CN102268433B - Plant aging specific promoter and application thereof - Google Patents
Plant aging specific promoter and application thereof Download PDFInfo
- Publication number
- CN102268433B CN102268433B CN 201010190818 CN201010190818A CN102268433B CN 102268433 B CN102268433 B CN 102268433B CN 201010190818 CN201010190818 CN 201010190818 CN 201010190818 A CN201010190818 A CN 201010190818A CN 102268433 B CN102268433 B CN 102268433B
- Authority
- CN
- China
- Prior art keywords
- plant
- promotor
- gene
- goal gene
- senescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a plant aging specific promoter and application thereof. In the invention, a promoter capable of responding to plant aging signals and regulating high expression of target gene specificity is separated for the first time. The promoter is very useful for regulating the expression of the target gene in a plant aging process, so as to change the plant characters, state and aging process.
Description
Technical field
The invention belongs to biological technical field; More specifically, the present invention relates to a kind of plant senescence-specific promotor and application thereof.
Background technology
Promotor is meant one section dna sequence dna that ability accurate and effective initial gene is transcribed in the gene, is usually located at upstream region of gene.Promotor is the critical elements of gene expression regulation, and trans-acting factors (transcription factor) such as it and RNA polymerase and other albumen cofactors interact the level that regulatory gene transcribes and the specificity of spatial and temporal expression thereof.
Present most popular constitutive promoter is tobacco mosaic virus(TMV) (CaMV) 35S promoter.Simultaneously, people pay much attention to from plant clone's constitutive promoter itself and win initial success, and Actin muscle (Actin) and the isogenic promotor of ubiquitin (Ubiquitin) are cloned.Mariani etc. successfully utilize tobacco flower pesticide tapetum specific expression gene promotor TA29 to drive nucleicacidase Barnase, RnaseT1 gene specifically expressing in flower pesticide; Destroy tapetum; Obtain the male sterile rape, this is to create male sterile line through genetically engineered first.Express the ipt gene in the wheat leaf, improve the cell fission cellulose content, chlorophyll degradation is slowed down, the leaf aging is slack-off.
Plant transgenic technology is normally used at present is composition type expression promoter, for example cauliflower mosaic virus CaMV 35S promoter.But the gene of constitutive promoter regulation and control all continues to efficiently express with organizing at development of plants each period; The specificity that does not have space-time; Still not a kind of unnecessary wasting of resources for plant; Be unfavorable for the healthy development of plant, and if some be that the gene that possibly change economical character is expressed at unnecessary position and period originally, may bring certain toxic action to growth and development of plant on the contrary.
To sum up, be necessary to develop new promotor,, realize the breed improvement of plant to change the economical character of plant effectively, exactly with specific function.
Summary of the invention
The object of the present invention is to provide a kind of plant senescence-specific promotor and application thereof.
In first aspect of the present invention, a kind of isolating plant (like the blade of plant) senescence-specific promotor is provided, described promotor:
(a) being positioned at 5 ' of pheophorbide oxydase encoding sox holds and the upper reaches;
(b) base length is 500-3000;
(c) have necessary site and the transcripting start point that initiation is transcribed; And
(d) has response plant senescence signal and start the specific expressed function of goal gene.
In a preference, described pheophorbide oxydase derives from Arabidopis thaliana (Arabidopsisthaliana).
In another preference, (a) in, be positioned at the pheophorbide oxidase gene upper reaches-2800 the 200th to the coding region.Preferably, be positioned at the pheophorbide oxydase upper reaches-2000 the 200th to the coding region; More preferably, be positioned at the pheophorbide oxydase upper reaches-1907 the 186th to the coding region.
In another preference, described promotor contains TATA-box structure.
In another preference, described plant is a cress.
In another preference, described plant is an Arabidopis thaliana.
In another preference, described promotor is:
(1) promotor of the nucleotide sequence shown in the SEQ ID NO:1;
(2) nucleotide sequence and SEQ ID NO:1 have 95% above homogeny and have the promotor that responds the plant senescence signal and start the specific expressed function of goal gene; Or
(3) the complete complementary promotor of nucleotide sequence shown in nucleotide sequence and the SEQ ID NO:1.
In another aspect of this invention, a kind of carrier is provided, described carrier contains described promotor.
In another preference, described carrier also contains the goal gene that is operably connected with described promotor.
In another preference of the present invention, described goal gene is a structure gene.
In another preference of the present invention, described goal gene codified has the albumen of specific function.
In another preference of the present invention, described goal gene is a foreign gene.
In another preference of the present invention; Described goal gene includes, but is not limited to: beta-glucosidase (GUS) gene; Cell fission differentiation associated gene (comprising phytokinin etc.), growth hormone pathways metabolism genes involved (comprise the synthetic and degraded genes involved of growth hormone; Growth hormone transporter gene etc.); Nutrition transportation genes involved (like isopentenyl transferase genes) improves in gene (like human lactoferrin gene, Methionin synthase gene, beta Serlabo synthetic gene, straight chain and pulullan synthase gene etc.) and the seed of plant quality or proterties or phenotypic correlation hormone synthesis related gene etc.
In another preference of the present invention, described goal gene is positioned at the downstream of said promotor, and with the sequence of the directly contiguous encoding sox of said promoter region.Usually, the interval of said promotor and goal gene less than 1000bp (preferred, less than 500bp; Preferred, less than 100bp; Most preferred, less than 50bp).
In another aspect of this invention, a kind of genetically engineered host cell is provided, described cell:
Contain described carrier; Or
Be integrated with the described promotor of external source in its genome.
In another aspect of this invention, a kind of method that goal gene is expressed in senescence process of plant is provided, described method comprises:
With the construction transformed plant cells, the goal gene that described construction contains described promotor and is operably connected with described promotor;
Filter out and changed the vegetable cell that is integrated with said construction in said construction or the karyomit(e) over to; With
With said vegetable cell regeneration plant, goal gene is expressed in senescence process of plant in the said plant.
In another preference, described method comprises:
(a) Agrobacterium of carrying expression vector is provided, contains construction in the said expression vector, the goal gene that described construction contains described promotor and is operably connected with described promotor;
(b) vegetable cell, tissue or organ (like floral organ) are contacted with Agrobacterium in the step (a), thereby make described construction change vegetable cell, tissue or organ over to;
(c) select vegetable cell, tissue or the organ that has changed said construction over to; And
(d) vegetable cell, tissue or neomorph in the step (c) are become plant, goal gene is expressed in senescence process of plant in the said plant.
In another aspect of this invention, the purposes of described promotor is provided, described promotor is used for responding the plant senescence signal and starts goal gene to be expressed at senescence process of plant.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown that AtPaO expression of gene amount is with the changing conditions of secretly inducing fate to increase under dark inductive condition.
Fig. 2 has shown transfer-gen plant naturally-aged adjusting GUS coloration result down.Wherein,
The vertical view of A, transfer-gen plant can be observed cotyledon and true leaf.
The old and feeble situation of B, each blade of Arabidopis thaliana.Be the whole lotus throne leaves of Arabidopis thaliana from left to right, comprise: 2 cotyledons, the 1st true leaf, the 2nd true leaf, the 3rd true leaf ... the 10th true leaf.Can be observed: leftmost leaf is the most yellow, and more and more greener along from left to right direction leaf, also promptly: leftmost leaf aging degree is the highest, successively decreases along from left to right direction leaf aging degree.
C and D, GUS coloration result show the GUS expression of each lotus throne leaf of Arabidopis thaliana.Can be observed, leftmost leaf blueness is the darkest, and along direction from left to right, blueness from deep to shallow.
Fig. 3 has shown transfer-gen plant naturally-aged adjusting GUS coloration result down.
The old and feeble position of A, each blade of Arabidopis thaliana.Be the part lotus throne leaf of Arabidopis thaliana from left to right, comprise successively: 1st, 3,5,7,9,11,13 lotus throne leaves.Can be observed: beginning out old and feeble position at first is blade tip and limb edge, shown in arrow.
B, GUS coloration result show the GUS expression of each lotus throne leaf of Arabidopis thaliana.Can be observed: blade tip and limb edge are observed at first by the GUS dye liquor and are dyed blueness.
Fig. 4 has shown secretly and has induced down blade GUS coloration result.Can be observed: the dyeing of 0 day blade of dark place reason is not obvious, begins after 2 days to can be observed GUS dyeing at blade edge and secretly induce, and 4 days most of positions of blade begin to observe gus gene and express.
Embodiment
The inventor is separated to one first and can responds the plant senescence signal through extensive and deep research, and regulates the promotor of goal gene specificity overexpression.Described promotor is very useful for the expression of in senescence process of plant, regulating goal gene to change plant trait, state or senescence process.Accomplished the present invention on this basis.
Term
As used herein, described " plant " has no particular limits, and includes, but is not limited to: fruit plant, vegetable plant, farm crop etc.The fruit plant is such as but not limited to the plant of oranges and tangerines section, the Rosaceae, Curcurbitaceae, Musaceae etc.Vegetable plant is such as but not limited to composite family, Solanaceae, Labiatae, umbelliferae, the plant of Cruciferae (like Arabidopis thaliana).Farm crop are such as but not limited to the plant of Gramineae, Amaryllidaceae etc.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification like polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, described " being operably connected " is meant functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promoter region is placed in the specific position with respect to the goal gene nucleotide sequence, makes transcribing of nucleotide sequence receive the guiding of this promoter region, thereby promoter region is " operably connected " on this nucleotide sequence.
As used herein, described " promotor " or " promoter region (territory) " is meant a kind of nucleotide sequence, and the upper reaches (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factor.In this article, described promotor or promoter region comprise the variant of promotor, and it is through inserting or deletion regulation and control zone, carry out at random or rite-directed mutagenesis waits and obtains.
As used herein, term " specific expressed " is meant that goal gene is at specific time and/or specific tissue expression.Described " senescence-specific promotor " is meant that under this type promoter regulation, goal gene is expressed in the process of plant senescence.
As used herein, " external source " or " allogenic " is meant from the relation between two of different sources or many nucleic acid or the protein sequence.For example, if the combination of promotor and target gene sequences is not naturally occurring usually, then promotor is an external source for this goal gene.Particular sequence is " external source " for cell or organism that it inserted.
As used herein, " cis-regulating element " is meant the gene transcription initial sum transcribed the conservative property base sequence that efficient plays regulating effect.
As used herein, " goal gene " is meant the gene that can be started or instructed expression by promotor of the present invention.Suitable goal gene includes but not limited to: improvement plant quality, proterties or the relevant gene of metabolism.Suitable goal gene includes but not limited to: beta-glucosidase (GUS) gene; Cell fission differentiation associated gene (comprising phytokinin etc.), growth hormone pathways metabolism genes involved (comprise the synthetic and degraded genes involved of growth hormone; Growth hormone transporter gene etc.); Nutrition transportation genes involved (like isopentenyl transferase genes) improves in gene (like human lactoferrin gene, Methionin synthase gene, beta Serlabo synthetic gene, straight chain and pulullan synthase gene etc.) and the seed of plant quality or proterties or phenotypic correlation hormone synthesis related gene etc.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " belong to the subordinate concept of " containing ", " having " or " comprising " with " by ... formation ".
As used herein, described plant " senescence process " has comprised " naturally-aged process " and " inducing (or artificial) senescence process ".
Described " naturally-aged process " is meant the aging course that plant starts voluntarily in growth and development process.For example, the lotus throne leaf of Arabidopis thaliana is not simultaneously old and feeble, but press leaf age progressively aging successively, and senescing from cotyledon is the 1st true leaf then, the 2nd true leaf ... to the 10th true leaf.The plant senescence process can learn through the apparent observation to plant, and for example to have represented leaf to take place by green flavescence old and feeble for the leaf of most plants (like Arabidopis thaliana etc.), and more obviously then aging degree is high more for yellow.
Described " inducing (or artificial) senescence process " is meant ambient conditions or thinks the process of growing of disturb plant, create plant old and feeble atmosphere or environment take place.For example, change the growing environment of plant, make plant under dark condition, grow, then plant can start senescence process under the inducing of dark, and along with the increase senescence process of induction time also increases.
Promotor
The present invention provides a kind of plant senescence-specific promotor, and described promotor has following characteristics: (a) be arranged in the pheophorbide oxidase gene upper reaches of (being called AtPaO at Arabidopis thaliana) (preferably be positioned at the pheophorbide oxydase upper reaches-2800 to the coding region the 200th); (b) has response plant senescence signal and start the specific expressed function of goal gene; (c) have necessary site and the transcripting start point that initiation is transcribed; And (d) base length is 500-3000.As one embodiment of the present invention, described promotor has the promotor of the nucleotide sequence shown in the SEQ ID NO:1.
The hybridization of polynucleotide is technology well known to those skilled in the art, the indication of hybridization characteristic their similarity or the identity of specific a pair of nucleic acid.Therefore; The invention still further relates to and aforementioned specified nucleotide sequence hybridization and two sequences between have at least 50%; Preferably at least 70%, polynucleotide of (for example 85%, 90%, 95%, 96%, 97%, 98% or 99%) homogeny more preferably at least 80%.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide according to the invention.
" stringent condition " (or " stringent condition ") is meant: (1) than hybridization under LIS and the comparatively high temps and wash-out, like 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, like 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only the homogeny between two sequences at least 50%, preferred more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85% or more than 90%, be more preferably 95% and just hybridize when above.And interfertile polynucleotide also have the function of response plant senescence signal.
The present invention also comprises with any promoter sequence of the present invention having 50% or above (preferred more than 60%; More than 70%; More than 80%, more preferably more than 90%, most preferably more than 95%; As 98%, 99%) nucleic acid of homogeny, said nucleic acid also has response plant senescence signal and starts the specific expressed function of goal gene." homogeny " be meant according to the identical per-cent in position, the similar level (being sequence homology, similarity or identity) between two or many nucleic acid.
Should understand; Although this promotor and the function thereof that derive from Arabidopis thaliana are provided in the instance of the present invention; Yet; The promotor that has certain homogeny (conservative property) with this promotor that derives from other similar plant is also included within the scope of the present invention, as long as those skilled in the art can separate from other plant easily and obtain this promotor having read the information that provides according to the application behind the application.
Start destination gene expression
Promotor of the present invention can be operatively connected on the goal gene, and this goal gene can be external source (allos) for promotor.Nucleotide sequence to said goal gene has no particular limits (like a kind of structural nucleotide sequence), and described goal gene optimized encoding has the albumen of specific function, and for example some has the albumen of key property or function in agricultural or plant improvement.
Promotor of the present invention can also be operably connected on the target gene sequences that is modified, and this goal gene is external source (allos) with respect to promotor.Described goal gene can be modified and produce various desired characteristics.For example, goal gene can be modified increases contents of essential amino acids, improves the translation of aminoacid sequence; Change the modification (like phosphorylation site) after translating; Outside the translation product transporte to cells, improve proteic stability, insert or delete cell signal etc.
In addition, promotor and goal gene can be designed to reduce specific gene.This generally is to realize that through promotor is connected on the target gene sequences this sequence oppositely is directed with antisense.Those of ordinary skill in the art is familiar with this antisense technology.Any nucleotide sequence can be conditioned by this way.
Any aforesaid promotor and/or target gene sequences can be comprised in the recombinant vectors.
As a kind of mode, described recombinant vectors comprises promotor of the present invention, comprises MCS or at least one restriction enzyme site in the downstream of said promotor.When needs are expressed goal gene, goal gene is connected in the suitable MCS or restriction enzyme site, thereby goal gene is operably connected with promotor.
As another kind of mode, described recombinant vectors comprises (from 5 ' to 3 ' direction): promotor, and goal gene.If desired, described recombinant vectors can also comprise 3 ' transcription terminator, 3 ' polymerized nucleoside acidifying signal, other untranslated nucleotide sequence, transhipment and target nucleotide sequence, resistance selective marker, enhanser or operator.
The method that is used to prepare recombinant vectors is well known in the art.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral or other carriers.In a word, as long as it can duplicate in host and stablize, any plasmid and carrier all are can be adopted.
Method well-known to those having ordinary skill in the art can be used to make up the expression vector that contains promotor of the present invention and/or target gene sequences.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, like Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein (GFP) etc.
Except containing promotor of the present invention, also can contain one or more other promotors in the recombinant vectors.Described other promotor for example is: tissue-specific, composing type or induction type.For example the cauliflower mosaic virus 19S of mannosaminic acid synthetic enzyme and 35S (CaMV19S CaMV35S), enhanced CaMV, tobacco RB7 etc.
Comprise the above-mentioned suitable promotor and the carrier of goal gene, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, like bacterial cell; Or eukaryotic cell such as low, like yeast cell; Or higher eucaryotic cells, like vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell etc.Persons skilled in the art all know how to select appropriate carriers and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method, rataria conversion method, bud infusion method etc.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thereby obtain genetically modified plant.
As a kind of mode, the method for preparing transgenic plant is: the carrier that will carry promotor and goal gene (both are operably connected) changes Agrobacterium over to, and the carrier segments that Agrobacterium will contain promotor and goal gene again is incorporated on the karyomit(e) of plant.The transgene receptor plant that relates to for example is Arabidopis thaliana, tobacco, fruit tree etc.
In instance of the present invention; Described recombinant vectors is the PBI101 binary vector, and it carries beta-glucosidase (GUS) gene, promotor of the present invention is building up to the upper reaches of gus gene in this carrier; Transformed plant; Promotor will activate the expression of gus gene, and said startup receives the regulation and control of each cis-acting elements of promoter region, simulate the situation that gene is activated in vivo and transcribes.
In instance of the present invention, the inventor finds, under the startup or guidance of described promotor, gus gene is expressed specifically in senescence process of plant.Therefore visible, promotor of the present invention is the old and feeble signal of a kind of response and behind received signal, starts goal gene generation expression promoter.Described promotor is useful especially for the quality of improvement plant in senescence process of plant.The a series of beta-glucoside of beta-glucosidase (GUS) ability catalytic pyrolysis produces the material with chromophoric group or fluorescence, and methods such as available spectrophotometer, photofluorometer or histological chemistry are carried out quantitatively and the spatial positioning analysis the GUS activity.In the art, gus gene has been widely used as the reporter gene of transgenic plant, bacterium and fungi, and particularly it can be used to study the concrete cell and the tissue site of exogenous gene expression.
Use
Senescence-specific promotor of the present invention has important use and is worth in theory research and agronomy improvement.
The present invention can be widely used in plant genetic engineering: promotor can merge with target gene as important tool in the plant genetic engineering, through transgene carrier, transforms plant and obtains transfer-gen plant.Growth along with the plant age; This promotor just can start the expression of downstream targets gene (can be interested any functional gene that can change economical character); And along with senescence process progressively improves this expression of gene amount, thereby reach purpose at a certain functional gene expression amount of artificial control of old and feeble stage.
On farm crop produced, some crop leaf was prone to take place presenility, and the cooperation of plant integral light is descended with level, and photosynthate reduces, and causes low, the poor quality of crop yield.Cause setting percentage low like some hybrid rice in the early ageing of development later stage blade and function, sterile grain rate is high, has had a strong impact on the further performance of hybridisation rice yield potential.This promotor can merge (like the gene on phytokinin, the growth hormone pathways metabolism with the genes involved that suppresses aging; External source prenyltransferase (ipt) etc.); Transform plant, provide and prolong the gene that declines, thereby delay the The Plant Senescence process along with the just regulation and control of senescence process.Can be widely used in fresh-keeping of vegetables and prolonging of reward leaf plant declines.
In addition, the carrier construction method of this promotor is provided among the present invention, and in plant materials, has confirmed the feasibility that this promoter regulation downstream gus gene is expressed under old and feeble signal induction.For further this promotor of research and aging phenomenon provide the foundation.
Major advantage of the present invention is:
(1) promotor of the present invention belongs to the Idiotype promotor.It is in the naturally-aged process; Respond old and feeble signal; Just start downstream gene expression, and very low in stage that does not senesce and organ expression amount, foreign gene is effectively played a role in plant materials; Simultaneously reduce the disadvantageous effect to plant again, utilizing the genetic expression of senescence-specific promoter regulation is a good approach.
(2) owing to senescence-specific, promotor of the present invention can be used for old and feeble relevant research, and application widely is being provided aspect the delay plant aging.
(3) promotor of the present invention has response rapidly, and the characteristic of strengthening along with the senescence process function.Be that plant is older and more feeble, the downstream gene expression amount of this promoter regulation is high more.
(4) this gene also can drive downstream gene expression in dark inductive excised leaf.Along with the prolongation of dark induction time, expression amount is significantly improved.These characteristics can be used for the stripped storage of vegetables.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to people such as normal condition such as Sambrook; Molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press; 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
I. material and method
1 promotor clone and vector construction
With the arabidopsis thaliana genomic dna is template; Design forward primer AtPaO_GUS_FP2 ': 5 ' CTCGAGTTGTTGCGGTGGTC 3 ' and reverse primer AtPaO_GUS_RP2:5 ' CGTCGAATCCGAAGTGGGTA 3 ' amplifies the dna fragmentation of the At3g44880 initiator codon ATG about 2kb in the upper reaches through the method for PCR.
With the promoter sequence connection carrier pMD19-T Vector (available from TAKARA) of amplification, will be connected to again on the pMD19-T Vector promoter fragment with contain gus reporter gene carrier pBI101.3 and carry out enzyme with restriction enzyme XhoI+XbaI and Sal I+XbaI respectively and cut.The recovery enzyme is cut product and is connected with the T4 dna ligase.
The acquisition of 2 transgenic plant
The carrier that builds is transformed agrobacterium strains C58 (available from the University of California).The acquisition of transgenic plant is soaked method through the flower of routine.Screen transfer-gen plant containing on the MS substratum of 50ug/ml kantlex.
The 3GUS histochemical stain
The blade of the different treatment of transgenic plant is taken off, is placed in the centrifuge tube, add an amount of GUS staining fluid in 37 ℃ of incubated overnight, the ethanol decolorization with 70% 2-3 time, manifest white to control material till.Naked eyes or microscopically are observed GUS expressive site (blueness is the GUS expressive site), and through the photographic recording coloration result.
II. embodiment
The amplification of embodiment 1, promotor, clone and sequential analysis
With the arabidopsis thaliana genomic dna is that template is carried out pcr amplification, obtains the DNA cloning product of an about 2093bp, is connected on the pMD 19-T Vector, and through order-checking, the result is correct.The complete sequence of promotor is shown in SEQ ID NO:1.
This sequence is the promotor of chlorophyll degradation pathway key enzyme AtPaO in Arabidopis thaliana.Therefore, through the Realtime PCR method of routine, detect the expression of AtPaO under dark inductive condition.
The result finds that under dark inductive condition, AtPaO expression of gene amount raises with secretly inducing fate to increase, and sees Fig. 1.Therefore, the promotor of visible AtPaO gene is the senescence-specific promotor.
The structure of embodiment 2, promotor plant expression vector
Reclaim the promoter sequence of 2Kb earlier with Xhol I and BamH I double digestion; Use Sal I and BamHI double digestion pBI 101.3 (available from Takara) again, reclaim big fragment, two fragments of recovery connect; Transformed into escherichia coli; The extracting plasmid also carries out enzyme and cuts evaluation, and promotor correctly is connected into carrier pBI101.3, obtains pBI101.3-Promoter-GUS.
With the electric shock conversion method recombinant vectors pBI101.3-Promoter-GUS is transformed among the Agrobacterium C58, through pcr amplification, the agarose gel electrophoresis 1% is identified the 2Kb band of having an appointment, and proves that the pBI101.3-Promoter-GUS carrier has changed among the Agrobacterium C58.
The acquisition of embodiment 3, transfer-gen plant
Use agriculture bacillus mediated genetic transformation and got 10 transfer-gen plants, PCR identifies that the result shows that most of strains are all can produce the fragment that size is about 2Kb, proves that the promoter fragment that merges with gus gene has been integrated in the arabidopsis gene group.
Analyze through the GUS histochemical stain, find to have 6 strain systems to carry promotor and GUS mosaic gene, these plant that under the kalamycin resistance screening conditions, obtain all can normal growth.
Embodiment 4, transfer-gen plant naturally-aged are regulated GUS coloration result down
This promotor that has made up and reporter gene GUS fusion vector, arabidopsis thaliana transformation obtains 6 strain systems of transformed plant, and under the naturally-aged condition, carry out the GUS coloration result and show: in the young tender blade, it is very shallow to dye, even does not have; And along with the growth dyeing of leaf age is more and more darker.As shown in Figure 2, comprise for the whole lotus throne leaves of Arabidopis thaliana from left to right: 2 cotyledons, the 1st true leaf, the 2nd true leaf, the 3rd true leaf ... the 10th true leaf, the GUS coloration result also presents variation tendency from shallow to deep.
Prior art is known, the lotus throne leaf of Arabidopis thaliana is not simultaneously old and feeble, but press leaf age progressively aging successively, and senescing from cotyledon is the 1st true leaf then, the 2nd true leaf ... to the 10th true leaf.
As shown in Figure 3: in the blade of beginning naturally-aged, the blade of jaundice is darker than being still green blade GUS dyeing; And with a slice leaf, beginning out old and feeble position at first is blade tip and limb edge, and these positions are observed at first by the GUS dye liquor and dyed blueness, even the observable tangible flavescence sign of naked eyes does not also appear in blade as yet.Above phenomenon also further specifies the susceptibility that this promotor responds old and feeble signal.
Embodiment 5, secretly induce down blade GUS coloration result
Dark startup as leaf senile is regulated, and induces excised leaf also can improve the expression of this promotor downstream gus gene with dark.
The Arabidopis thaliana plant is placed dark surrounds; Result such as Fig. 4; With 21 days transgenic plant blade of dark processing, and carry out the GUS staining analysis and find, the dyeing of 0 day blade of dark place reason is not obvious; Begin after 2 days to can be observed GUS dyeing at blade edge and secretly induce, 4 days most of positions of blade begin to observe gus gene and express.
All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
< 110>Shanghai Inst. of Life Science, CAS
< 120>a kind of plant senescence-specific promotor and application thereof
<130>102577
<160>1
<170>PatentIn?version?3.3
<210>1
<211>2093
<212>DNA
< 213>Arabidopis thaliana (Arabidopsis thaliana)
<400>1
ctcgagttgt?tgcggtggtc?aagtgatccc?tgacaggctg?caaaatccac?attattgggc 60
tgcatcgtga?aaagtgaatg?gtcaaatgat?tccctgcata?ggcttatagt?attaaaatat 120
gataattatg?tttattagtt?aatgtattcg?aaaatttgtt?taataaaacg?tggccaatat 180
gtttattaat?actagcaata?ctcaaaccct?caatggcaag?ccgattgata?gatataaata 240
agcacaaagg?cttgaaacta?aaacattcat?cacatcctca?cgcacatata?aagaaatcat 300
cacaagacag?gagttaaaag?agagacatgt?cgacttcatt?cacaatgatc?ggtggtgaag 360
gtcccaacag?ttaccgagac?cattcgaaat?accaggttta?cttattaaca?tatacacaca 420
aaaaaacttt?taaatcatct?ttttatagct?tgagatattg?attgcaaaac?atttatggtg 480
tatagggagc?attggttgaa?gctgcaaagg?aaaagatcaa?tgaagccatc?tctacgaaac 540
tcgatatcga?ctttacttca?aatcttgtta?acatagcaga?ttttggttgc?tcttctggac 600
caaacacttt?cacagcggtg?caaaccttaa?tcgatgctgt?ggaaaacaag?tataagaaag 660
aaagtaatat?cgagttccaa?gttttcttca?atgattcttc?gaacaatgat?ttcaacactc 720
ttttcaaaac?acttcctccg?gctagactgt?atttcgcaag?tggagtaccg?ggttctttct 780
ttggtcgtgt?tcttcctaga?aatagtctcc?atttgggagt?ttctgcttac?tcactccatt 840
tcatatccaa?gattcccaaa?gaagttaaag?atcgtgattc?tcctgtgtgg?aacaaggaca 900
tacattgctc?tggatcttca?aaagaggtag?caaaattgta?tcttggtcaa?tacaagatcg 960
atgtggggag?tttcttgaac?gcgagagcgc?aagagcttgt?gtccggtgga?ttgctattgc?1020
ttcttggttc?atgtcgtcca?aatggagttc?aaatgtttga?aacggttgaa?ggcatgatga 1080
ttgattttat?tggagcttct?cttaatgaaa?ttgctaacca?ggtacttcaa?tctcataaaa 1140
cactagttac?tcgtttgatc?attacattat?actaataaat?ccatactaac?atgttatgtt 1200
tttggctgtc?tgttcaaaag?ggtctaatag?atcaacaaaa?gcttgacact?tttaagttgc 1260
ctatctatgc?tccacaagcg?gatgaattga?agcaaatcat?cgaggataac?gggtgtttca 1320
cgattgaggt?attcgaaaat?attatacacg?ccaagggaga?gtatccgtta?gaccccgagt 1380
ttttaacagt?ctcctttaag?gtcacggttg?gaggatcagt?agcttcacta?tttgggcaag 1440
atggtatgga?gaaaaccttt?gagcttgtga?aagagaagac?acaagaaatg?cttcctcaga 1500
tagccaaagc?caaacccgga?atgcaatacc?tcattgtgct?tcgaagaaac?tgttttcatg 1560
atctatttag?atctttgaaa?cgagacttaa?ataatgtaat?tgcaatgatg?tgtgtttgtg 1620
tgtgtatgtg?ttgtattgtt?tgttatttta?aatagtctct?ttcgtttatg?tatatcacaa 1680
atacatatca?caacgttcat?atttgcaatg?tgccaaaatc?ctccacgtgt?taaatccatt 1740
tgttcatagt?ttctcgttac?aagacaacaa?atggtatcaa?tgtccacgga?aaaattgcat 1800
acttgcacgc?aatctcttct?tcttcttctt?cgttcttctc?gtagcttgaa?ataagattca 1860
tcagaagagt?aaataaacat?caaaatccaa?caaaccaaac?tagaaaaatg?tcagtagttt 1920
tactctcttc?tacttctgca?acaatcacca?aatcccaatc?caaaaagatt?ccctttttat 1980
ctcccaccac?aaaattccca?ttaaaggtct?caatttctcc?atcaagatcg?aaacttttcc 2040
acaacccttt?acgcgtggcg?gcgccgccgt?ctgtacccac?ttcggattcg?acg 2093
Claims (9)
1. isolating plant senescence-specific promotor is characterized in that described promotor:
(a) being positioned at 5 ' of pheophorbide oxydase encoding sox holds and the upper reaches;
(b) have necessary site and the transcripting start point that initiation is transcribed; And
(c) has response plant senescence signal and start the specific expressed function of goal gene;
Described promotor is the promotor of the nucleotide sequence shown in the SEQ ID NO:1.
2. promotor as claimed in claim 1 is characterized in that, described pheophorbide oxydase derives from Arabidopis thaliana.
3. promotor as claimed in claim 1 is characterized in that, (a) in, be positioned at the pheophorbide oxydase upper reaches-1907 the 186th to the coding region.
4. a carrier is characterized in that, described carrier contains the arbitrary described promotor of claim 1-3.
5. carrier as claimed in claim 4 is characterized in that described carrier also contains the goal gene that is operably connected with described promotor.
6. a genetically engineered host cell is characterized in that, described cell:
Contain the described carrier of claim 5; Or
Be integrated with the described promotor of claim 1 of external source in its genome.
7. the method that goal gene is expressed in senescence process of plant is characterized in that, described method comprises:
With the construction transformed plant cells, the goal gene that described construction contains the arbitrary described promotor of claim 1-3 and is operably connected with described promotor;
Filter out and changed the vegetable cell that is integrated with said construction in said construction or the karyomit(e) over to; With
With said vegetable cell regeneration plant, goal gene is expressed in senescence process of plant in the said plant.
8. method as claimed in claim 7 is characterized in that, described method comprises:
(a) Agrobacterium of carrying expression vector is provided, contains construction in the said expression vector, the goal gene that described construction contains the described promotor of claim 1 and is operably connected with described promotor;
(b) vegetable cell, tissue or organ are contacted with Agrobacterium in the step (a), thereby make described construction change vegetable cell, tissue or organ over to;
(c) select vegetable cell, tissue or the organ that has changed said construction over to; And
(d) vegetable cell, tissue or neomorph in the step (c) are become plant, goal gene is expressed in senescence process of plant in the said plant.
9. the purposes of the arbitrary described promotor of claim 1-3 is characterized in that, described promotor is used for responding the plant senescence signal and starts goal gene to be expressed at senescence process of plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010190818 CN102268433B (en) | 2010-06-01 | 2010-06-01 | Plant aging specific promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010190818 CN102268433B (en) | 2010-06-01 | 2010-06-01 | Plant aging specific promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102268433A CN102268433A (en) | 2011-12-07 |
| CN102268433B true CN102268433B (en) | 2012-12-19 |
Family
ID=45050894
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010190818 Expired - Fee Related CN102268433B (en) | 2010-06-01 | 2010-06-01 | Plant aging specific promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102268433B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949764B (en) * | 2018-09-03 | 2021-09-14 | 中国农业科学院烟草研究所 | Dark and aging specific induction promoter, engineering vector and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1763197A (en) * | 2004-09-02 | 2006-04-26 | 高丽大学校产学协力团 | Novel plant senescence-specific gene and its promoter |
| CN101358193A (en) * | 2008-08-08 | 2009-02-04 | 华中农业大学 | Identification of specificity promoter for rice leaf senescence |
-
2010
- 2010-06-01 CN CN 201010190818 patent/CN102268433B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1763197A (en) * | 2004-09-02 | 2006-04-26 | 高丽大学校产学协力团 | Novel plant senescence-specific gene and its promoter |
| CN101358193A (en) * | 2008-08-08 | 2009-02-04 | 华中农业大学 | Identification of specificity promoter for rice leaf senescence |
Non-Patent Citations (2)
| Title |
|---|
| Tomoe Kamada-Nobusada et al..A Putative Peroxisomal Polyamine Oxidase, AtPAO4, is Involved in Polyamine Catabolism in Arabidopsis thaliana.《plant cell》.2008,第49卷(第9期),1272-1282. * |
| 李鹏丽 等.大豆GmLls1基因的克隆及表达调控分析.《科学通报》.2006,第51卷(第9期),1034-1041. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102268433A (en) | 2011-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103820445B (en) | The qualification of one plant anther specific expression promoter and application | |
| CN101503691B (en) | Plant epidermal hair specific expression promoter F1F1 and use thereof | |
| CN102465128B (en) | Anther specific expression promoter and application thereof | |
| CN103130885B (en) | Malus sieversii (Ledeb.) Roem-derived plant growth-related protein, and coding gene and application thereof | |
| CN112457380A (en) | Protein for regulating and controlling content of fruit shape and/or fruit juice of plant, related biological material and application thereof | |
| CN108707605B (en) | GSM2 promoter induced to express by adding exogenous sugar | |
| CN102465114A (en) | Identification and application of specific expression promoter of plant root | |
| CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
| CN103667296A (en) | Constitutive expression promoter and application thereof | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN102268433B (en) | Plant aging specific promoter and application thereof | |
| CN101565702B (en) | GIF1 promoter and use thereof | |
| CN104109682B (en) | A kind of pectin lyase BnPL gene and promoter thereof and application | |
| CN103788187B (en) | Flowering of plant associated protein GmSOC1-like and encoding gene thereof and application | |
| CN101245349B (en) | Plants leaf all-level vein and tillering base section special expression promoter and application | |
| CN104975024B (en) | The identification and application of plant anther specific expression promoter pTaASG042 | |
| CN105039338B (en) | The identification and application of plant anther specific expression promoter pTaASG004 | |
| KR101494191B1 (en) | Promoter for directing the guard-cell specific expression | |
| CN104087587A (en) | Plant drought stress induction expression promoter and application thereof | |
| CN105316334B (en) | The identification and application of plant anther specific expression promoter pTaASG019 | |
| CN102676457A (en) | Function and application of flower-specific expression promoter KT631P | |
| CN112646813B (en) | Isolated nucleic acid molecules and uses thereof | |
| KR102390866B1 (en) | Constitutive promoter derived from chrysanthemum and use thereof | |
| CN107142262B (en) | Rice seed specific promoter Posseed and application thereof | |
| CN104975025B (en) | The identification and application of plant anther specific expression promoter pTaASG033 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121219 Termination date: 20160601 |