CN102465128A - Anther specific expression promoter and application thereof - Google Patents
Anther specific expression promoter and application thereof Download PDFInfo
- Publication number
- CN102465128A CN102465128A CN2011103601232A CN201110360123A CN102465128A CN 102465128 A CN102465128 A CN 102465128A CN 2011103601232 A CN2011103601232 A CN 2011103601232A CN 201110360123 A CN201110360123 A CN 201110360123A CN 102465128 A CN102465128 A CN 102465128A
- Authority
- CN
- China
- Prior art keywords
- polynucleotide
- gene
- plant
- promotor
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to an anther specific expression promoter and an application thereof. The promoter which can express the specificity in the plant anther is separated at the first time. The promoter can direct the specific high expression of a target gene in the plant anther and direct low expression or no expression in other tissues of the plant.
Description
Technical field
The invention belongs to biotechnology and phytology field; More specifically, the present invention relates to a kind of flower pesticide specific expression promoter and application thereof.
Background technology
The mankind pass through selection and the utilization to spontaneous mutation gene and recombinant chou, the kind of crop are improved the history in existing nearly thousand.In the last hundred years, adopt the method for artificial hybridization usually, realize the reorganization of excellent genes and the importing cultivation crop new variety of foreign gene.A transgenosis in crossbreeding technology can be realized kind, still, then there is obstacle in the transgenosis between the sibship kind far away; On the other hand, certain gene can not accurately selected and handle to crossbreeding technology, therefore, increased breeding result's complicacy.
Carry out the seed selection of crop varieties through genetically modified means, it is advantageous that transgenic does not receive the restriction of sibship between organism, from genetically modified technical standpoint, the gene source that the candidate transforms is restricted hardly; Therefore, the inventor can be through the various effective genes of genetically modified means polymerization, cultivate high yield, high-quality, degeneration-resistant crop new variety.On the other hand, the operated gene with transfer of transgenic technology is the gene of definite functions, controlled target proterties, and therefore, the phenotype of transgenic progeny has more predictable.At present, transgenic technology has become the important means of improvement of crop cultivar, and the cultivated area of genetically engineered soybean, corn, cotton and rape has reached 25% (James, 2005 of 4 kinds of total cultivated areas in the crop whole world; Sankula et al., 2005).
In the transgenic of plant, need two essential elements, i.e. promotor and goal gene.Promotor is the cis regulating and controlling sequence that is positioned at the genetic transcription initiation site upper reaches, combines with the recognition factor of trans-acting, and through the interaction of recognition factor and RNA polymerase, the transcribing of promotor gene; Therefore, promoter regulation expression of gene pattern, promptly the space-time specificity of destination gene expression and the intensity of expression are one of key factors of transgenic success or failure or effect height.
Different to genetically modified purpose, the expression pattern that the gene Selection of conversion is different mainly comprises composing type high expression level, tissue specific expression and inducible expression etc.As in farm crop such as cotton, corn, paddy rice, changing bacillus thuringiensis (Bacillus thuringiensis over to; What pest-resistant albumen Bt) adopted is the mode of composing type high expression level; High dosage is expressed the pest-resistant proteic advantage of Bt and is that high dosage can guarantee parasiticidal effect in crop, helps prolonging the pest-resistant proteic validity period of Bt simultaneously.In the initiative process of golden paddy (Golden rice), its target is through in paddy endosperm, having introduced the route of synthesis of vitamin A precursor, thus in rice enhanced vitamin A, solve the problem of vitamin A nutritive deficiency; Therefore, the promotor that adopts during transgenic is the gluten promotor of specifically expressing in paddy endosperm.In the conversion of plant disease resistance genes, often adopt the pathogenic bacterium inducing expression promoter.
Along with transgenic crop is promoted in the big area in the whole world, the importance of promotor in transgenic is known together widely, and the inventor needs dissimilar promotors to help the inventor that the solution of transgene expression pattern is provided.For example, in the research field of rice tissue specific promoter, what people paid close attention to the most is the special promotor of flower pesticide.Rice Anther is the organ that rice male gamete pollen produces, and is closely related with the output of growth, breeding and the paddy rice of paddy rice fringe etc.
Therefore, this area needs further research plants flower pesticide specificity expression promoter, to be used for reaching the purpose of breed improvement in more specific expressed functional genes of flower pesticide or structure gene.
Summary of the invention
The object of the present invention is to provide a kind of flower pesticide specific expression promoter and application thereof.
In first aspect of the present invention, a kind of isolating polynucleotide (promotor) are provided, described polynucleotide:
(a) be positioned at osigcfa001g12 gene (GenBank accession number: the 5 ' end and the upper reaches thereof CT833313);
(b) base length is 200-2000;
(c) have necessary site and the transcripting start point that initiation is transcribed; And
(d) has specifically expressing function in plant anther.
In a preference of the present invention, described osigcfa001g12 gene source is in grass; More preferably derive from paddy rice (Oryza Sativa).
In a preference of the present invention, (a) in, be positioned at the 100th of osigcfa001g12 upstream region of gene-1000 to coding region.
In another preference of the present invention, described polynucleotide are:
(1) polynucleotide of the nucleotide sequence shown in the 1-521 position among the SEQ ID NO:1;
(2) polynucleotide of the nucleotide sequence shown in the 1-552 position among the SEQ ID NO:1;
(3) polynucleotide of (1) or (2) arbitrary qualification, wherein 1-22 bit base disappearance (that is: polynucleotide of the nucleotide sequence shown in the 23-552 position among the SEQ ID NO:1; Or: the polynucleotide of the nucleotide sequence shown in the 23-521 position among the SEQ ID NO:1);
(4) polynucleotide that constitute by the nucleotide sequence shown in (1-22)～(521-552) position among the SEQ ID NO:1;
(6) nucleotides sequence is listed under the stringent condition and can hybridizes and have the polynucleotide that instruct goal gene specifically expressing function in plant anther with the polynucleotide sequence of the arbitrary qualification in (1)-(4);
(7) polynucleotide sequence of nucleotide sequence and the arbitrary qualification in (1)-(4) has more than 80% (preferably more than 85%; More preferably more than 90%; More preferably more than 95%; More preferably more than 99%; ) homology and have the polynucleotide that instruct goal gene specifically expressing function in plant anther; Or
(8) the complete complementary polynucleotide of polynucleotide sequence of nucleotide sequence and the arbitrary qualification in (1)-(4).
In another preference of the present invention; Described polynucleotide are: based on nucleotide sequence shown in the 1-552 position among 1-521 position or the SEQ ID NO:1 among the SEQ ID NO:1; 436-442 position, 146-153 position, 278-283,305-311 position and/or 287-312 position (26bp) nucleotide sequence are constant, and the polynucleotide sequence of other site and the arbitrary qualification in (1)-(4) has 50% (preferably 60%; More preferably 70%; More preferably 80%; More preferably 90%; More preferably 95%; Above homogeny more preferably 99%), and instruct the polynucleotide of goal gene specifically expressing function in plant anther.
In another preference of the present invention; Described polynucleotide are: based on nucleotide sequence shown in the 1-552 position among 1-521 position or the SEQ ID NO:1 among the SEQ ID NO:1; 99-104 position, 115-120 position and/or 131-138 position nucleotide sequence are constant, and the polynucleotide sequence of other site and the arbitrary qualification in (1)-(4) has 50% (preferably 60%; More preferably 70%; More preferably 80%; More preferably 90%; More preferably 95%; Above homogeny more preferably 99%), and have the polynucleotide that instruct goal gene specifically expressing function in plant anther.
In another preference of the present invention, described plant is a monocotyledons.
In another preference of the present invention, described plant includes, but is not limited to: grass, amrallid, liliaceous plant, irides or Dioscoreaceae plant etc.
Preferred, described plant is a grass.For example said plant includes but not limited to: paddy rice, wheat, barley, corn, Chinese sorghum etc.
In another aspect of this invention, the purposes of described polynucleotide is provided, is used for instructing goal gene at the plant anther specifically expressing.
In another aspect of this invention, a kind of carrier is provided, described carrier contains described polynucleotide, as promoter element.
In a preference of the present invention, described carrier also contains and described polynucleotide operability purpose of connecting gene.
In another preference of the present invention, described goal gene is a structure gene.
In another preference of the present invention, described goal gene codified has the albumen of specific function.
In another preference of the present invention, described goal gene is a foreign gene.
In another preference of the present invention; Described goal gene includes, but is not limited to: cytotoxic group is because of (Cytotoxic gene), as comes from rnase (Barnase) gene of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) or connect ribonuclease T1 (RNase T1) gene that comes from aspergillus tubigensis (Aspergillus oryzae); Influence the DYT1 gene that flower pesticide suede adhesion coating function and pollen form in the Arabidopis thaliana, ABORTED MICROSPORE gene (AMS) and MALE STERILITY 1 gene (MS1) etc.; Influence the MULTIPLE SPOROCYTE1 gene (MSP1) that suede adhesion coating function and pollen form in the paddy rice, OsTDL1A gene, UNDEVELOPED TAPETUM gene (OsUDT1) and TAPETUM DEGENERATION RETARDATION gene (OsTDR) etc.
In another preference of the present invention, described goal gene is positioned at the downstream of said polynucleotide, and with the interval of said polynucleotide less than 1000bp.Preferably, less than 500bp; Preferred, less than 100bp; Most preferred, less than 50bp.
In another aspect of this invention, a kind of genetically engineered host cell is provided, described cell:
Contain described carrier; Or
Be integrated with the described polynucleotide of external source in its genome.
In another aspect of this invention, a kind of method that makes goal gene specifically expressing in plant anther is provided, described method comprises:
With the construction transformed plant cells, described construction contain described polynucleotide and with described polynucleotide operability purpose of connecting gene;
Filter out and changed the vegetable cell that is integrated with said construction in said construction or the karyomit(e) over to; With
With said vegetable cell regeneration plant.
In another preference of the present invention, described method comprises:
(a) Agrobacterium of carrying expression vector is provided, contains construction in the said expression vector, described construction contain described polynucleotide and with described polynucleotide operability purpose of connecting gene;
(b) vegetable cell, tissue or organ are contacted with Agrobacterium in the step (a), thereby make described construction change vegetable cell over to.
In another preference of the present invention, said method also comprises:
(c) select vegetable cell, tissue or the organ that has changed said construction over to; And
(d) vegetable cell, tissue or neomorph in the step (c) are become plant.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown pcr amplification Totomycin sequence (gene that is used for resistance screening in the transgene carrier), identifies whether contain the electrophoresis result that T-DNA inserts in the transgenic paddy rice seedling.M, DNA Marker DL2000 (dna molecular amount standard); The 1-12 representative comes from the qualification result of the different transfer-gen plants of different transgenic lines (lines).
Fig. 2 has shown the variant painted result of gus reporter gene that organizes in the promotor transgenic paddy rice.Wherein:
A, the GUS dyeing in the rice young panicle;
B, the GUS dyeing during the paddy rice grain husk is spent;
C, with figure B be the same stage, two clever shells (inner glume and coetonium) strip off of grain husk flower is come, the arrow indication be the special anther tissue of dying blueness;
D, the GUS dyeing during the paddy rice grain husk is spent; A, flower pesticide; S, column cap; O, ovary.
E, the GUS dyeing of the grain husk flower after blooming;
F is the same stage with scheming E, and two clever shells of grain husk flower are peeled off, shows the dyeing of stamen and gynoecium; A, flower pesticide; S, column cap; O, ovary.
G is the same stage with scheming E, and the flower pesticide part of amplification shows flower pesticide dyeing;
H is the same stage with scheming E, shows pollen staining;
I, the GUS dyeing of root;
J, the GUS dyeing of blade;
K, the GUS dyeing of leaf sheath, the tip of a leaf, auricle;
L, the GUS dyeing of stem;
Among the figure, the scale among G, the H is 100 μ m, and the scale among other figure is 1mm.
Fig. 3 has shown GUS coloration result in the flower pesticide section, and blueness shows that GUS dyeing is positive.A, flower pesticide; T, the suede adhesion coating; L: clever shell; E, epidermis; MC, maiotic cell.
Fig. 4 has shown the column diagram of gus gene quantitative result of special high expression level in fringe.
The variant painted result of gus reporter gene that organizes in Fig. 5, the M1 promotor transgenic paddy rice.
A, the GUS dyeing of root; B, the GUS dyeing of blade; C, the GUS dyeing of leaf sheath, the tip of a leaf, auricle; D, the GUS dyeing of stem; E, the GUS dyeing of flower.Scale among the figure is 1mm.
The variant painted result of gus reporter gene that organizes in Fig. 6, the M2 promotor transgenic paddy rice.
A, the GUS dyeing of root; B, the GUS dyeing of blade; C, the GUS dyeing of leaf sheath, the tip of a leaf, auricle; D, the GUS dyeing of stem; E, the GUS dyeing of flower.Scale among the figure is 1mm.
The variant painted result of gus reporter gene that organizes in Fig. 7, the M3 promotor transgenic paddy rice.
A, the GUS dyeing of root; B, the GUS dyeing of blade; C, the GUS dyeing of leaf sheath, the tip of a leaf, auricle; D, the GUS dyeing of stem; E, the GUS dyeing of flower.Scale among the figure is 1mm.
The variant painted result of gus reporter gene that organizes in Fig. 8, the M4 promotor transgenic paddy rice.
A, the GUS dyeing of root; B, the GUS dyeing of blade; C, the GUS dyeing of leaf sheath, the tip of a leaf, auricle; D, the GUS dyeing of stem; E, the GUS dyeing of flower.Scale among the figure is 1mm.
The GUS quantitative result of Fig. 9, promotor and clipped form thereof.
Embodiment
The inventor is through extensive and deep research, is separated to can be in a plant anther specific expressed promotor first.Described promotor can instruct goal gene specificity overexpression in plant anther, expresses or does not express and in other tissue of plant, hang down.
Term
As used herein, described " plant " mainly is meant monocotyledons, includes, but is not limited to: grass, amrallid, liliaceous plant, irides or Dioscoreaceae plant etc.Preferred, described plant is a grass, includes but not limited to: paddy rice, wheat, barley, corn, Chinese sorghum etc.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification like polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, described " being operably connected " or " operability connection " is meant functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promoter region is placed in the specific position with respect to the goal gene nucleotide sequence, makes transcribing of nucleotide sequence receive the guiding of this promoter region, thereby promoter region is " operably connected " on this nucleotide sequence.
As used herein, described " promotor " or " promoter region (territory) " is meant a kind of nucleotide sequence, and the upper reaches (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factor.In this article, described promotor or promoter region comprise the variant of promotor, and it is through inserting or deletion regulation and control zone, carry out at random or rite-directed mutagenesis waits and obtains.
As used herein, term " specific expressed " is meant that goal gene is at specific time and/or specific tissue expression.
As used herein, " tissue-specific promoter " claims " organ specific promoters " again, and under this type promoter regulation, gene is often only expressed at some specific organ or tissue position, and shows the characteristic of growing adjusting.Among the present invention, described " tissue-specific promoter " is the plant anther specific expression promoter.
Usually, if mRNA is with than at least 10 times of height in other tissue or organ in certain tissue or organ, preferably high at least 100 times, more preferably high at least 1000 times of levels are expressed, and then this promotor is considered to tissue or organ specific.
As used herein, " external source " or " allogenic " is meant from the relation between two of different sources or many nucleic acid or the protein sequence.For example, if the combination of promotor and target gene sequences is not naturally occurring usually, then promotor is an external source for this goal gene.Particular sequence is " external source " for cell or organism that it inserted.
As used herein, " cis-regulating element " is meant the gene transcription initial sum transcribed the conservative property base sequence that efficient plays regulating effect.
As used herein, " goal gene " is meant the gene that can be started or instructed expression by promotor of the present invention.Suitable goal gene includes but not limited to: improvement plant quality, proterties or the relevant gene of metabolism.Suitable goal gene includes but not limited to: cytotoxic group is because of (Cytotoxic gene), as comes from rnase (Barnase) gene of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) or connect ribonuclease T1 (RNase T1) gene that comes from aspergillus tubigensis (Aspergillus oryzae); Influence the DYT1 gene that flower pesticide suede adhesion coating function and pollen form in the Arabidopis thaliana, ABORTED MICROSPORE gene (AMS) and MALE STERILITY 1 gene (MS1) etc.Influence the MULTIPLE SPOROCYTE1 gene (MSP1) that suede adhesion coating function and pollen form in the paddy rice, OsTDL1A gene, UNDEVELOPED TAPETUM gene (OsUDT1) and TAPETUM DEGENERATION RETARDATION gene (OsTDR) etc.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " belong to the subordinate concept of " containing ", " having " or " comprising " with " by ... formation ".
As used herein; Described " nucleotide sequence shown in (1-22)～(521-552) position among the SEQ ID NO:1 " refers to promptly that also said sequence can originate among the SEQ ID NO:1 arbitrary base in the 1st to the 22nd, ends among the SEQ ID NO:1 the 521st to the 552nd arbitrary base.
Promotor
The present invention provides a kind of anther-specific expression promotor, and described promotor has following characteristics: the 5 ' end and the upper reaches thereof that (a) are positioned at the osigcfa001g12 gene; (b) base length is 200-2000; (c) have necessary site and the transcripting start point that initiation is transcribed; And (d) has specifically expressing function in plant anther.
Promotor of the present invention has necessary site and the transcripting start point that initiation is transcribed; The inventor has studied the critical sites of the performance function of this promotor particularly; Comprise:
box (TATAAAT);
(CCAATGCA), these sites of
sequence and 26bp sequence
are critical areas of promotor of the present invention performance promotor gene expressive function and performance anther-specific expression function.
As one embodiment of the present invention, described promotor has the nucleotide sequence shown in 1-521 position, 1-552 position, the 23-552 position among the SEQ ID NO:1.
The hybridization of polynucleotide is technology well known to those skilled in the art, the indication of hybridization characteristic their similarity or the identity of specific a pair of nucleic acid.Therefore; The invention still further relates to and aforementioned specified nucleotide sequence hybridization and two sequences between have at least 50%; Preferably at least 70%, polynucleotide of (for example 85%, 90%, 95%, 96%, 97%, 98% or 99%) homogeny more preferably at least 80%.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide according to the invention.
" stringent condition " (or " stringent condition ") is meant: (1) than hybridization under LIS and the comparatively high temps and wash-out, like 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, like 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only the homogeny between two sequences at least 50%, preferred more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85% or more than 90%, be more preferably 95% and just hybridize when above.And interfertile polynucleotide also have and instruct goal gene specific expressed function in flower pesticide.
The present invention also comprises with any promoter sequence of the present invention having 50% or above (preferred more than 60%; More than 70%; More than 80%, more preferably more than 90%, most preferably more than 95%; As 98%, 99%) nucleic acid of homogeny, said nucleic acid also has the goal gene of guidance specific expressed function in flower pesticide." homogeny " be meant according to the identical per-cent in position, the similar level (being sequence homology, similarity or identity) between two or many nucleic acid.
Should understand; Although this promotor and the function thereof that derive from paddy rice are provided in the instance of the present invention; Yet; Those skilled in the art derive from the promotor that other monocotyledonous and this promotor have certain homogeny (conservative property) and are also included within the scope of the present invention, as long as can separate from other plant easily and obtain this promotor having read the information that provides according to the application behind the application.
Start destination gene expression
Promotor of the present invention can be operatively connected on the goal gene, and this goal gene can be external source (allos) for promotor.Nucleotide sequence to said goal gene has no particular limits (like a kind of structural nucleotide sequence), and described goal gene optimized encoding has the albumen of specific function, and for example some has the albumen of key property or function in agricultural or plant improvement.
Promotor of the present invention can also be operably connected on the target gene sequences that is modified, and this goal gene is external source (allos) with respect to promotor.Described goal gene can be modified and produce various desired characteristics.For example, goal gene can be modified increases contents of essential amino acids, improves the translation of aminoacid sequence; Change the modification (like phosphorylation site) after translating; Outside the translation product transporte to cells, improve proteic stability, insert or delete cell signal etc.
In addition, promotor and goal gene can be designed to reduce specific gene.This generally is to realize that through promotor is connected on the target gene sequences this sequence oppositely is directed with antisense.Those of ordinary skill in the art is familiar with this antisense technology.Any nucleotide sequence can be conditioned by this way.
Any aforesaid promotor and/or target gene sequences can be comprised in the recombinant vectors.
As a kind of mode, described recombinant vectors comprises promotor of the present invention, comprises MCS or at least one restriction enzyme site in the downstream of said promotor.When needs are expressed goal gene, goal gene is connected in the suitable MCS or restriction enzyme site, thereby goal gene is operably connected with promotor.
As another kind of mode, described recombinant vectors comprises (from 5 ' to 3 ' direction): promotor, and goal gene.If desired, described recombinant vectors can also comprise 3 ' transcription terminator, 3 ' polymerized nucleoside acidifying signal, other untranslated nucleotide sequence, transhipment and target nucleotide sequence, resistance selective marker, enhanser or operator.
The method that is used to prepare recombinant vectors is well known in the art.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral or other carriers.In a word, as long as it can duplicate in host and stablize, any plasmid and carrier all are can be adopted.
Method well-known to those having ordinary skill in the art can be used to make up the expression vector that contains promotor of the present invention and/or target gene sequences.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, like Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein (GFP) etc.
Except containing promotor of the present invention, also can contain one or more other promotors in the recombinant vectors.Described other promotor for example is: tissue-specific, composing type or induction type.For example the cauliflower mosaic virus 19S of mannosaminic acid synthetic enzyme and 35S (CaMV19S CaMV35S), enhanced CaMV, tobacco RB7 etc.
Comprise the above-mentioned suitable promotor and the carrier of goal gene, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, like bacterial cell; Or eukaryotic cell such as low, like yeast cell; Or higher eucaryotic cells, like vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell etc.Persons skilled in the art all know how to select appropriate carriers and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method, rataria conversion method, bud infusion method etc.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thereby obtain genetically modified plant.
As a kind of mode, the method for preparing transgenic plant is: the carrier that will carry promotor and goal gene (both are operably connected) changes Agrobacterium over to, and the carrier segments that Agrobacterium will contain promotor and goal gene again is incorporated on the karyomit(e) of plant.The transgene receptor plant that relates to for example is paddy rice, wheat, Arabidopis thaliana, tobacco, fruit tree etc.
In instance of the present invention; Described recombinant vectors is the pCambia carrier, and it carries beta-glucosidase (GUS) gene, promotor of the present invention is building up to the upper reaches of gus gene in this carrier; Transformed plant; Promotor will activate the expression of gus gene, and said startup receives the regulation and control of each cis-acting elements of promoter region, simulate the situation that gene is activated in vivo and transcribes.The a series of beta-glucoside of beta-glucosidase (GUS) ability catalytic pyrolysis produces the material with chromophoric group or fluorescence, and methods such as available spectrophotometer, photofluorometer or histological chemistry are carried out quantitatively and the spatial positioning analysis the GUS activity.In the art, gus gene has been widely used as the reporter gene of transgenic plant, bacterium and fungi, and particularly it can be used to study the concrete cell and the tissue site of exogenous gene expression.
Use
Anther specific promoter of the present invention has important use and is worth in theory research and agronomy improvement.The present invention can be widely used in plant genetic engineering: promotor can merge with target gene as important tool in the plant genetic engineering, through transgene carrier, transforms plant and obtains transfer-gen plant.
The using value of Rice Anther specific promoter includes but not limited to following aspect:
A, utilize Rice Anther specific promoter initiative male sterible series of rice
In the process of paddy rice cross breeding breeding, need male sterile line (Male sterility), people utilize this characteristic of male sterile, have removed the operating process of artificial emasculation from, thereby have practiced thrift a large amount of manpowers and the time of cross-breeding.Therefore, male sterile plant has great economic worth.Utilize the Rice Anther specific promoter can formulate male sterile line.The Rice Anther specific promoter connects cytotoxic group because of (Cytotoxic gene); As come from rnase (Barnase) gene of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) or connect ribonuclease T1 (RNase T1) gene that comes from aspergillus tubigensis (Aspergillus oryzae); Barnase and RNase T1 gene destroy the normal development of cell in the cell of its expression; Therefore; By means of Barnase or the specifically expressing of RNase T1 gene in flower pesticide, can suppress the normal development of flower pesticide, thereby obtain male sterible series of rice.
B, utilize of the gene diffusion of Rice Anther specific promoter control transgenic in the field
At present, a major issue of transgenic field control is the powder problem of wafing of genetically modified crops.The uncontrolled propagation of transgenic pollen meeting causes gene contamination to other species in the surrounding environment, and the Rice Anther specific promoter can help to address this problem.As stated, the Rice Anther specific promoter is connected Barnase, rice transformation together, the paddy rice transfer-gen plant that obtains like this can not form normal pollen; Therefore, the gene contamination of having avoided the pollen of transfer-gen plant that other species in the surrounding environment are caused.
C, utilizing Rice Anther specific promoter research influence the important gene that the paddy rice fringe is grown, is to increase crop yield, improve quality, increase the provenance that resistance provides excellence
Flower pesticide specific promoter regulatory gene specifically expressing in flower pesticide, its expressive site concentrates on flower pesticide, in its hetero-organization, does not express, and perhaps expression amount is very low.Compare with constitutive promoter, the advantage of flower pesticide specific promoter is that it makes the goal gene specific action in the flower pesticide organ, has reduced the possible influence of its hetero-organization of paddy rice.For the improvement of carrying out rice varieties through engineered method provides important operational means.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to people such as normal condition such as Sambrook; Molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press; 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
The screening of embodiment 1, rice tissue specific promoter and the evaluation of genetic expression
The inventor has made up full-length cDNA library (Liu, XH, Lu TT, the Yu SL of tissue such as over-ground part and the root of the fringe in paddy rice boot stage, 14 days seedling; Li Y, Huang YC., Huang T., Zhang L.; Zhu JJ, Zhao Q, Fan DL, Mu J; Shangguan YY, Feng Q, Guan JP, Ying K; Zhang Y, Lin ZX, Sun ZX, Qian Q; Lu YP, Han B. (2007) A collection of 10,096indica rice full-length cDNAs reveals highly expressed sequence divergencebetween Oryza sativa indica and japonica subspecies.Plant Mol Biol.65:403-415).Carry out 20,000 clones' 5 ' end sequencing respectively in each library.In the process of each library cDNA redundancy statistics, the inventor finds to have the very high cDNA clone of some copy numbers in the cDNA library of every kind of tissue.With the copy number of cDNA in each library,, find out that the cDNA copy number is positioned at preceding 20 cDNA in each library according to ordering from high to low; Then, add up the copy number of these cDNA in the cDNA library of its hetero-organization of paddy rice, if these cDNA do not occur in the library of its hetero-organization, then these cDNA become the isolating candidate gene of tissue specificity high expression level promotor.Then, the inventor identifies through the tissue specificity that the method for Real time RT-PCR is expressed candidate gene in the over-ground part and root of the paddy rice fringe in boot stage, 14 days seedling, further confirms candidate gene.
The clone of Rice Anther specific promoter and the conversion of paddy rice:, can obtain the upstream regulatory region sequence of gene, i.e. promoter sequence through the comparison of candidate gene full length cDNA sequence and rice genome sequence.Then through PCR method cloning promoter sequence; Promoter sequence is inserted between the BamHI and NcoI site of pCambia1305.2 (available from Cambia company) expression vector (containing gus reporter gene); Conventional agrobacterium co-cultivation rice transformation is identified the expression characterization of promotor through the expression that detects gus gene in the transgenic paddy rice.
The tissue-specific evaluation of the screening of embodiment 2, Rice Anther specific promoter and genetic expression
Through the statistics to full-length cDNA copy number in the paddy rice fringe full-length cDNA library, the inventor has obtained the candidate gene of a paddy rice fringe specific expression gene, osigcfa001g12 (GenBank accession number: CT833313).
Then, the inventor carries out the evaluation of Realtime RT-PCR to osigcfa001g12 in over-ground part and the expression in the root of the paddy rice fringe in boot stage, 14 days seedling.With paddy rice constitutive expression gene actin1 as reference gene, result such as table 1.Osigcfa001g12 expression of gene amount is the relative expression quantity with respect to reference gene actin1 in the table.
Table 1
The above results shows that the expression of osigcfa001g12 in fringe is very high, and in rice root and seedling, expresses very low.Osigcfa001g12 is the gene of special high expression level in fringe.
The structure of the sequential analysis of embodiment 3, Rice Anther specific promoter, the clone of promotor and transgene carrier
The promoter region sequence of osigcfa001g12 gene and genes encoding region sequence such as SEQ ID NO:1.Wherein: box indicating be proteic initiator codon and terminator codon.What
showed be the coding region of gene,
sign be the 5 ' UTR and 3 ' the UTR district of gene.Double underline is
box; (TATAAAT) reach
; (CCAATGCA).Italic emphasis added as
and
sequence.20 bases of 5 ' end are to be used to increase the corresponding site of primer of promoter region.
SEQ?ID?NO：1：
ACCTCAGCCAAAACCGAAGACAGTACCGCCGAAGGACCTTATTTAA
ACGGTTTTGTTAAGTTGGGGGACCCATCGTACCCGGTTTTGCGACC
GGGGACGAAAATCGGACTAGGTGATAAATAGAGGGACCCAAAGTG
AACTTATA
ATTTCATATCAAACAGTCACGGATGGGCTT
TAGGAAAGCAGAACTGGGCCCGGCCCAGTAGATCACATAGCCCAA
CAAGATCTAAACCGCATGCTCTCGTTTCAACAAATTATCACACCGA
TTG
CATCTGCTGCACAGGCTAAAT
GTAGCCATGA
ACCATTCACCTCACAAGTCACAAGCATTGCATTTCTATGGTTACCA
GTGCAGGACGAAATGCTCAACTAGCCCAAGCAAGAATGGAGCATG
ACAACCTCAGGCACCAAAAGCTC
ATTTGCATTGCACAAA
TCAAAAGTTTCC
CTTGATTGGCCACACTGATCACCTGGGTAAGAACTGACAATAACAC
GCCGGCTCCTCTGGATTGCGACTTCCAGTGGGGCCCAGGTGTCGGT
GTCAGCTGGGTAAGTTGGTGTCATCTGGTATGGGAAACTTTGATGT
TTTGTACATGTGGTGGTGCTCTTGTCAACATTATATAGATAAGGAG
AGAATAGGACAAACATGACGCTTGAATAGCAGAAGAGAAGTTCTA
TCCAGCAATATCAAAAGTACAGCTGTCATTTTCAAAAAATGTAAAA
CAAAAATAAAACGAAAAACCCACTATACTAGTGCCAATAAAAGAA
GAAACAAAAGAGAACTACATTATTGTCAATGCCATTTGTTGATGTT
ATTATTACTTTTGTTTATAAGAATAACAATTGTACTTATAAGGCCTA
CGATTTATTACAG
The transgene carrier that the inventor selects is pCambia1305.2, and clone's restriction enzyme site is selected BamHI and NcoI.PCambia1305.2 cuts through BamHI and NcoI enzyme, and original 35S promoter in the carrier is cut away, and rubber tapping is reclaimed and obtained carrier segments.
No BamHI point of contact in the amplification PCR fragment, but the NcoI point of contact is arranged.Therefore the inventor adds the BsaI point of contact in the reverse primer of design, and primer sequence is following:
Forward primer: ggatccacctcagccaaaaccgaaga (SEQ ID NO:2);
Reverse primer: ggtctc ccatgg cagccaggctagaagacttg (SEQ ID NO:3);
The recognition site of BsaI is ggtctc, and restriction enzyme site is the 1st and the 5th base thereafter, and therefore, actual point of contact still is NcoI point of contact ccatgg.After PCR product process BamHI and BsaI enzyme are cut like this, can be connected, obtain the promotor transgene carrier with the pCambia1305.2 that process BamHI and NcoI enzyme are cut.
Need to prove; Promotor is with after pCambia1305.2 is connected; Before the gus protein encoding sequence; The inventor has introduced the ten amino acid encoding sequence of osigcfa001g12 gene N end, and therefore, the gus protein of expression is that the N end contains 10 amino acid whose fusion roteins of osigcfa001g12 gene.Fusion rotein does not influence the tissue-specific evaluation of osigcfa001g12 promoter expression.
The expression of gus gene is identified in conversion of embodiment 4, paddy rice and the transgenic paddy rice
The inventor carries out the conversion of paddy rice through the method for Agrobacterium-mediated Transformation paddy rice rataria.The promotor transgene carrier change over to Agrobacterium EHA105 (referring to Hood, E.E., Gelvin; S.B., Melchers, L.S. and Hoekema; A., Transgenic Res., 1993; 2,208-218), transform Japan's fine (available from rice in China institute) rataria through EHA105 then and obtain the transfer-gen plant of promotor.The fine rataria of Japan is at first sterilized the generation that places evoked callus on the inducing culture through Youxiaolin.Rataria is induced in callus and 26 ℃ of Agrobacteriums, the dark of generation and was cultivated altogether 3 days.Then, change 4 week of cultivation on the screening culture medium that contains 40mg/l Totomycin and 300mg/l cephamycin over to.The kanamycin-resistant callus tissue that screening obtains changes over to and contains 0.5mg/l naphthylacetic acid (NAA), 4mg/l kinetin (kinetin), and 6mg/l 6-benzylaminopurine (6-BA), the 40mg/l Totomycin, the regeneration culture medium of 300mg/l cephamycin is cultivated 2-3 week.Afterwards, the regeneration seedling that obtains changes over to and carries out root culture in the 1/2MS root media.After 2-3 week, transgenic seedling moves into phytotron and cultivates.
Through the conversion of paddy rice, the transfer-gen plant that the inventor obtains 5-10 system (lines) carries out the evaluation of promoter activity.At first, transgenic paddy rice carries out the evaluation that T-DNA inserts.The genomic dna of extracting transgenic paddy rice seedling is a template with the genomic dna of transgenic paddy rice seedling, and pcr amplification Totomycin sequence (gene that is used for resistance screening in the transgene carrier) identifies that whether containing T-DNA in the transgenic paddy rice seedling inserts, and sees Fig. 1.The pcr amplification positive shows that T-DNA is inserted as the positive.Usually all containing T-DNA basically in the transgenic paddy rice that screening obtains inserts.
The GUS activity identification of embodiment 5, promotor transgenic positive plant
Tissues such as the root of transfer-gen plant, blade, stem and flower are dipped in the GUS staining fluid, 37 ℃, spend the night.Second day, the 70-75% ethanol decolorization was taken off the chlorophyll in the tissue.Then, under dissecting microscope, observe and write down the painted result of GUS.The component of paddy rice GUS staining fluid is:
Na
2HPO
4/NaH
2PO
4(1M，pH7.0) 5ml；
X-Gluc 100mg；
Triton?X-100 0.5ml；
Methyl alcohol 10ml;
The aqua sterilisa surplus;
TV 100ml.
The painted result of reporter gene GUS:
That Fig. 2 shows is the variant painted result of gus reporter gene that organizes in the promotor transgenic paddy rice.
A, the GUS dyeing in the rice young panicle.The about 7mm of children's spike length, paddy rice grain husk flower is about 1mm.At this moment, clever shell is transparent, dye-free; Only the flower pesticide specific staining is positive.Promoter regulation gene specifically expressing in flower pesticide is described.
B, the GUS dyeing during the paddy rice grain husk is spent.The grain husk flower is about 3.78mm, at this moment, and clever shell dye-free; The flower pesticide specific staining is positive.
C, with figure B be the same stage, the inventor comes two clever shells (inner glume and coetonium) strip off of grain husk flower, the arrow indication be the special anther tissue of dying blueness.
D, the GUS dyeing during the paddy rice grain husk is spent, the grain husk flower is about 6.53mm.Grain husk shell dye-free; The column cap of gynoecium and ovary dye-free; The special blueness of dying of the flower pesticide of stamen.Promoter regulation gene specifically expressing in flower pesticide.
E, the grain husk flower after blooming, the grain husk flower is about 6.58mm.Grain husk shell dye-free, the flower pesticide specific staining is blue.
F is the same stage with scheming E, and two clever shells of grain husk flower are peeled off, shows the dyeing of stamen and gynoecium.The column cap dye-free of gynoecium has light dyeing in the zero position of style and the base portion of ovary; Flower pesticide dyeing is the very strong positive.
G is the same stage with scheming E, and the flower pesticide part of amplification shows that flower pesticide is the strong positive.
H is the same stage with scheming E, and pollen staining is positive.
What A-H showed is the GUS dyeing of grain husk flower, and the different steps (1mm-7mm) at clever flower development is the flower pesticide specifically expressing.
I, the GUS dyeing of root is negative.
J, the GUS dyeing of blade is negative.
K, the GUS dyeing of leaf sheath, the tip of a leaf, auricle is negative.
L, the GUS dyeing of stem.The GUS dyeing of internode is negative, and the GUS dyeing of joint is the very light positive.A, anther, flower pesticide; S, stigma, column cap; O, ovary, ovary.
Conclusion: the promotor of osigcfa001g12 gene connects gus reporter gene; Rice transformation; Group dyeing through gus reporter gene in the transfer-gen plant is identified; The promoter regulation gene of proof osigcfa001g12 is special high expression level in the anther tissue of paddy rice grain husk flower stamen, at clever shell, does not express in the gynoecium.In root, blade, leaf sheath, all do not express.In the internode of stem, do not express, but very weak expression is only arranged in the joint of stem.
The section of flower pesticide: flower pesticide section result sees Fig. 3, and its Smalt shows that GUS dyeing is positive.
Figure A result shows that GUS is specifically expressing in the suede adhesion coating cell of flower pesticide, in clever shell, does not express.A, anther, flower pesticide; T, Tapetum, suede adhesion coating; L, Lemma, clever shell.Figure B, the flower pesticide part of amplification shows GUS specifically expressing in the suede adhesion coating.E, epidermis, epidermis; MC, meiotic cell, maiotic cell.
Quantitative results in the blade of paddy rice, leaf sheath, stem, fringe confirms that also gus gene is special high expression level in fringe specifically, sees Fig. 4.
The variant research of embodiment 6, promotor reservation function
As previously mentioned, promoter region sequence of the present invention is shown in 1-521 position among the SEQ ID NO:1, and the effect that the sequence shown in the 1-552 position also has promotor among the SEQ ID NO:1.Through identifying,
that be arranged in
box (TATAAAT), the 146-153 position of SEQID NO:1 436-442 position (CCAATGCA) is the critical sites (necessary site and transcripting start point that initiation is transcribed) of promotor performance function.
At the promoter region of osigcfa001g12 gene, except TATA box (TATAAAT) and CAAT box (CCAATGCA), the inventor has also found: E-box, sequence are 5 '-CATTTG-3 ' (278-283 position among the SEQ ID NO:1).The E-box is the cis regulation and control assembly of the promoter region of fat translocator (Lipid transfer protein) gene family, is the transcription factor binding site point, and pointing out it is the critical sites of regulation and control flower pesticide specifically expressing.
In addition, the CAAACAC sequence is the cis regulation and control assembly of the promoter region of fat transporter gene family, is the critical sites that influences promotor intensity.
Therefore, basic above-mentioned critical sites, the inventor has carried out promoter variants research.
M1：
The inventor has prepared based on the promotor of sequence shown in the 1-552 position among the SEQ ID NO:1, and wherein 5 ' end reduces 22 bases (M1).Based on the analysis of critical sites, the TATA box, CAAT box, these sites as conservative property of E-box and CAAACAC sequence remain unchanged.Sequence is (single underscore is the primer sequence that is used to increase) as follows:
GTACCGCCGAAGGACCTTATTTAAACGGTTTTGTTAAGTTGGGGGACCCA
TCGTACCCGGTTTTGCGACCGGGGACGAAAATCGGACTAGGTGATAAAT
AGAGGGACCCAAAGTGAACTTATA
ATTTCATATCAAACAGT
CACGGATGGGCTTTAGGAAAGCAGAACTGGGCCCGGCCCAGTAGATCAC
ATAGCCCAACAAGATCTAAACCGCATGCTCTCGTTTCAACAAATTATCAC
ACCGATTG
CATCTGCTGCACAGGCTAAAT
GTAGCCATG
AACCATTCACCTCACAAGTCACAAGCATTGCATTTCTATGGTTACCAGTG
CAGGACGAAATGCTCAACTAGCCCAAGCAAGAATGGAGCATGACAACCT
CAGGCACCAAAAGCTC
ATTTGCATTGCACAAATCAAAAGTTT
CC
The variant painted result of gus reporter gene such as Fig. 5 of organizing in the promotor transgenic paddy rice.
The painted result of transgenic paddy rice GUS shows that in the paddy rice grain husk was spent, clever shell did not have GUS dyeing; Flower pesticide specific staining positive (showing blue); In addition, in root, blade, leaf sheath, stem, all do not express.The M1 promotor has the function that instructs goal gene specifically expressing in plant anther.
M2：
The inventor has prepared the promotor than the short 135bp sequence of M1, and wherein 5 ' end reduces 135bp (M2).Based on the analysis of critical sites, CAAT box (CCAATGCA) disappearance, and TATA box, these sites as conservative property of E-box and CAAACAC sequence remain unchanged.Sequence is (single underscore is the primer sequence that is used to increase) as follows:
CATATCAAACAGTCACGGATGGGCTTTAGGAAAGCAGAACTGGGCCCG
GCCCAGTAGATCACATAGCCCAACAAGATCTAAACCGCATGCTCTCGTT
TCAACAAATTATCACACCGATTG
CATCTGCTGCACAGGCTAAA
T
GTAGCCATGAACCATTCACCTCACAAGTCACAAGCATTGCA
TTTCTATGGTTACCAGTGCAGGACGAAATGCTCAACTAGCCCAAGCAA
GAATGGAGCATGACAACCTCAGGCACCAAAAGCTC
ATTTGC
ATTGCACAAATCAAAAGTTTCC
The variant painted result of gus reporter gene that organizes sees Fig. 6 in the promotor transgenic paddy rice.
It is thus clear that the promotor M2 rice transformation of brachymemma instructs gus reporter gene in the flower pesticide of paddy rice grain husk flower, to express; In blade and leaf sheath, express.But, in root, do not express, a little less than in stem, not expressing or expressing.
From above-mentioned M2 and M1 transfer-gen plant GUS coloration result relatively, in the 135bp zone of reducing, contain the critical sites that regulation and control are transcribed simultaneously in blade, leaf sheath, after this site disappearance, show as in blade and leaf sheath and express.
M3：
The inventor has prepared the promotor than the short 129bp sequence of M2, and wherein 5 ' end reduces 129 bases (M3).Based on the analysis of critical sites, CAAT box (CCAATGCA), E-box disappearance, and these sites as conservative property of TATA box and CAAACAC sequence remain unchanged.Sequence is (single underscore is the primer sequence that is used to increase) as follows:
AGTCACAAGCATTGCATTTCTATGGTTACCAGTGCAGGACGAAATGCTC
AACTAGCCCAAGCAAGAATGGAGCATGACAACCTCAGGCACCAAAAGC
TC
ATTTGCATTGCACAAATCAAAAGTTTCC
The variant painted result of gus reporter gene that organizes sees like Fig. 7 in the promotor transgenic paddy rice.
It is thus clear that the promotor M3 rice transformation of brachymemma instructs gus reporter gene in the flower pesticide of paddy rice grain husk flower, to express, and in blade, leaf sheath, stem, expresses; But in root, do not express.In addition, in the clever point of grain husk flower, express.
From above-mentioned M3 and M2 transfer-gen plant GUS coloration result relatively, contain the critical sites that regulation and control are transcribed in this 129bp zone in stem, after the disappearance of this site, show as high expression level in stem.
The promotor (Pro-osigcfa001g12) of sequence shown in the 1-552 position is compared among M2 promotor and the SEQ ID NO:1, and its 5 ' end reduces 157bp; M3 reduces 129bp than M2 again; Their GUS quantitative result such as Fig. 9.Shown in the figure, the intensity of M4 promotor significantly reduces than Pro-osigcfa001g12, but does not have significant difference with M5, the visible motif that in this 157bp, contains regulation and control promotor expression intensity in flower pesticide; In this section, CAAT box is arranged, CAAT box possibly influence the expression intensity of gus reporter gene.In addition, through the comparison of homologous sequence, find the motif of GTGA, the motif of GTGA possibly influence the expression intensity in flower pesticide in the promotor.
M4：
The inventor has prepared the promotor than the short 26bp sequence of M3, and wherein 5 ' end reduces 26 bases (M4).Based on the analysis of critical sites, CAAT box (CCAATGCA), E-box, CAAACAC sequence deletion, and the TATA box remains unchanged as the site of conservative property.Sequence is (single underscore is the primer sequence that is used to increase) as follows:
TAGCCATGAACCATTCACCTCACAAGTCACAAGCATTGCATTTCTATGGT
TACCAGTGCAGGACGAAATGCTCAACTAGCCCAAGCAAGAATGGAGCAT
GACAACCTCAGGCACCAAAAGCTC
ATTTGCATTGCACAAATC
AAAAGTTTCC
The variant painted result of gus reporter gene that organizes sees Fig. 8 in the M4 promotor transgenic paddy rice.
It is thus clear that, the promotor M4 rice transformation of brachymemma, the painted result of transgenic paddy rice GUS shows, root, blade, leaf sheath, the internode of stem, and the GUS of flower pesticide dyeing is all negative; Only the joint position GUS of stem dyeing is the weak positive (showing light blueness).
M4 is than the short 26bp of M3, from above-mentioned M4 and M3 transfer-gen plant GUS coloration result relatively, under the situation of this 26bp sequence of disappearance, promotor is at blade, leaf sheath, the internode of stem and the expression in the flower pesticide have disappeared.The reduction of highly significant is also arranged on the GUS expression intensity of the joint of stem.Therefore, this 26bp is the crucial motif of regulation and control osigcfa001g12 genetic transcription, also is the crucial motif that flower pesticide is expressed.
The sequential analysis of embodiment 7, Rice Anther specific promoter
Through the homology comparison, find other several cis regulation and control assemblies,
GT1consensus: The following sequence of 99-104 bits
115-120 bits
and light regulation of gene expression.Supposition possibly participated in the regulation and control of genetic expression in blade, the leaf sheath.
ACCTCAGCCAAAACCGAAGACAGTACCGCCGAAGGACCTTATTTAAAC
GGTTTTGTTAAGTTGGGGGACCCATCGTACCCGGTTTTGCGACCGGGGA
C
CGGACTAGGT
TAGAGGGACC
ACTTATA
GAACTGGGCCCGGCCCAGTAGATCACATAGCCCAACAAGATCTAAACC
GCATGCTCTCGTTTCAACAAATTATCACACCGATTG
CATCTGCT
GCACAGGCTAAAT
GTAGCCATGAACCATTCACCTCACAAGTC
ACAAGCATTGCATTTCTATGGTTACCAGTGCAGGACGAAATGCTCAACT
AGCCCAAGCAAGAATGGAGCATGACAACCTCAGGCACCAAAAGCTC
All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (11)
1. isolating polynucleotide is characterized in that, described polynucleotide:
(a) being positioned at 5 ' of osigcfa001g12 gene holds and the upper reaches;
(b) base length is 200-2000;
(c) have necessary site and the transcripting start point that initiation is transcribed; And
(d) has specifically expressing function in plant anther.
2. polynucleotide as claimed in claim 1 is characterized in that, described polynucleotide are:
(1) polynucleotide of the nucleotide sequence shown in the 1-521 position among the SEQ ID NO:1;
(2) polynucleotide of the nucleotide sequence shown in the 1-552 position among the SEQ ID NO:1;
(3) polynucleotide of (1) or (2) arbitrary qualification, wherein 1-22 bit base disappearance;
(4) polynucleotide that constitute by the nucleotide sequence shown in (1-22)～(521-552) position among the SEQ ID NO:1;
(5) nucleotides sequence is listed under the stringent condition and can hybridizes and have the polynucleotide that instruct goal gene specifically expressing function in plant anther with the polynucleotide sequence of the arbitrary qualification in (1)-(4);
(6) nucleotide sequence has 80% above homology and has the polynucleotide that instruct goal gene specifically expressing function in plant anther with the polynucleotide sequence of the arbitrary qualification in (1)-(4); Or
(7) the complete complementary polynucleotide of polynucleotide sequence of nucleotide sequence and the arbitrary qualification in (1)-(4).
3. polynucleotide as claimed in claim 2 is characterized in that, described polynucleotide are:
Based on nucleotide sequence shown in the 1-552 position among 1-521 position or the SEQ ID NO:1 among the SEQ ID NO:1; 436-442 position, 146-153 position, 278-283,305-311 position and/or 287-312 position nucleotide sequence are constant; The polynucleotide sequence of other site and the arbitrary qualification in (1)-(4) has 50% above homogeny, and has the polynucleotide that instruct goal gene specifically expressing function in plant anther.
4. like claim 2 or 3 described polynucleotide; It is characterized in that; Described polynucleotide are: based on nucleotide sequence shown in the 1-552 position among 1-521 position or the SEQ ID NO:1 among the SEQ ID NO:1; 99-104 position, 115-120 position and/or 131-138 position nucleotide sequence are constant, and the polynucleotide sequence of other site and the arbitrary qualification in (1)-(4) has 50% above homogeny, and has the polynucleotide that instruct goal gene specifically expressing function in plant anther.
5. the purposes of the arbitrary described polynucleotide of claim 1-4 is used for instructing goal gene at the plant anther specifically expressing.
6. a carrier is characterized in that, described carrier contains the arbitrary described polynucleotide of claim 1-4, as promoter element.
7. carrier as claimed in claim 6 is characterized in that, described carrier also contains and described polynucleotide operability purpose of connecting gene.
8. carrier as claimed in claim 6 is characterized in that described goal gene is positioned at the downstream of said polynucleotide, and with the interval of said polynucleotide less than 1000bp.
9. a genetically engineered host cell is characterized in that, described cell:
Contain the described carrier of claim 5; Or
Be integrated with the arbitrary described polynucleotide of claim 1-4 of external source in its genome.
10. a method that makes goal gene specifically expressing in plant anther is characterized in that, described method comprises:
With the construction transformed plant cells, described construction contain the arbitrary described polynucleotide of claim 1-4 and with described polynucleotide operability purpose of connecting gene;
Filter out and changed the vegetable cell that is integrated with said construction in said construction or the karyomit(e) over to; With
With said vegetable cell regeneration plant.
11. method as claimed in claim 10 is characterized in that, described method comprises:
(a) Agrobacterium of carrying expression vector is provided, contains construction in the said expression vector, described construction contain the arbitrary described polynucleotide of claim 1-4 and with described polynucleotide operability purpose of connecting gene;
(b) vegetable cell, tissue or organ are contacted with Agrobacterium in the step (a), thereby make described construction change vegetable cell over to.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110360123.2A CN102465128B (en) | 2010-11-12 | 2011-11-14 | Anther specific expression promoter and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010542607 | 2010-11-12 | ||
| CN201010542607.4 | 2010-11-12 | ||
| CN201110360123.2A CN102465128B (en) | 2010-11-12 | 2011-11-14 | Anther specific expression promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102465128A true CN102465128A (en) | 2012-05-23 |
| CN102465128B CN102465128B (en) | 2015-02-18 |
Family
ID=46069248
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110360123.2A Active CN102465128B (en) | 2010-11-12 | 2011-11-14 | Anther specific expression promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102465128B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820445A (en) * | 2014-01-15 | 2014-05-28 | 深圳市作物分子设计育种研究院 | Identification and application of plant anther specific expression promoter |
| CN104946649A (en) * | 2015-07-07 | 2015-09-30 | 安徽省农业科学院水稻研究所 | Specific expression promoter OsAnth1 for rice anthers |
| WO2015161744A1 (en) * | 2014-04-22 | 2015-10-29 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | Identification and use of promoter ptaasg048 specifically expressed by plant anther |
| CN111041042A (en) * | 2018-10-11 | 2020-04-21 | 内蒙古农业大学 | Method for establishing and optimizing agrobacterium-mediated transient expression system of caragana intermedia |
| CN111676229A (en) * | 2020-06-30 | 2020-09-18 | 四川农业大学 | Maize male nuclear sterility gene ms40 and molecular marker and application thereof |
| CN113416735A (en) * | 2021-03-17 | 2021-09-21 | 云南中烟工业有限责任公司 | Tobacco germ cell specific high expression gene and application thereof |
-
2011
- 2011-11-14 CN CN201110360123.2A patent/CN102465128B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| LIU LI-KE ET AL: "Construction and identification of HSP70 antisense RNA Expression Vector for genetic Engineering Male Sterility in Plant", 《AGRICULATURAL BIOTECHNOLOGY》 * |
| 涂知明等: "六倍体大小麦tritordeum花药组织特异性启动子的鉴定与分离", 《武汉植物学研究》 * |
| 郑宏红等: "花药特异性表达的类查尔酮合酶基因D5与水稻花粉发育相关", 《科学通报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820445A (en) * | 2014-01-15 | 2014-05-28 | 深圳市作物分子设计育种研究院 | Identification and application of plant anther specific expression promoter |
| CN103820445B (en) * | 2014-01-15 | 2016-07-06 | 深圳市作物分子设计育种研究院 | The qualification of one plant anther specific expression promoter and application |
| WO2015161744A1 (en) * | 2014-04-22 | 2015-10-29 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | Identification and use of promoter ptaasg048 specifically expressed by plant anther |
| CN104946649A (en) * | 2015-07-07 | 2015-09-30 | 安徽省农业科学院水稻研究所 | Specific expression promoter OsAnth1 for rice anthers |
| CN111041042A (en) * | 2018-10-11 | 2020-04-21 | 内蒙古农业大学 | Method for establishing and optimizing agrobacterium-mediated transient expression system of caragana intermedia |
| CN111676229A (en) * | 2020-06-30 | 2020-09-18 | 四川农业大学 | Maize male nuclear sterility gene ms40 and molecular marker and application thereof |
| CN111676229B (en) * | 2020-06-30 | 2021-07-13 | 四川农业大学 | Maize male nuclear sterility gene ms40 and molecular marker and application thereof |
| CN113416735A (en) * | 2021-03-17 | 2021-09-21 | 云南中烟工业有限责任公司 | Tobacco germ cell specific high expression gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102465128B (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7129397B2 (en) | Promoters functional in plant plastids | |
| CN102465128B (en) | Anther specific expression promoter and application thereof | |
| WO2009097823A1 (en) | Plant epidermal hair specific expression promoter fif1 and its use | |
| CN106834305B (en) | Rice male fertility regulation gene OsSTRL2 and application thereof | |
| WO2019129145A1 (en) | Flowering time-regulating gene cmp1 and related constructs and applications thereof | |
| CN110386967B (en) | Plant male fertility-related protein SiMS1, and coding gene and application thereof | |
| WO2000071704A1 (en) | Promoter having specific activity to pistil tissue | |
| CN102533761A (en) | Pollen-specific promoter and expression vector and application thereof | |
| JP3054694B2 (en) | Transcription factor genes that alter plant morphology and their use | |
| CN113817033B (en) | Application of ZmELF3.1 protein and its functional deletion mutant in regulating and controlling crop aerial root number or layer number | |
| CN101880664B (en) | Monocotyledon promoter as well as preparation method and application thereof | |
| CN101565702B (en) | GIF1 promoter and use thereof | |
| CN105316333B (en) | The identification and application of plant anther specific expression promoter pTaASG005 | |
| CN113564199A (en) | Method for creating high-yield soybean | |
| KR102000471B1 (en) | Constitutive promoter derived from chrysanthemum and use thereof | |
| US5955649A (en) | Gene expression regulatory DNA, expression cassette, expression vector and transgenic plant | |
| KR102374017B1 (en) | Plant regulatory elements and their uses | |
| CN102268433B (en) | Plant aging specific promoter and application thereof | |
| EP2363465A1 (en) | Transgenic plant of which seed has enlarged size | |
| CN105039338B (en) | The identification and application of plant anther specific expression promoter pTaASG004 | |
| KR101494191B1 (en) | Promoter for directing the guard-cell specific expression | |
| CN104975024B (en) | The identification and application of plant anther specific expression promoter pTaASG042 | |
| KR101636317B1 (en) | funiculus specific expression promoter | |
| KR102390866B1 (en) | Constitutive promoter derived from chrysanthemum and use thereof | |
| CN102676457A (en) | Function and application of flower-specific expression promoter KT631P |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200611 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031, 320 Yueyang Road, Shanghai, Shanghai, Xuhui District Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |