CN113416735A

CN113416735A - Tobacco germ cell specific high expression gene and application thereof

Info

Publication number: CN113416735A
Application number: CN202110286643.7A
Authority: CN
Inventors: 曾婉俐; 高茜; 向海英; 米其利; 朱玲超; 许力; 蒋佳芮; 张建铎; 黄海涛; 孔维松; 王根洪; 贾凌; 刘赫; 李雪梅
Original assignee: China Tobacco Yunnan Industrial Co Ltd
Current assignee: China Tobacco Yunnan Industrial Co Ltd
Priority date: 2021-03-17
Filing date: 2021-03-17
Publication date: 2021-09-21
Anticipated expiration: 2041-03-17
Also published as: CN113416735B

Abstract

The invention relates to a tobacco germ cell specific high expression gene and application thereof, wherein a nucleotide sequence is shown as SEQ ID NO. 1. The invention identifies and obtains the coding sequence of the gene of the cultivated tobacco and the promoter sequence thereof through genomic informatics analysis. Through analysis of candidate promoter sequence elements and analysis of gene expression profiles, the gene is proved to be a gene with high-abundance expression of germ cells. The promoter sequence of the gene is obtained by cloning, the gene editing vector of the germ cell specific high-abundance expression Cas9 protein is constructed by taking the promoter sequence as a starting element, the vector is transferred into agrobacterium, a transgenic tobacco plant is obtained by a leaf disc transformation method, sequencing analysis of a gene editing target site shows that the PDS gene mutation efficiency of the transgenic tobacco plant is high, and research results have important guiding significance and application value for constructing a high-efficiency plant gene inactivation vector and obtaining the mutant plant.

Description

Tobacco germ cell specific high expression gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a tobacco germ cell specific high-expression gene and application thereof.

Background

The principle of the CRISPR/Cas9 system is to recognize a target site through sgRNA (single-guide RNA) formed by crRNA and tracrRNA and guide Cas9 to perform directional shearing on the target gene, Cas9 is composed of two domains of HNH and RuvC, which are responsible for cutting two strands of DNA to form double-strand break (DSB). While DSBs are repaired mainly by two methods. One is Nonhomologous End Joining (NHEJ), which causes insertions and deletions of bases resulting in loss of gene function. The exact modification of Homologous Recombination (HR) occurs in the presence of the donor DNA template, but with less efficiency. The CRISPR/Cas9 gene editing system is simple in design, easy to operate and low in cost, and obtains the 'pursuit' of scientific researchers and laboratories, so that the CRISPR/Cas9 system is well popularized and developed. In 2013, the CRISPR/Cas9 gene editing system is first successfully transformed into a rice, Arabidopsis, tobacco and wheat protoplast and agrobacterium-mediated Cas9-sgRNA co-skeleton vector. The system is applied to plants such as potatoes, soybeans, corns, barley and the like, and the simultaneous editing of multiple genes is realized in arabidopsis, rice and tobacco.

The CRISPR/Cas9 system is generally integrated into the genome to play a role in plants by agrobacterium-mediated genetic transformation, and the constructed plant gene editing vector is generally used for promoting expression of Cas9 by using the 35S promoter of cauliflower mosaic virus. The existing research results show that the offspring editing efficiency of the conventional gene editing vector is low. In 2015, researchers found that using the YAO gene promoter in arabidopsis to drive Cas9, the mutation efficiency of transgenic arabidopsis in T2 generation reached 40.9% -85.7%, and plants with mutated target genes but no Cas9 embedded appeared in T2 generation. In the same year, researchers used the promoter of oocyte-specific gene EC1.2 in Arabidopsis thaliana to drive Cas9, called EPC (the eg cell-specific promoter-controlled CRISPR/Cas9 system), to efficiently obtain non-chimeric T1-generation mutants of multiple target genes.

Tobacco (Nicotiana tabacum), one of important commercial crops and model plants, has important research value. However, as the cultivated tobacco is an allotetraploid and the genome is huge and complex, when the conventional CRISPR/Cas9 gene editing vector is used for editing, the proportion of chimeric progeny plants is high, the gene editing efficiency is low, and a large amount of manpower, material resources and financial resources are consumed in the application process.

Disclosure of Invention

The invention aims to provide a tobacco germ cell specific expression gene and application thereof, and aims to solve the problems that when the existing CRISPR/Cas9 gene editing vector using conventional 35S as a promoter is used for editing, the chimeric proportion of progeny plants is high, the editing efficiency is low, and a large amount of manpower, material resources and financial resources are consumed.

According to the invention, by constructing the tobacco gene editing vector, the germ cell specific high-expression NtEC1.2-1 gene promoter is used for driving the expression of the Cas9 protein, so that the aims of reducing the ratio of tobacco chimera and improving the gene editing efficiency are fulfilled.

The invention is realized by the following technical scheme:

a tobacco germ cell specific high expression gene, the nucleotide sequence is shown in SEQ ID NO.1, comprises 372 basic groups, is derived from tobacco and is named as NtEC1.2-1.

Preferably, the nucleotide sequence of the promoter of the tobacco germ cell specific high expression gene is shown in SEQ ID NO.2 and comprises 2186 basic groups.

Preferably, the nucleotide sequence of the primer is shown as SEQ ID NO.3 and SEQ ID NO. 4.

Editing the tobacco germ cell specific high expression gene by the gene to obtain the tobacco plant with specific expression.

Preferably, the coding sequence of the tobacco germ cell specific high expression gene is designed with specific quantitative primers, total RNA of each tissue of the tobacco in the full-bloom stage is respectively extracted, cDNA is obtained through reverse transcription, the expression condition of the gene in each tissue of the tobacco is detected by using the cDNA as a template and using a fluorescent quantitative PCR method, the obtained data is used for analyzing the expression condition of the gene in each tissue of the tobacco by using a 2-delta Ct method, and the gene is determined to be specifically expressed in high quantity in genital organs.

Preferably, the nucleotide sequence of the specific quantitative primer required for editing the specific high expression gene of the tobacco germ cell is shown as SEQ ID NO.5 and SEQ ID NO. 6.

Preferably, the promoter of the gene editing tobacco germ cell specific high expression gene is obtained by carrying out gene editing on the tobacco germ cell specific high expression gene, preferably by carrying out gene editing on the tobacco germ cell specific high expression gene by a promoter containing pORE-NtEC1.2-1P: agrobacterium of the GUS vector infects tobacco plants, indicating that the NtEC1.2-1 promoter is specifically expressed in early seeds and ovaries. .

Preferably, the tobacco plants are infected with agrobacterium containing the pORE-NtEC1.2-1-rbcS-E9 knockout vector to obtain transgenic tobacco plants, and mutation detection shows that 4 of 15 transgenic lines are mutated, and the mutation efficiency is 26.7%.

The invention has the beneficial effects that:

the coding sequence and the promoter sequence of the NtEC1.2-1 gene of the cultivated tobacco are identified and obtained through genome informatics analysis. Through the analysis of candidate promoter sequence elements and the analysis of gene expression profiles, NtEC1.2-1 is proved to be a gene with high-abundance expression of germ cells. The promoter sequence of NtEC1.2-1 is obtained by cloning, and the promoter sequence is used as a promoter element to construct a genetic editing vector NtEC1.2-1-Cas9-rbcS-E9 for germ cell specific high-abundance expression of Cas9 protein. The vector is transferred into agrobacterium and a transgenic tobacco plant is obtained by a leaf disc transformation method. Through gene editing target site sequencing analysis, the mutation efficiency of the PDS gene of the transgenic tobacco plant is up to 26.7 percent. The research result has important guiding significance and application value for constructing a high-efficiency plant gene inactivation vector and obtaining a mutant plant.

Drawings

FIG. 1 is a schematic diagram showing the expression of the NtEC1.2 gene in different tissues of tobacco;

FIG. 2 is a clone electrophoresis diagram of tobacco NtEC1.2-1 gene promoter, wherein A is an electrophoresis diagram of a PCR product of the NtEC1.2-1 gene promoter sequence, B is an electrophoresis diagram of a PCR product of an Arabidopsis AtEC1.2 gene promoter sequence, and P represents a promoter;

FIG. 3 is a fluorescent microscope photograph showing promoter activity verification;

FIG. 4 is an electrophoretogram constructed from a promoter vector, wherein A is a GUS vector digested by NheI and NotI in a double-enzyme manner, 1: carrying out enzyme digestion on the GUS vector; 2: an original GUS vector; b is a NheI and NotI double-restriction enzyme digestion promoter sequence; 1,2: the NtEC1.2-1 promoter; 3,4: a control promoter;

FIG. 5 is a PCR identification electrophoretogram of GUS transgenic plants, wherein 1-12 are numbers of different plants;

FIG. 6 is a photograph of transgenic GUS seedling staining;

FIG. 7 is a GUS staining picture of transgenic tissue;

FIG. 8 is an electrophoretogram of a specific promoter knock-out vector construction, wherein A: 1,2 is rbcS-E9 terminator; b: 1 represents the vector pORE-Cas9 after NcoI and NotI cleavage, 2 represents the original vector pORE-Cas9, 4 represents the vector pORE-Cas9-rbcS-E9 after NheI and EcoRI cleavage, and 5 represents

pORE-Cas9-rbcS-E9 original vector.

Detailed Description

The technical solutions of the present invention are described in detail below by examples, and the following examples are only exemplary and can be used only for explaining and illustrating the technical solutions of the present invention, but not construed as limiting the technical solutions of the present invention.

In the embodiments of the present application, those who do not specify a specific technique or condition, and those who do follow the existing techniques or conditions in the field, and those who do not specify a manufacturer or a material used, are general products that can be obtained by purchasing.

The percentage numbers are volume percentages and the ratios are volume ratios unless otherwise specified.

The tobacco variety used in the application is Honghuadajinyuan, a commercialized tobacco variety.

The application provides a tobacco germ cell specific high expression gene, wherein an amino acid sequence of an AtEC1.2 gene of Arabidopsis obtained from NCBI is compared with a tobacco genome database to obtain two homologous candidate genes of AtEC1.2 in tobacco, and the two homologous candidate genes are named as NtEC1.2-1 and NtEC1.2-2. Wherein the nucleotide sequence number of the NtEC1.2-1 is shown as SEQ ID NO.1 and comprises 372 bases.

And performing activity and specificity element analysis on the upstream 2200bp sequences of the compared NtEC1.2-1 and NtEC1.2-2 genes by using a Genomatx online analysis website. The promoters of these two genes were found to contain several unique elements in addition to the promoter core elements TATA box and CAAT box: NtEC1.2-1P and NtEC1.2-2P contain 15 and 9 POLLEN ILAT52(AGAAA) elements, 5 and 7 POLLEN-specific transcription enhance element (TGTGA), 6 and 3 cell division M phase-specific elements (AACGG), respectively. NtEC1.2-1P contains 2 targets of early activator (AACTTAA), which are specific elements related to reproduction or early growth and development, the identification of the elements shows that the obtained sequence is possible to be a reproduction-specific promoter and a promoter of a tobacco germ cell specific high-expression gene is obtained, and the nucleotide sequence is shown as SEQ ID NO.2 and comprises 2186 basic groups.

To further prove that the obtained NtEC1.2-1 and NtEC1.2-2 genes are specifically expressed in reproductive organs, the relative expression of the genes in various tissues of tobacco was quantitatively analyzed.

Firstly, designing specific quantitative primers according to coding sequences of NtEC1.2-1 and NtEC1.2-2 genes, respectively extracting total RNA of an ovary, a style, a filament, an anther, a flower, a root, a stem and a leaf of the tobacco in the full-bloom stage, obtaining cDNA through reverse transcription, taking the cDNA as a template, and detecting the expression conditions of the two genes in 8 tissues of the tobacco by using a fluorescent quantitative PCR method. The obtained data are used for analyzing the expression conditions of the two genes in eight tissues of tobacco by using a 2-delta Ct method. The results after processing were plotted using GraphPad Prism7 software for analysis. As shown in FIG. 1, the NtEC1.2-1 and NtEC1.2-2 genes were expressed in high amounts in anthers, wherein NtEC1.2-2 was expressed in high amounts in comparison with each tissue-specific, while NtEC1.2-1 was expressed in high amounts not only in anthers but also in ovaries, which demonstrates that the above two genes are expressed in high amounts specifically in reproductive organs and are likely to be involved in the reproduction and early development of plants.

Specific NtEC1.2 gene expression profiling:

extraction of Total RNA

Three kinds of tobacco with the same tissue were put into a centrifuge tube and then quickly put into liquid nitrogen, and RNA extraction was performed using an easy pure Plant RNA Kit (from Takara Shuzo Co., Ltd.) (the following operations were performed at room temperature).

(1) And pouring liquid nitrogen into the mortar and the pestle subjected to dry heat sterilization for precooling, and respectively putting the taken tobacco tissue samples into the mortar.

(2) Adding liquid nitrogen, rapidly grinding, immediately adding liquid nitrogen when the liquid nitrogen is about to be completely evaporated, continuously grinding, and repeating the operation for 3-4 times until the sample is powdery. The samples were collected in 1.5mL RNase free centrifuge tubes.

(3) Adding 5 mu L of beta-mercaptoethanol and 500 mu L of BB6, shaking, mixing uniformly, and standing for 3 min.

(4) Centrifuging at 12000 Xg for 5min, sucking the supernatant into a new 1.5mL RNase-free centrifuge tube, adding 0.5 times volume of absolute ethyl alcohol, and turning and mixing uniformly.

(5) The mixture was pipetted into a spin column, centrifuged at 12000g for 30s, and the flow-through was discarded.

(6) Pipetting 500. mu.L of CB6 into a spin column, centrifuging at 12000g for 30s, discarding the flow-through solution, adding 80. mu.L of DNaseI, standing for 15min, adding 500. mu.L of CB6, centrifuging at 12000g for 30s, and discarding the flow-through solution.

(7) Aspirate 500. mu.L of WB6 into spin columns, centrifuge at 12000g for 30s, and discard the flow-through.

(8) This step (7) is repeated once.

(8) Centrifuging at 12000g for 2min, and standing for 2min to volatilize ethanol remained in the centrifugal column.

(9) Absorbing 30 mu L of RNase-free water suspension, adding the suspension into a centrifugal column, standing for 1min, and then centrifuging at 12000g for 2 min. The eluted RNA was stored in a freezer at-80 ℃.

Obtaining of cDNA:

(1) the samples were loaded as follows, and then placed in a PCR instrument at 70 ℃ for 5min in an ice bath for 2 min.

(2) Then the following reagents were added to the system and mixed well, and placed in a PCR instrument at 42 ℃ for 60min and stored at 4 ℃.

Detecting the gene expression level by fluorescent quantitative PCR:

(1) samples were loaded using the miScript SYBR Green PCR Kit (from Qiagen) as follows, three technical replicates per sample, and the following amplification procedure was followed after vortexing.

(2) Lysis curve analysis was performed on the results of the amplification-terminated procedure, followed by use of 2^-ΔΔCtThe method of (3) processes the data and calculates the relative expression level of the gene. The calculated results were plotted, and the expression of the gene in each tissue was analyzed.

The tissue specificity expression verification method of the tobacco reproduction specificity gene EC1.2 comprises the following steps:

uniformly spreading the Nicotiana benthamiana seeds on the surface of moist soil (nutrient soil: vermiculite: 2:1), sealing the opening of a pot with a preservative film with air holes, at 26 ℃, illuminating for 16h, darkness for 8h and humidity for 70%, culturing for one week, keeping the soil moist during the culture period, and transplanting the seeds into a proper pot for continuous culture after the seeds sprout for one week.

Constructing a subcellular localization vector:

) The pBI221-eEFP vector was purchased from the Chongqing magpie company.

(2) pBI 221-eFP plant expression vectors were double digested with SalI-HF and NcoI-HF from NEB. The pBI221-eEFP backbone vector was recovered by gel cutting recovery.

(3) The promoter sequences were amplified by designing a SalI-HF-containing forward specific primer and an NcoI-HF reverse specific primer, respectively.

(4) Samples were applied using Gibson Assembly MasterMix enzyme from NEB as follows, and incubated at 50 ℃ for 30min in a PCR apparatus.

(5) The incubated product was directly transformed into DH 5-. alpha.E.coli and cultured in an inverted culture overnight at 37 ℃.

(6) Selecting a single clone, carrying out PCR amplification by using a specific primer, carrying out preliminary detection by agarose gel electrophoresis, and sending the bacterial liquid of the positive clone to a company for Sanger sequencing.

(7) And extracting the plasmid of the bacterial liquid with the correct sequencing result, and storing the bacterial liquid in a refrigerator at the temperature of 20 ℃ below zero for later use.

GV3101 agrobacterium-mediated transient expression:

the GV3101 Agrobacterium competent cells were taken out from the-80 ℃ freezer and frozen and thawed on ice. 0.5-1 μ g of plasmid was added into a centrifuge tube containing 50 μ L of competent cells, and the steps were performed in the order of ice bath 5min, liquid nitrogen freezing 5min, 37 ℃ water bath heat shock 5min, and ice bath 5 min.

(2) Adding 500 μ L of room temperature SOD liquid culture medium, placing on a constant temperature shaking bed, centrifuging at 28 deg.C for 2min at 6000g after shaking culture for 2-3h, removing supernatant, adding 100 μ L of SOD liquid culture medium, suspending thallus, uniformly coating on YEB plate containing 50mg/L kanamycin, 20mg/L rifampicin, and 40 mg/L gentamicin, placing in 28 deg.C constant temperature incubator, inverting, and culturing in dark place for 2 days.

(3) PCR detection is carried out on a single colony in a flat plate by designing a specific primer, a positive clone is placed in a YEB (Yeb broth) culture medium containing three antibiotics, after the bacterial liquid is turbid, 1mL of the bacterial liquid is inoculated into a 50mLYEB culture medium for further expanded culture for 10h, and the bacterial body is collected by centrifugation at 4 ℃ for 15 minutes at 3000 g.

(4) The collected bacterial liquid was suspended in MS liquid medium to adjust the OD value to 0.6-0.8. Standing in dark at room temperature for 2-3 h.

(5) Ben's tobacco with broad bright green leaves growing around 30d was used for injection.

(6) A1 mL syringe with a needle removed is used for selecting the light green and wide leaves, and the bacterial solution is slowly injected from the leaf back until the bacterial solution infects the whole leaves.

(7) Culturing the injected Nicotiana benthamiana in dark for 8h, culturing in an environment with light for 16h and dark for 8h, and performing fluorescence observation after culturing for 36h-48 h.

Construction of GUS plant expression vector:

) The pORE-GUS vector was maintained for this experiment.

(2) The pORE-GUS plant expression vector was digested with NheI-HF and NotI-HF of NEB, and the backbone vector was recovered by cutting the gel and recovering it.

(3) Specific primer amplification promoter sequences containing the incision homologous arms of the skeleton vector are respectively designed.

(4) Samples were applied using the Gibson Assembly Master Mix enzyme from NEB as follows, and incubated in a PCR apparatus at 50 ℃ for 30 min.

Obtaining of GUS transgenic plant with stable inheritance:

the constructed plasmid is transformed into LBA4404 agrobacterium tumefaciens, and after amplification culture, MS liquid culture medium is used for suspending bacterial liquid for later use.

(2) Leaf beating disc: sterile second of four leaf stage grown in culture bottle is removed in sterilized clean bench and placed on filter paper, and a puncher with specification of 5mm × 5mm is used for selecting green leaves to punch, so as to avoid veins, and collected leaf discs, 50 leaf discs are collected in a group and placed in bottles containing MS liquid culture medium for later use.

(3) Infecting a leaf disc with the agrobacterium tumefaciens heavy suspension: taking out the leaf disc, putting the leaf disc into a new culture bottle, adding the resuspension containing the LBA4404 agrobacterium tumefaciens to ensure that the leaf disc is completely immersed in the resuspension, infecting for 8min, taking out the leaf disc, putting the leaf disc on filter paper, sucking the liquid, putting the leaf disc on an MS solid culture medium by using tweezers, and culturing for two days in dark at 28 ℃.

(4) Induction of callus formation: transferring leaf disc to plant hormone, kanamycin, and carboxybenomycins

On the selection medium of (1). Culturing at 28 deg.C in a greenhouse with 16h light and 8h dark, and replacing the selective culture medium every 14d until callus cell mass is differentiated from leaf disc.

(5) Differentiation of callus into shoots: the formed callus is dispersed and placed in a new selective medium for continuous culture, and buds are differentiated from the callus after two weeks.

(6) Inducing and rooting: cutting off the buds growing on the callus by using a sterile scalpel, inserting the buds into a rooting culture medium, culturing for 10-14 days, and then rooting, thus obtaining sterile regenerated tobacco plants.

GUS transgenic plant identification:

extracting the genome of a transgenic GUS plant, designing a specific primer to perform PCR amplification on the GUS gene, purifying the obtained PCR product by using a PCR product purification kit of a whole gold company (the detailed steps are shown in the kit specification), sending the purified PCR product to a sequencing company for Sanger sequencing, comparing the sequencing result with a GUS gene sequence, and obtaining the GUS transgenic plant corresponding to the successfully compared PCR product. The PCR amplification system and procedure were as follows:

preparing a GUS dye solution:

X-Gluc mother liquor: X-Gluc (5-bromo-4-chloro-3-indole-beta-glucoside) is prepared into 20mM stock solution by using N-N-Dimethylamide (DMF), and the stock solution is subpackaged into 100 mu L of each tube and stored at-20 ℃.

(2) The preparation method of the X-Gluc base liquid comprises the following steps:

GUS staining solution: 50 μ L X-Gluc stock solution +50 μ L base solution.

And (3) GUS plant staining:

(1) seedlings of GUS transgenic plants and buds, flowers, anthers and ovaries of full-bloom stage (meanwhile, plants containing pORE-GUS no-load plasmid in the same growth state are taken as a contrast) are respectively put into a test tube containing GUS staining solution, tissues are ensured to be completely soaked in the staining solution through vacuum infiltration treatment, and the test tube is put into a constant-temperature incubator at 37 ℃ for overnight incubation.

(2) The stained tissue was placed in a 70% ethanol containing solution for decolorization, during which time the ethanol was changed 2-3 times, until our control material appeared white.

(3) The staining conditions of the tissue sites were compared with those of the control group by direct observation with a microscope or the naked eye.

Cloning of the ntec1.2 promoter:

in order to obtain the promoter sequences of the two genes, specific primers are designed according to the predicted sequences of the promoters of the NtEC1.2-1 and NtEC1.2-2 genes respectively, and the two promoter sequences are subjected to PCR amplification by taking tobacco pollen tissue cDNA as a template. Meanwhile, PCR amplification is carried out by taking the promoter of the AtEC1.2 gene of Arabidopsis as a template. The agarose gel electrophoresis results show (figure 2), the above 3 genes promoter band size and prediction of sequence length consistent, wherein Pro: NtEC1.2-1 and Pro: NtEC1.2-2 length is 2118bp and 2201bp respectively. And (3) connecting the PCR product to a TA vector through gel cutting recovery, converting the PCR product to DH-5 alpha escherichia coli, selecting monoclones to perform colony PCR primary detection after kanamycin resistance screening, sending the positive monoclonal bacteria liquid to a company for sequencing, and performing Blast comparison on a sequencing result and an obtained database sequence, wherein the sequence is consistent. The correct plasmid was stored in a-20 ℃ freezer.

The method comprises the following specific steps:

(1) selecting about 100mg of wild type tender green tobacco leaves, adding liquid nitrogen, fully grinding in a mortar, putting into a 1.5mL centrifuge tube, adding 250 mu L RB1 and 15 mu L RNase A, and shaking to fully and uniformly mix. Incubating in 55 deg.C water bath for 15 min. Centrifuging at 12000g for 15min, sucking supernatant into a new centrifuge tube, adding 100 μ L PB1, mixing, ice-cooling for 5min, and centrifuging at 12000g for 5 min. Sucking the supernatant into a clean centrifuge tube, adding 375 mu L of BB1 containing absolute ethyl alcohol, mixing uniformly, adding into a centrifugal column, centrifuging at 12000g for 30s, and discarding the effluent. Then 500. mu.L of CB1 was added and 12000g was centrifuged for 30s and the effluent was discarded. Add 500. mu.L of WB1, centrifuge at 12000g for 30s and discard the effluent. Then 12000g was left to air-separate for 2min, and the column was put into a new 1.5mL centrifuge tube, left at room temperature for one minute, and ddH at 65 ℃ was added₂And standing the mixture at room temperature for one minute, centrifuging the mixture at 12000g for 1min, and obtaining the liquid eluted at the bottom of the centrifuge tube, namely the tobacco genome.

(2) Designing a specific primer, and carrying out PCR amplification on the predicted promoter by using high-fidelity enzyme, wherein an amplification system and a program are as follows:

(2) the PCR product was recovered by tapping and ligated to pEASY-T5 vector, which was transformed into DH-5. alpha. E.coli, recovered at 37 ℃ for 40min and spread on LB plate containing kanamycin, and inverted at 37 ℃ and protected from light overnight for culture.

(3) Single clones were picked from the plates and subjected to PCR using M13F/R universal primers, the amplification system and procedure were as follows:

(4) and (3) carrying out agarose gel electrophoresis on the PCR product, and sending the bacterial solution or the PCR product with the band size matched with the cloned promoter sequence size to a sequencing company for Sanger sequencing. Performing Blast comparison on the sequencing result and a promoter sequence obtained from a database, performing amplification culture on a bacterial solution with a completely correct comparison result, extracting plasmids, and storing in a refrigerator at the temperature of-20 ℃ for later use. Thus, a tobacco endogenous EC1.2 promoter was obtained.

Constructing an eGFP plant expression vector containing a reproduction-specific promoter:

a forward primer containing a SalI enzyme cutting site and a framework vector homologous arm and a reverse primer containing an NcoI enzyme cutting site and a framework vector homologous arm are designed to specifically amplify a promoter sequence, a pBI 221-eFP plant expression vector is subjected to double enzyme digestion by SalI-HF and NcoI-HF, and the framework vector is recovered. The promoter was constructed into PBI221-eGFP vector using the principle of seamless cloning using Gibson Assembly Master Mix enzyme from NEB.

In order to investigate whether the cloned promoter is active, the constructed eGFP plant expression vectors PBI221-NtEC1.2-1-eGFP, PBI221-NtEC1.2-2-eGFP and PBI221-35S-eGFP are transferred into the GV3101 Agrobacterium by a chemical transformation method. After the positive agrobacterium colony is subjected to amplification culture, adjusting the OD value of a bacterial liquid to 0.6-0.8 by using an MS liquid culture medium, standing in the dark for 2-3h, and then sucking proper bacterial liquid by using a 1mL injector to perform slow injection from the leaf back of the Nicotiana benthamiana until the whole leaf is completely impregnated with the bacterial liquid. In order to obtain more reliable results, each bacterial fluid is injected into three leaves of a Nicotiana benthamiana strain, the leaves are marked by using labels, the Nicotiana benthamiana strain is placed in a dark environment for culturing for 8 hours after the injection is finished, and then the tobacco is normally cultured. After the infection for 36-48h, different leaves are taken and placed under a fluorescence microscope for observation, and the result shows that compared with a control group (35S: eGFP), all 2 experimental groups have green fluorescence signals. The appearance of green fluorescence in the experimental group indicates that the eGFP fluorescent protein is expressed, and 2 cloned reproductive-specific promoters are proved to be active, which is shown in FIG. 3.

To verify that the cloned promoter is not only active but also specifically expressed, pORE-NtEC1.2-1P: GUS and pORE-NtEC1.2-2P: GUS plant expression vectors were constructed. Firstly, specific primers are respectively designed to clone a promoter to obtain NtEC1.2-1P and NtEC1.2-2P sequences containing NheI enzyme cutting sites and NotI enzyme cutting sites (figure 4), a pORE-GUS plant expression vector and a cloned promoter are subjected to double enzyme cutting by using NheI-HF enzyme and NotI-HF enzyme of NEB company respectively (figure 4), gel cutting and recovery are respectively carried out, and a vector framework (pORE-GUS) and fragments (NtEC1.2-1P and NtEC1.2-2P) are connected by T4 ligase. The connecting product is transformed into an escherichia coli competence by a chemical transformation method, after an LB plate containing kanamycin is used for culture, a monoclonal colony is picked, a specific primer is used for detection, a possible positive colony is selected for sequencing according to an agarose gel electrophoresis result, and a bacterial liquid with a correct sequencing result is extracted to obtain a plasmid. Storing in a refrigerator at-20 deg.C for use.

Obtaining pORE-GUS transgenic tobacco plants: and (3) mixing the constructed pORE-NtEC1.2-1P: GUS and pORE-NtEC1.2-2P: GUS plant expression vectors are respectively transformed into LBA4404 agrobacterium, after screening culture by an anti-microbial culture medium, positive monoclonal is selected for amplification culture, MS liquid culture medium is used for suspending bacterial liquid, the OD value of the bacterial liquid reaches 0.6-0.8, the bacterial liquid is placed in darkness at room temperature for 2-3h, then the bacterial liquid is poured into a glass bottle containing a leaf disc, the leaf disc is completely immersed in the leaf disc, after the bacterial liquid is infected for 8min, filter paper is used for sucking dry the liquid, the leaf disc is placed into MS solid culture medium for co-culture for 2d, the leaf disc is transferred into culture medium containing kanamycin and carbenicillin for selective culture, the culture medium is replaced during the period until the leaf disc is dedifferentiated to form callus, the callus is trimmed and then continuously cultured until the callus is differentiated into buds, and the buds are cut off and placed into a rooting culture medium for culturing until the buds grow. Extracting leaf genome of the rooting plant, performing PCR amplification of GUS gene sequence by using specific primers, carrying out agarose gel electrophoresis primary detection, sending the obtained product to a company for sequencing, carrying out Blast comparison on a sequencing result and a database sequence, and obtaining a plant with correct comparison, namely a transgenic GUS tobacco plant (figure 5).

Taking pORE-NtEC1.2-1P: GUS, pORE-NtEC1.2-2P: seedlings of GUS plants and buds, flowers, anthers and ovaries in full-bloom periods (wild plants in the same growth state are taken as controls at the same time) are respectively placed into prepared GUS staining solution, because the tissues of tobacco are thick and difficult to stain, the buds are longitudinally cut into two halves, a needle tube with a needle removed is used for extracting air in a test tube, so that the staining solution completely permeates into the tissues of the tobacco, and the two halves are placed into a constant-temperature incubator at 37 ℃ for overnight incubation. And (3) decolorizing each incubated tissue by using 75% absolute ethyl alcohol for 2-3 times until the staining of a control group is completely removed. And then observed with a microscope and directly with the naked eye, respectively. It was found that compared to the control group, pORE-NtEC1.2-1P: GUS and pORE-NtEC1.2-2P: seedlings of transgenic GUS plants were all white. The results indicated that the GUS gene was not expressed or very low expressed in seedlings, further indicating that the NtEC1.2-1P and NtEC1.2-2P promoters were not expressed at the seedling stage (FIG. 6). Whereas in the case of the bud and seed staining, pORE-NtEC-1.2-1P: the ovary of the seed and bud section of GUS experimental group plants appeared obviously blue, while the color of pORE-NtEC1.2-2P: the GUS experimental group showed no coloration at the seed and bud ovary or a very light blue color at the seed petiole, and the results indicate that the NtEC1.2-1 promoter is specifically expressed in the early seed and ovary, and the expression level is high in terms of the degree of staining. And pORE-NtEC1.2-2P: GUS plants showed no apparent staining at early seed and ovary, indicating that the NtEC1.2-2 promoter was not expressed at early seed stage and ovary or expressed at other stages (FIG. 7).

Constructing a specific promoter knockout vector and detecting editing efficiency:

first, the T5 vector containing the promoter sequences of NtEC1.2-1 and NtEC1.2-2 was used as a template to amplify the promoter sequences of NtEC1.2-1 and NtEC1.2-2 with specific primers, respectively. Next, the company synthesized rbcS-E9 terminator fragment was amplified with a specific primer. The pORE-Cas9 vector was digested with NcoI and NotI, and the original NOS terminator in the vector was replaced with the rbcS-E9 terminator of our clone by T4 ligase. The pORE-Cas9-rbcS-E9 vector was digested with NheI and EcoRI, and the original 35S promoter was replaced with the cloned NtEC1.2-1 and NtEC1.2-2 promoters using T4 ligase to drive expression of Cas 9. Thus, pORE-NtEC1.2-1-rbcS-E9, pORE-NtEC1.2-2-rbcS-E9 knock-out vector constructs were completed. Meanwhile, pORE-AtEC1.2-rbcS-E9 vector was constructed in the same manner as a control plasmid, and the structural diagram is shown in FIG. 8 below.

The constructed pORE-NtEC1.2-1-rbcS-E9, pORE-NtEC1.2-2-rbcS-E9 and a control plasmid pORE-AtEC1.2-rbcS-E9 are subjected to agrobacterium-mediated genetic transformation and tissue culture technology to obtain T0 generation transgenic plants. Used herein is YEB-resistant medium containing rifampicin (Rif), streptomycin (Str) and kanamycin (Kan). The T0 generation transgenic plant is obtained by agrobacterium mediated genetic transformation and tissue culture such as leaf disk beating, agrobacterium infection, agrobacterium co-culture, selective culture, rooting culture and the like. Positive detection was performed on the plants with specific JC-F. Plants obtained by each transformation knockout vector are one strain, and 20 transgenic positive plants are detected for each of the three strains.

Obtaining transgenic plants of T1 generation:

the harvested T0 generation seeds of 3 groups of transgenic tobacco (pORE-NtEC1.2-1-rbcS-E9, pORE-NtEC1.2-2-rbcS-E9, pORE-AtEC1.2-rbcS-E9) were soaked with 75% alcohol for 30s in the seeds of T0 generation transgenic plants, and then sterilized ddH was added₂Washing with O for 2-3 times, soaking in 5% sodium hypochlorite for 8min, shaking for 2-3 times, and sterilizing with ddH₂O washing for 2-3 times, pouring into filter paper, sucking water, sterilizing, and placing in MS solid containing kanamycinOn the culture medium, the plate was sealed with a sealing film, and placed in a greenhouse at 26 ℃ under light for 16h and dark for 10 h. After about 7 days, the seeds germinate and grow sprouts, and when the sprouts grow to 1-2cm, the sprouts are respectively transplanted into a large glass bottle containing an MS solid culture medium containing kanamycin to continue culturing. After resistance screening, randomly selecting each group of plants, extracting genomes of the plants, carrying out PCR amplification on a sgRNA scaffold sequence through a specific primer, carrying out agarose gel electrophoresis initial identification, then sending positive bacteria to a company for sequencing, carrying out Blast comparison on sequencing results, and screening out transgenic plants of each group of tobaccos. 20 strains of pORE-NtEC1.2-1-rbcS-E9 and pORE-NtEC1.2-2-rbcS-E9 are detected, the detected transgenic plants are 16 strains and 19 strains respectively, and the transgenic positive rate is 80 percent and 95 percent respectively. 25 strains of pORE-AtEC1.2-rbcS-E9 strain are detected, 21 transgenic strains are detected, and the transgenic positive rate is 84%.

Mutation detection of T1 transgenic plants:

and respectively extracting the genomes of the transgenic strains with positive detection results, and detecting sgRNA and gRNA scaffold gene segments in the genome of the leaf by using detection primers JC-F and U26-R to identify whether the tobacco is a transgenic plant. Amplifying a tobacco PDS gene sequence by using a forward primer 5'CTGAAGCAGTCACCAAGAAT 3' and a reverse primer 5 'AGCTATCTGATTAATGGACAAA 3', carrying out PCR amplification, cutting and recovering a PCR product, connecting the PCR product to a T vector, carrying out conversion and plate coating, selecting a monoclonal antibody, carrying out agarose gel electrophoresis primary detection, and sending a sample with a strip size matched with an amplified fragment to a company for sequencing detection. The detection result is subjected to Blast comparison with a PDS gene sequence, and the result shows that 4 strains are mutated in the 20 detected pORE-AtEC1.2-rbcS-E9 transgenic strains, the mutation efficiency is 20 percent, and the mutation forms are all the deletion of bases. 4 of 15 detected pORE-NtEC1.2-1-rbcS-E9 transgenic strains are mutated, the mutation efficiency is 26.7%, and the mutation forms are deletion and insertion of bases. 1 of the 20 pORE-NtEC1.2-2-rbcS-E9 transgenic strains tested has mutation, the mutation efficiency is 5 percent, the mutation form is the replacement of basic groups, and the mutation information is shown in Table 1.

TABLE 1 statistical table of mutation information of transgenic plants in T1 generations

Wherein the darkened letters represent the PAM region, the italic letters and dots represent the deletions, insertions and substitutions of bases. The foregoing shows and describes the general principles, essential features, and advantages of the invention.

It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are given by way of illustration of the principles of the present invention, and that various changes and modifications may be made without departing from the spirit and scope of the invention as defined by the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> tobacco industry Limited liability company in Yunnan

<120> tobacco germ cell specific high expression gene and application thereof

<130> WPM210175

<140> 2021102866437

<141> 2021-03-17

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 372

<212> DNA

<213> Artificial sequence (NtEC1.2-1)

<400> 1

atggctcctt tcaaacttcc attagtactt ttaatctcgt ggcttctgac aacaacaacg 60

gcaataaact tgtccaaaat gaaactagga caagacattg ttgctagact tcaactcgga 120

gaaggtagca tgccagtgtg ctggaatgca ttatttgaga taaaatcatg cacgaatgag 180

atcatacttt tcttcttcaa tggcgaatct tatttaggga ggaaagattg ttgtaaggct 240

attagaacta ttacttataa ctgttggcct tctatgctta cttccattgg ttttactgct 300

gaggaagttg atattctacg tggttattgt ggaactccat cacctcaacc tgctgtggcc 360

attaaagttt aa 372

<210> 2

<211> 2186

<212> DNA

<213> Artificial sequence (NtEC1.2-1 promoter)

<400> 2

ataataggtg gaggaggacg ggtaacaggt ctgggtcggg gagccggagg aagagtagta 60

gcttggctac tagattcacc aattttagat tttcccttac ccttaccacc aaaaatattt 120

tttaaagaaa atgccatatt aattataatt atactaaata aaactaacaa aactataata 180

ttaaaactta agagttggaa cgagtttacc gaattgacga acaacttctt gaaaattgaa 240

tatcgttgaa gacttgaata cttcaattca ccaacttcac aatttttcac gaaattgcaa 300

taataaagta agcaattata gaagaaaatt agagagagat tgatgaattt gtgagtaaaa 360

atgaaagaat ggggggtatt tatagttgag aattgagaaa aagtgtaatt ataaaaagtt 420

tggggttaaa gcaaagtttg ggggccaaat ggctattttt taaagtgccc aacggataga 480

ttttgaaggc caacggctag attttaaaaa tctgaccgtt ggtctttttt ttaaaattag 540

ccgttggagc ctgttaggcc tgttgggccc ggttgaaccg gcccaggccc gcctgccggt 600

cccgggttca cgggctattt gtgttgaact ggcccaccac gagcttttgc accactagag 660

cccaggcctg gttgaaccag cccgtttggc ccgcggtcct gggccaggcc cgggccacaa 720

tacagcctta tatggaactc ctgcgtttaa acttccagaa tattatgttg gaacttcagc 780

acattatgct gaaatctcat atgtaaaaaa ttcgaactcc agcatattat gctggaatat 840

ttccgtattt ttaagggtgt ttttgttcaa attttatctt tacaagaaaa atgtctaaat 900

ttcgattact tttgaaactt tgactatttt tcaattacca atttaaatct agttagtttt 960

tattttttct cgaattcaac agattgctat ccaatctaac atgggccaat ccaaactata 1020

ctcttgattc aagtcaaacc aaacactcag gctggtcata agttacgaat cttgtgttca 1080

actgttcata ccggatgccg ataatcccct agtcaccaga aaacgagaat aacaatgcag 1140

aaattttcaa atgaaaatgg aataacaata ataaataaag actatttcaa gtgaatacac 1200

tctaatgaat aatataagaa gaatattttg ggcagtcttt tctaggtgaa tctctcccat 1260

aaaaaaaaaa ggaatctgtc gcatcccatt tttgcgggat ttcaaaagtt atcgtcagtt 1320

ggaactttga atcggttcct tttcaattta attggagctt tgattctcac ccttcccctt 1380

tttgtttttt cttttattta ttattgggtg gggagggaga aggttcttga tttggttggc 1440

catgaattat agaaacaaat ctaagtaaag caaatggttt taattaattt tctcgtttca 1500

atcttttatg acttagctgg tagttaaact aagatgatat aataaatttt tatactttat 1560

gtagcaaaga gaaaggtaca agaatttgct caaaatacta aagctagaat ttggattgcc 1620

tctgcagtgg attttctttt agatatgtga tgtctaaatt tgaaatatct tttgctcaac 1680

gcaataaaag aaataaagga aaagtgtgaa aatactagta ctatttttta gctccgtttg 1740

agatattaac attttaagtg ctatcatatt ataaaagacg tttcaattat aggcagagat 1800

aaaatactag tttaggttgg aactagtcta aaataagtac agtattaatt aagttaggta 1860

tctacacata taattccttt tggtgatcat agctagctgt actatgattg gattcctttt 1920

ttaattatcc aaaacgttac gttgattaat atttctatca gacaaaatga atctttgatt 1980

atatttctaa cttttcacat tccacatata ttaactcata aattaaattt attaaaggta 2040

tatcaaattc ttaattaatt ctgccccttc aacttacatc agttacactc tctatagctt 2100

actctacaac ctataaatca ccatgtccaa accttcattt ccttcaccat aacgcactct 2160

acacatattc tacactacat ttcaag 2186

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence (NtEC1.2-1 primer)

<400> 3

aacctgcagg ataataggtg gaggaggacg 30

<210> 4

<211> 33

<212> DNA

<213> Artificial sequence (NtEC1.2-1 primer)

<400> 4

gctctagact tgaaatgtag tgtagaatat gtg 33

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence (NtEC1.2-1 specific quantitative primer)

<400> 5

ggcgccccgc ggaaagcttg ataataggtg gaggaggacg 40

<210> 6

<211> 45

<212> DNA

<213> Artificial sequence (NtEC1.2-1 specific quantitative primer)

<400> 6

ggccgcaaag tcgacgaatt cttgaaatgt agtgtagaat atgtg 45

Claims

1. A tobacco germ cell specific high expression gene is characterized in that a nucleotide sequence is shown as SEQ ID NO. 1.

2. The tobacco germ cell specific high expression gene according to claim 1, wherein the promoter of the tobacco germ cell specific high expression gene has a nucleotide sequence shown in SEQ ID No. 2.

3. The tobacco germ cell specific high expression gene of claim 1, wherein the nucleotide sequence of the primer is shown in SEQ ID No.3 and SEQ ID No. 4.

4. The tobacco germ cell specific high expression gene according to claim 3, wherein the nucleotide sequence of the specific quantitative primer required by the tobacco germ cell specific high expression gene is shown as SEQ ID No.5 and SEQ ID No. 6.

5. The tobacco germ cell specific high expression gene according to claim 1, wherein the coding sequence of the tobacco germ cell specific high expression gene is designed with specific quantitative primers, total RNA of each tissue of tobacco in full-bloom stage is extracted respectively, cDNA is obtained by reverse transcription, the expression condition of the gene in each tissue of tobacco is detected by using the cDNA as a template and a fluorescent quantitative PCR method, and the obtained data is used for analyzing the expression condition of the gene in each tissue of tobacco by using a 2-delta-Ct method to determine that the gene is specifically expressed in high amount in reproductive organs.

6. The tobacco germ cell-specific high-expression gene according to claim 2, wherein the promoter of the tobacco germ cell-specific high-expression gene is expressed by a promoter containing port-ntec 1.2-1P: agrobacterium of GUS vector infects tobacco plant, and GUS display of the obtained transgenic tobacco plant shows that the NtEC1.2-1 promoter is specifically expressed in early seed and ovary.

7. The use of a tobacco germ cell-specific high-expression gene, wherein the promoter of the tobacco germ cell-specific high-expression gene according to any one of claims 1 to 6 is used to obtain a tobacco plant with specific high expression mediated by the promoter.

8. The application of the tobacco germ cell specific high expression gene as claimed in claim 7, wherein the specific high expression promoter in the tobacco germ cell can mediate the specific high expression of the gene editing vector in the tobacco germ cell, thereby obtaining a transgenic tobacco plant with specific high expression and improving the gene editing efficiency.

9. The application of the tobacco germ cell specific high expression gene according to claim 7, wherein an editing vector pORE-NtEC1.2-1-rbcS-E9 for knocking out germ cell specific expression of a target gene PDS is constructed.

10. The vector constructed according to claim 9, wherein the agrobacterium containing the knockout vector infects tobacco plants to obtain transgenic tobacco plants, mutation detection shows that 4 of 15 detected pORE-NtEC1.2-1-rbcS-E9 transgenic lines are mutated, and the mutation efficiency is 26.7%.