming from granule kind as masterplate, first chain cDNA is synthesized, with the 5 ' of the DNA sequence dna and 3 ' end PCR
Oligonucleotides is primer, is expanded with KOD-Plus-Neo exo+ polymerases, and the overall length ORF amplification productions of 1.275KB are obtained
Object.The amplified production is cloned by way of blunt end cloning on intermediate carrier pEASY-Blunt3 carriers, and to multiple
Recon is sequenced, and the correctness of sequence is verified.BamH I and Hind III digestions site is utilized later, in sequencing correctly
Between carrier digestion, be connected on pHB carriers, successfully build pHB-35S-antiTGW3 plasmids.PCR amplification primer sequence：
5 ' terminal nucleotide primer sequences are：5’-CGGGATCCATGGCCTATTCTGGACTAAGG-3’
3 ' terminal nucleotide primer sequences are：5’-CCAAGCTTCTAGGTGCGCAGCGCCATGAA-3’
3.TGW3 rice transformations
Above two recombinant plasmid imports agrobacterium strains EHA105 by freeze-thaw method.Every 200 μ lEHA105 competence is thin
Born of the same parents and 0.5-1 μ g (about 10 μ l) Plasmid DNA mixing respectively place 5 points of kinds on ice, in liquid nitrogen and in 37 DEG C of water-baths successively：With new
Fresh YEB fluid nutrient mediums are diluted to 1ml, are cultivated 2-4 hours in 28 DEG C of shakings；Take 200 μ l coatings and (50 μ of Kan containing antibiotic
G/ml on YEB tablets), 28 DEG C are cultivated 2-3 days.The bacterium colony grown draws single bacterium on the YEB tablets containing antibiotic, continuous to draw
3 times.It is inoculated into the antibiotic AB fluid nutrient mediums of 3ml from picking Agrobacterium single bacterium colony on YEB tablets, 200rpm continues to shake
Culture is shaken to OD600It collects and is resuspended by fresh Agrobacterium bacterium solution in 500rpm, 4 DEG C of centrifugations, 5 points of kinds for 0.6-0.8 or so
In the AAM fluid nutrient mediums of 1/3 volume, the various acceptor materials of rice transformation are can be used at this time.
The present embodiment is using the rataria callus for spending 11 in conventional conversion method for agrobacterium rice transformation.Take 12- after pollinating
Spend 11 immature seeds after 70% ethyl alcohol impregnates 1 point of kind in 15 days, (with water 1 in NaCLO solution:3 mixing, add 2-3 drops
Polysorbas20 0) more than 90 points of kinds of disinfection, with aseptic water washing 4-5 times, then chooses rataria with scalpel and tweezers and be inoculated in
N6D2Evoked callus on culture medium, 26 ± 1 DEG C, be protected from light under the conditions of cultivate, can be used for converting after 4 days.By rataria callus
It is soaked into fresh AAM Agrobacterium bacterium solutions and shakes frequently, rice material is removed after 20 points of kinds, was sucked on aseptic paper
More bacterium solutions, is transferred to N6D immediately2On C culture mediums, co-cultured 3 days in 26 DEG C.When co-cultivation, add in co-culturing culture medium
Enter acetosyringone as Agrobacterium Vir gene activation objects, uses a concentration of 100 μm of ol/L.After 3 days, from co-cultivation culture medium
Upper taking-up callus cuts plumule and is transferred to Selective agar medium N6D2S1 (Hyg25 ㎎/l), carries out selection culture.7-12 days
Resistant calli is transferred to N6D afterwards2Continue to screen on S2 (Hyg50 ㎎/l) Selective agar medium.It is grown after 10-12 days vigorous
Resistant calli be transferred on pre- differential medium and cultivate one week or so, then move on differential medium and break up (12 hours
Illumination/day).Regenerated seedling is in 1/2MS0Strong plantlets and rootage on culture medium is subsequently moved within the cultivation of phjytotron basin soil.
4 rice TGW3 antisense transgenes plant of embodiment is compared with the grain size of TGW3 justice transfer-gen plants
1, the comparison of TGW3 antisense transgenes plant and wild type
Method as described in Example 3 obtains rice TGW3 antisense transgene plant, observes the phenotype of rice grain shape, analyzes
The influence of TGW3 gene pairs grain sizes.The results are shown in Figure 1, the paddy of rice TGW3 antisense transgenes plant (AS87, AS88)
Grain is obviously bigger than spending 11 (ZH11) in receptor kind.
2, the comparison of TGW3 antisense transgenes plant and wild type
Method as described in Example 3 obtains rice TGW3 justice transfer-gen plants, observes rice grain shape phenotype, analysis
The influence of TGW3 gene pairs grain sizes.As a result such as Fig. 2, the grain of rice TGW3 justice transfer-gen plant (S14,16) obviously compare
Spend 11 (ZH11) small in receptor kind.
Embodiment 5 obtains TGW3 mutant using crispr technologies
1, TGW3 gene orders are analyzed, CRIPSR-P tool (http are utilized://crispr.hzau.edu.cn/
CRISPR2/ sgRNA target sites, target sequence) are designed：
Target sequence：5’-ctacgatccgtggccgaaa actacgatccgtggccgaaatgg-3’
2, structure intermediate carrier (tgw3--B1)
Intermediate carrier primer synthesizes, and obtains primer sequence using primer5, primer sequence is as follows：
5 ' terminal nucleotide primer sequence tgw3-B1 (+):5’-cagtGGTCTCaggcactacgatccgtggccgaaa-3’
3 ' terminal nucleotide primer sequence tgw3-B1 (-):5’-cagtGGTCTCaaaactttcggccacggatcgtag-3’
By primer denaturation, annealing, gRNA segments are obtained, digestion connection obtains recombinant plasmid, and conversion Escherichia coli set 37
DEG C constant incubator, is incubated overnight, and selects monoclonal, extracts plasmid identification.
3,2 monoclonals, sequencing identification are sent the plasmid of extracting
4, it identifies that correct plasmid enzyme restriction is connected to expression vector, converts competent escherichia coli cell DH5 α, be coated on
LB solid mediums are incubated overnight, and select monoclonal, extract plasmid identification.
5, identify correct plasmid vector, using Agrobacterium (EHA105) infestation method infect it is middle spend 11 callus, turned
Gene plant.
6, from T0 for tender blade is picked on transfer-gen plant, plant tissue DNA is extracted using CTAB methods.
7, the primer for including target site using primer5 Software for Design obtains TGW3 segments, primer using round pcr
Sequence：
5 ' terminal nucleotide primer sequence TGW3-P3 (+):5’-CCTTCTTGATCGCTGTGTGG-3’
3 ' terminal nucleotide primer sequence TGW3-P3 (-):5’-TCTGCTGTACTGTCTCGCAA-3’
8,1% agarose gel electrophoresis selects target stripe gel extraction, is sent to company's sequencing.
9, website DSDECODE (http are utilized://dsdecode.scgene.com/home/) sequencing result is divided
Analysis.
10, result display obtains 2 plants of TGW3 mutant C65 and C70.The target sequence of C65 and C70 mutant strains and wild type
It compares：
Wild type：GAATGTCTAGGAAGG(456)AGCTACTACGATCCGTGGCCGAAATGGTCTACCTAAACAGG
C65：GAATGTCTAGGAAGG(456)AGCTACTACGATCCGTGGCCGAAAATGGTCTACCTAAACAGG
C70：GAATGTCTAGGAAGG(456)AGCTACTACGATCCGTGGCC-AAATGGTCTACCTAAACAGG
6 rice TGW3 mutant transfer-gen plant of embodiment is compared with the grain size of WT lines
Method as described in Example 5 obtains rice TGW3 gene knockout plant, observes rice grain shape phenotype, analyzes TGW3
The influence of gene pairs grain size.As a result as the grain of Fig. 3, rice TGW3 transfer-gen plant (C65, C70) knocked out obviously compares
Spend 11 (ZH11) big in receptor rice varieties.
Claims (4)
1. a kind of albumen of separation, which is characterized in that the albumen is selected from the group：
(1) such as SEQ ID NO:Polypeptide shown in 2 amino acid sequences；Or
(2) by SEQ ID NO:Amino acid sequence shown in 2 replaces, misses or adds to be formed by 1-10 amino acid residue
It is polymorphic derived from (1)；Or
(3) amino acid sequence and SEQ ID NO:Homology >=90% of amino acid sequence shown in 2 is (preferably >=95%, more preferably
Ground >=98%), the polypeptide derived from (1).
2. a kind of albumen of separation, which is characterized in that the albumen is selected from the group：
(i) such as SEQ ID NO:Polypeptide shown in 4 amino acid sequences；Or
(ii) by SEQ ID NO:Amino acid sequence shown in 4 replaces, misses or adds shape by 1-10 amino acid residue
At derived from (i) it is polymorphic；Or
(iii) amino acid sequence and SEQ ID NO:Homology >=90% of amino acid sequence shown in 4 is (preferably >=95%, more
Goodly >=98%), the polypeptide derived from (i).
3. a kind of polynucleotides of separation, which is characterized in that the polynucleotides are selected from the group：
(a) polynucleotides of the albumen described in claim 1 and 2 are encoded；
(b) sequence such as SEQ ID NO:1 and SEQ ID NO:Polynucleotides shown in 3；
(c) nucleotide sequence and SEQ ID NO:1 and SEQ ID NO:Homology >=95% (preferably >=98%) of 3 sequences
Polynucleotides；
(d) with (a), (b) and (c) described in polynucleotides complementation polynucleotides.
4. the purposes of claim 1 and 2 polypeptides or its coded polynucleotide, which is characterized in that the purposes is selected from the group：
(I) polypeptide or its coded polynucleotide are for controlling crop kernel shape；
(II) polypeptide or its coded polynucleotide are for adjusting cell division；
(III) polypeptide or its coded polynucleotide are for adjusting grain crop weight and crop yield.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810040287.9A CN108395472A (en) | 2018-01-16 | 2018-01-16 | A kind of gene and its application of control rice class grain length and grain weight |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810040287.9A CN108395472A (en) | 2018-01-16 | 2018-01-16 | A kind of gene and its application of control rice class grain length and grain weight |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108395472A true CN108395472A (en) | 2018-08-14 |
Family
ID=63094916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810040287.9A Pending CN108395472A (en) | 2018-01-16 | 2018-01-16 | A kind of gene and its application of control rice class grain length and grain weight |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108395472A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109608532A (en) * | 2019-02-02 | 2019-04-12 | 中国科学院植物研究所 | OsSYF2 albumen and its encoding gene and its application in adjusting and controlling rice grain weight |
| CN110616277A (en) * | 2019-11-14 | 2019-12-27 | 扬州大学 | Rice grain length gene function marker and application thereof |
| CN111499713A (en) * | 2020-06-10 | 2020-08-07 | 华中农业大学 | Rice grain type gene qG L6-2 and application thereof |
| CN111793625A (en) * | 2020-07-29 | 2020-10-20 | 江西农业大学 | Oligo DNA group of sgRNA for site-directed knockout of rice OsAUR2 gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101161675A (en) * | 2006-10-13 | 2008-04-16 | 中国科学院上海生命科学研究院 | Rice big grain gene and uses thereof |
| CN102533782A (en) * | 2012-01-05 | 2012-07-04 | 华南师范大学 | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains |
| CN103289972A (en) * | 2012-03-02 | 2013-09-11 | 中国科学院上海生命科学研究院 | Rice long-grain related gene and application for same |
| CN105950633A (en) * | 2016-06-16 | 2016-09-21 | 复旦大学 | Application of gene OsARF4 in controlling grain length and thousand grain weight of rice |
-
2018
- 2018-01-16 CN CN201810040287.9A patent/CN108395472A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101161675A (en) * | 2006-10-13 | 2008-04-16 | 中国科学院上海生命科学研究院 | Rice big grain gene and uses thereof |
| CN102533782A (en) * | 2012-01-05 | 2012-07-04 | 华南师范大学 | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains |
| CN103289972A (en) * | 2012-03-02 | 2013-09-11 | 中国科学院上海生命科学研究院 | Rice long-grain related gene and application for same |
| CN105950633A (en) * | 2016-06-16 | 2016-09-21 | 复旦大学 | Application of gene OsARF4 in controlling grain length and thousand grain weight of rice |
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "CP018159", 《GENBANK》 * |
| GENBANK: "XP_015633107", 《GENBANK》 * |
| MI-JEONG YOO等: "Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants", 《BMC PLANT BIOLOGY》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109608532A (en) * | 2019-02-02 | 2019-04-12 | 中国科学院植物研究所 | OsSYF2 albumen and its encoding gene and its application in adjusting and controlling rice grain weight |
| CN109608532B (en) * | 2019-02-02 | 2020-09-22 | 中国科学院植物研究所 | OsSYF2 protein, coding gene thereof and application thereof in regulation and control of rice grain weight |
| CN110616277A (en) * | 2019-11-14 | 2019-12-27 | 扬州大学 | Rice grain length gene function marker and application thereof |
| CN111499713A (en) * | 2020-06-10 | 2020-08-07 | 华中农业大学 | Rice grain type gene qG L6-2 and application thereof |
| CN111793625A (en) * | 2020-07-29 | 2020-10-20 | 江西农业大学 | Oligo DNA group of sgRNA for site-directed knockout of rice OsAUR2 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164347B (en) | Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application | |
| CN107460199B (en) | Rice grain shape controlling gene GS9 and its application | |
| CN108395472A (en) | A kind of gene and its application of control rice class grain length and grain weight | |
| CN110724183B (en) | Application of GmXTH91 protein in regulation and control of plant stress resistance and plant height | |
| CN107205354A (en) | Haploid induction thing | |
| CN105646684B (en) | A kind of rice grain shape GAP-associated protein GAP GLW2 and its encoding gene and application | |
| CN108291234A (en) | Multiple sporinite forms gene | |
| CN110684796B (en) | Method for specifically knocking out soybean lipoxygenase gene by CRISPR-Cas9 and application thereof | |
| CN108503700B (en) | Rice grain type protein and coding gene and application thereof | |
| CN112760304A (en) | GBSSI mutant protein based on gene editing technology and application thereof in plant breeding | |
| CN111073875B (en) | Wheat haploid inducing gene and application thereof | |
| CN107338265B (en) | Gene editing system and method for editing plant genome by applying same | |
| CN107353332A (en) | A kind of rice chloroplast developmental regulation Gene A HS1 and its coding protein and application | |
| CN109776664A (en) | A kind of gene and its application controlling rice class granule and semi-dwarf mutant | |
| CN107326035A (en) | A kind of adjusting and controlling rice grain type and the deubiquitination enzyme gene UBP5 of leaf color and its application | |
| CN114230648B (en) | Application of rice gene PANDA in improving plant yield | |
| CN114395580B (en) | Gene for controlling maize plant height | |
| CN111979233A (en) | Method for increasing rice grain type and application thereof | |
| CN112279904B (en) | Application of protein GL12.2 in regulation and control of rice yield | |
| CN111304219B (en) | GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length | |
| CN110407921A (en) | From the plant seed development associated protein SGDW1 and its encoding gene of millet and application | |
| CN111440231B (en) | Application of protein GmFULa in regulation and control of soybean plant type and yield | |
| CN114958867A (en) | Corn ear grain weight and yield regulation gene KWE2, and encoding protein, functional marker, expression vector and application thereof | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN115466747A (en) | Glycosyltransferase ZmKOB1 gene and application thereof in regulating and controlling maize ear fructification character or development |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |