CN107142262B

CN107142262B - Rice seed specific promoter Posseed and application thereof

Info

Publication number: CN107142262B
Application number: CN201710500111.2A
Authority: CN
Inventors: 李�浩; 杨剑波; 杨亚春; 秦瑞英; 李娟�; 李莉; 许蓉芳
Original assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Current assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Priority date: 2017-06-27
Filing date: 2017-06-27
Publication date: 2020-08-11
Anticipated expiration: 2037-06-27
Also published as: CN107142262A

Abstract

The invention provides a rice seed specific promoter Posseed and application thereof. The rice seed specific promoter comprises a DNA sequence shown as SEQ ID No. 1 in a sequence table. The DNA sequence shown in SEQ ID No. 1 of the sequence Listing is derived from Oryza sativa L cv. Nipponbare, and is referred to herein as Posseed or promoter Posseed. The invention also provides an expression cassette, a plant expression vector and a host bacterium containing the promoter. Specifically, the promoter is applied to plant transgenic engineering. The promoter provided by the invention can start the expression of the exogenous gene in the plant, is suitable for any plant, and particularly can drive the specific expression of the exogenous gene in the seed of the rice plant, so that the promoter can be used for cultivating an ideal rice variety or used in bioreactor research.

Description

Rice seed specific promoter Posseed and application thereof

Technical Field

The invention relates to the technical field of biotechnology and plant genetic engineering, in particular to a rice seed specific expression promoter and application thereof.

Background

A promoter is a DNA sequence located in the upstream region of a gene, and is an important component in genetic engineering. Promoters commonly used in plant genetic engineering can be classified into three categories according to their mode of action and their function: the constitutive promoter drives the continuous and constant expression of the exogenous gene in each development stage and each tissue of the plant, and the difference of expression quantity caused by the difference of time and space can not be caused; the tissue-specific promoter can only regulate the expression of genes in certain specific organs or tissue parts, so that the expression products of target genes can be accumulated in a certain space; inducible promoters generally do not initiate transcription or have very low transcriptional activity, but can significantly increase transcriptional activity under stimulation by certain specific physical or chemical signals. At present, the constitutive promoter is widely applied, but some problems are gradually exposed in the application, for example, the constitutive promoter enables an exogenous gene to be expressed in the whole plant to generate a large amount of exogenous protein or metabolite, breaks the original metabolic balance of the plant, increases the burden of the plant, influences the shape and normal growth and development of the plant, even leads to the death of the plant and causes unnecessary waste of resources. Under the control of tissue-specific promoters, gene expression often occurs only in certain specific organs or tissue sites, avoiding unnecessary waste of plant nutrients. The tissue specific promoter is utilized to improve metabolic pathways according to the will of people, the content of nutrient substances in tissues is improved, and industrial new products, new medical compounds and the like are obtained more conveniently. Therefore, tissue-specific promoters have become the most promising promoter elements for foreign genes in transgenic research.

Rice is one of the most important food crops in the world. The seeds are the most important nutrition storage organs of the rice and have important economic value. The seed specific promoter cloned at present is mainly the promoter of related enzyme genes in anabolic pathways such as protein, amino acid, starch, lipid and the like of grain crops and oil crop seeds, such as glutelin and prolamin gene promoters of rice; a promoter of ADP-glucose pyrophosphorylase of rice. GluB-1 promoter is widely applied in plant genetic engineering. The method is mainly used for driving some soybean genes to express in rice to improve the quality of the rice. The ferritin contained in rice grains is mostly accumulated in an aleurone layer and is easy to lose in grain processing, so that the ferritin can be accumulated in the endosperm of transgenic rice and is difficult to lose by using the endosperm-specific glutelin gene promoter to drive the expression of a soybean ferritin gene in the rice, and the iron content of the rice is increased. Xue et al use GluB-1 gene promoter to synthesize cellulase in large quantities, so seed specific promoter can also be applied to bioreactor research. The number of seed-specific promoters which can be used for rice transgenosis at present is still small, so that a new rice seed-specific promoter is obtained, and the promoter has a promoting effect on research and development of new rice varieties and development of plant genetic engineering.

Disclosure of Invention

The invention aims to provide a promoter for driving a foreign gene to be specifically expressed in rice seeds, a transformant obtained by the promoter and application of the promoter.

In order to achieve the above object, in one aspect, the present invention provides a rice seed-specific promoter comprising a DNA sequence shown by SEQ ID No. 1 of the sequence Listing. The DNA sequence shown in SEQ ID No. 1 in the sequence Listing is a rice seed-specific expression promoter derived from Nipponbare (Oryza sativa L cv. Nipponbare), and is referred to herein as Posseed or promoter Posseed.

In another aspect, the present invention provides a rice seed specific promoter having a DNA sequence at least 80% homologous to the DNA sequence shown in SEQ ID No. 1; or the rice seed specific promoter is a mutant or allele or derivative generated by adding, substituting, inserting or deleting one or more nucleotides in the DNA sequence shown in SEQ ID No. 1; or the rice seed specific promoter has a product hybridized with the DNA sequence shown in SEQ ID No. 1. The rice seed specific promoter sequences have the same functions as the DNA sequences shown in SEQ ID No. 1, namely driving the specific expression of target genes in plants.

On the other hand, the invention also provides an expression cassette, a recombinant expression vector and a host bacterium which comprise the rice seed specific promoter.

In another aspect, the invention provides the application of the rice seed specific promoter in culturing transgenic plants. The application comprises the steps of connecting the rice seed specific promoter provided by the invention to the upstream of a gene sequence to be expressed of a vector (for example, placing the promoter sequence in front of a target gene) so as to construct a recombinant expression vector, and transforming the recombinant expression vector into plant cells, tissues or organs for cultivation.

And preferably, the application can be used in breeding of desirable rice varieties and bioreactor applications. Specifically, the content of the protein in the rice endosperm reaches more than 80%, so that rice seeds can be used as a bioreactor to express a large amount of specific protein in the rice seeds. For example, the promoter is used for driving genes such as ferritin and the like, is used for improving the ferritin content of seed seeds and the like, and can also be used for driving cellulose genes, immune proteins and the like to be expressed in large quantities in rice endosperm, and then the components are separated and purified from the rice endosperm.

In concrete practice, the present inventors isolated and cloned a DNA sequence whose structure includes 2034bp upstream of the transcription initiation site from Oryza sativa L cv. Nipponbare, and named it as Posseed (SEQ ID No:1 in the sequence Listing). The sequence is connected to a plant binary expression vector pCAMBIA1381 after enzyme digestion to obtain a corresponding recombinant plasmid (namely a recombinant expression vector) for driving the expression of GUS genes. The recombinant plasmid is used for transforming agrobacterium tumefaciens strain EHA105, and then the agrobacterium-mediated method is used for transforming rice to obtain transgenic rice plants. Histochemical detection of the obtained transgenic rice shows that the seeds of the transgenic plants have obvious GUS staining but no staining in other tissues, thereby proving that the 2034bp sequence has the activity of driving the expression of genes in the seeds.

Technical effects

The rice promoter Posseed cloned by the invention can regulate and control the specific expression of a target gene in seeds, but does not express the target gene in other tissues of other plants, and has obvious value in practical application. The promoter is used for carrying out gene modification on crop varieties, for example, the promoter replaces constitutive promoters such as 35S and the like, and the expression of a target gene in a plant is regulated and controlled, so that ideal transgenic rice varieties are cultivated, for example, the development speed of seeds is improved, the protein and starch content in rice is changed, or the promoter is used in a bioreactor to express and produce proteins in a large scale.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a schematic representation of the construction of the Posseed promoter in the pCAMBIA1381 vector plasmid, wherein A is a schematic representation of pCAMBIA1381 and B is a schematic representation of pCAMBIA 1381-Posseed;

FIG. 2 is a schematic diagram showing the results of enzyme digestion verification of the promoter of the present invention.

FIG. 3 is Posseed:GUStransgenic rice plant tissue staining diagram. After 24 hours GUS staining, roots (a), stems (B), leaves (C), leaf sheaths (D) and flowers (E) all had no GUS activity, whereas GUS was strongly expressed in both embryo and endosperm (F) of the seeds (scale ═ 2.5 mm).

FIG. 4 is a graph showing the result of staining of the promoter-driven gus gene in example 2. The GUS gene is obviously observed in blue (F) in the embryo and endosperm of immature seeds of the transgenic rice, and the expression of the GUS gene is not detected in roots (A), stems (B), leaves (C), leaf sheaths (D), flowers (E) and mature seeds of other organs.

Detailed Description

The invention is illustrated below with reference to specific examples. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.

Step 1, extracting DNA of Nipponbare genome of wild rice

Wild type Nipponbare genomic DNA is extracted according to the method provided by the Tiangen kit.

Step 2, obtaining a promoter Posseed and constructing a plant expression vector

According to the whole genome sequence of a rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided in NCBI, an amplification primer is designed according to the sequence of a rice Posseed promoter, and the enzyme cutting site of the primer is designed according to the characteristics of a selected carrier and a target gene. The specifically designed primers are: the 5 'end of the forward primer (SEQ ID No:2) is provided with HindIII, the enzyme cutting site (AAGCTT), the 5' end of the reverse primer (SEQ ID No:3) is provided with SalI and the enzyme cutting site (GTCGAC), the primers are synthesized by Shenzhen Huada gene company, and the sequences are as follows:

a forward primer:AAGCTTAGTACCGTACCACTCTTTCTCG HindIII

reverse primer:GTCGACCGATCGGTCCCTAGTACGCACT SalI

the method is characterized in that DNA of a rice variety Nipponbare is used as a template, a forward primer and a reverse primer are used for amplifying a promoter Posseed, and the following amplification program is adopted according to a conventional PCR system:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min for 30s, 35 cycles; finally, extension is carried out for 10min at 72 ℃.

Recovering a target fragment amplified by PCR, wherein the length of the target fragment is 2034bp, connecting the target fragment to a PGEM-T-Easy vector (purchased from Promega corporation and mixed according to the proportion in the vector specification), transforming escherichia coli XL-Blue competent cells according to a heat shock method, obtaining positive clones by colony PCR screening, selecting monoclonal shake culture solution to extract plasmids, and performing double enzyme digestion verification by HindIII and SalI, as shown in figure 2. The identified positive clones were sent to Invitrogen for sequencing. The correct clone is verified to be the promoter Posseed to be obtained, and the nucleic acid sequence of the promoter Posseed is shown as SEQ ID No. 1.

Recovering a promoter Posseed fragment, performing linearization treatment and recovering a pCAMBIA1381 vector fragment by utilizing HindIII and SalI, connecting the Posseed fragment and the pCAMBIA1391 fragment by using T4 ligase (purchased from TaKaRa), obtaining a plant expression vector pCAMBIA 1381-Possed (figure 1) with the promoter Posseed and GUS gene fused, transferring the plant expression vector into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (rice group preservation of a transgenic biological product supervision test center of agricultural department of agricultural academy of agricultural sciences, Anhui) by utilizing a freeze-thaw method, and obtaining positive clone by colony PCR screening to obtain the Agrobacterium containing pCAMBIA 1381-Posseed.

Step 3, obtaining positive transgenic plants

Removing glumes of mature seeds, soaking the seeds in 70% alcohol for 1min, and pouring off the alcohol. Seeds were soaked for 40min (150r/min) with 1 drop of Tween 20 in 50% sodium hypochlorite (stock solution available chlorine concentration greater than 4%). And pouring off sodium hypochlorite, and washing for 5 times by using sterile water until the solution is clear and has no sodium hypochlorite taste. The seeds were soaked in sterile water overnight. The embryos were detached along the aleurone layer with a scalpel seed and inoculated onto callus induction medium. And after dark culture for 11 days at the temperature of 30 ℃, separating the callus from endosperm and embryo, and pre-culturing the primary callus with good bud removal state and vigorous division for 3-5 days for agrobacterium transformation.

Agrobacterium tumefaciens transformed with the recombinant expression vector in step 2 above is used to perform Agrobacterium-mediated genetic transformation, and 24 pCAMBIA1381-Posseed positive plants are obtained by genetic transformation, transformant selection and transgenic Plant regeneration, etc. according to methods proposed by Yongbo Duan (Yongbo Duan, Chenguang ZHai, et al. an infection and high-throughput protocol for Agrobacterium mediated transformation on a photomananoses assay selection in Japonica rice (OrySativa L.) [ J ]. Plant Cell Report, 2012.DOI 10.1007/s00299-012 and 1275-3.).

Step 4, identifying the activity of the rice seed specific promoter

Tissue organs of the Posseed GUS transgenic plant, namely roots, stems, leaves, leaf sheaths, flowers and seeds, are respectively subjected to GUS staining. With reference to the method proposed by Jefferson (Jefferson RA et al. GUS fusion:. beta. -Glucuronidase as sensitive and versatile gene fusion marker in highher plant [ J ]. EMBO J., 1987, 6: 3901-. Decolorizing with 75% ethanol to remove chlorophyll from the tissue. The results of GUS staining were then observed and recorded under a dissecting microscope. As shown in FIG. 3, the blue color was clearly observed in the embryo and endosperm (FIG. 3F) of mature seeds of transgenic rice, and the expression of the GUS gene was not detected in the root (A), stem (B), leaf (C), leaf sheath (D) and flower (E) of each of the other organs.

Example 2

In this example, the inventors of the present application found and verified another seed promoter, and found that the promoter has a specific expression stage.

The sequence of the promoter is as follows:

the inventors of the present application also performed similar verification on the promoter with reference to steps (1) to (4) in example 1 described above.

Namely, step 1, extracting DNA of a Nipponbare genome of wild rice;

step 2, obtaining a promoter and constructing a plant expression vector;

step 3, obtaining positive transgenic plants;

and 4, identifying the activity of the rice seed specific promoter.

The results of the Gus gene test of this example are shown in fig. 4. The experimental procedure used in the validation experiments in this example was exactly the same as in example 1 except that the sequence of the promoter to be validated was changed.

The applicant found that it could successfully drive the specific expression of Gus gene during the development phase, especially the grain filling phase, of rice, and once the rice seeds entered the maturity phase, the expression specificity disappeared.

The above embodiments are merely preferred examples to illustrate the present invention, and it should be apparent to those skilled in the art that any obvious variations and modifications can be made without departing from the spirit of the present invention.

Sequence listing

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> rice seed specific promoter Posseed and application thereof

<130>HCI20170105

<160>3

<170>PatentIn version 3.3

<210>1

<211>2034

<212>DNA

<213> Rice seed-specific promoter

<400>1:

agtaccgtac cactctttct cgttctttcc ttgaccggtt caaatgtact gtgccggtac 60

aaacaaacaa acgaacaaag tatgaattcc aagcctctag gttctaacta ctcatccatc 120

acataaaaaa acaataactt gaattccaaa tccatgacca tgaagatatc ctttcatgca 180

ttcacacatt tcaggacctc ctttggaata ggggaattgt tagaggatta tacaattcca 240

actaattaac ggcatggtac gctgtcaatt gttcggtact actccatgtc catgtccatg 300

tccatgtcca gcagaaatta agtcatgtca gtttcagtgc tctttgttag actactgtat 360

tttgtaagca ctcaacacta accacaagag tagcagagac cttggtggtg gactactccg 420

cgtgaaagtc agtaggccgg ccgttagtgt acaagagatt tgcttgattt tcctctgcat 480

gtccggttgt ccaccctctg aaatggggaa cagagacagt agccatagac gtctcgtcaa 540

cgcagaggcg aggcgaccat tcaagtcgag tcgtccaccg aggagaccac acacctcatc 600

tccctgatca attggctgag cagttcgcta tagccagtgc ttgttccatt ttaaaatata 660

agagatttta aacgtggata taacatatta taatattttt atttaaattc gtaatattaa 720

aatatatctt atttatttaa aattatttat attttggacg gagggagagc taggtttgcg 780

gaaattttca atagcctcat gggcagacaa gttaaagcaa gttatctaag agaaaaggtt 840

aaagtagtta cagtcacatt ataaagttct gttaaacaac ttgcagcaga ttcggcccat 900

ctgcaaagtg ccattgttaa gcagcatata ctaatactcc tactatgtga tttgctattt 960

gacgcgtggg cctactagcc gtacgaaata aagtcgtatt ggacgcgtag ctatgttgct 1020

tctacgtctg cttcgtcatg gttcgtttcg ttcgtacgca gggaatcaag catatgataa 1080

ccactggaat agtaacggta atagcaatgg ctagagggag ctccagtggc ctgtgcgaag 1140

catacggaat ccgaatagca gcaacctcct tcagagatag acgtactgta cgtacttgcc 1200

atcaactaag cagtttcagt gaaacttcca ccatgcttta atgctttgcc tgatcccaga 1260

ttcccagact tcagtgcaac acccgggaaa attcggactc gccgcactcg ctgcaactcc 1320

tagcatgtgt ttagattggc ccaaagttta gaatttggtt gaaattaaag acgatgtgac 1380

tgaaaagtta tgtgtgtatg aaaggtttga tgtgatggaa agttgaaagt ttaaaaaaaa 1440

aaactttgga acacacagta gctcgcaagg cgccattccg ccgaattgct taggcaacag 1500

gctacttgca tgggagttcg tttttgcgtg tgcgattcgg tgcggttgcg gcaccgggct 1560

tgatggattg ggtagtggcc gaggccgatg gctctccggc aatttgttcg gcccagccgc 1620

gcgtggcgag accgtgggcg tgggagttca cgcacgcagg gagcgggtgt gggttgccgg 1680

gctaaaaagc cgccggcaac agccacgtcc cgccgcgcgt cgcacgtccg cgccacgagg 1740

caccgaccta tccccgcctc gcgcgccaag cgctccacgc gccgcccagc gccgcaaggc 1800

ccgcaaatac gtggatcccc cacggcgcaa cgccgcaaat aatttacccg cacgcaagcc 1860

tgcacgcgaa cgttcgcgac acttcgtacc aatccattgt ccgtcgaacg ccagaactat 1920

ttaaccaaga ccaggcgcgc gaagagcgaa cgacgctata gcttcagcta cgtagccgtt 1980

gttcatcact cactcaactc agctcagtag tcagtgcgta ctagggaccg atcg 2034

<210>2

<211>28

<212>DNA

<213> Forward primer

<400>2:

aagcttagta ccgtaccact ctttctcg 28

<210>3

<211>28

<212>DNA

<213> reverse primer

<400>3:

gtcgaccgat cggtccctag tacgcact 28

Claims

1. A rice seed specific promoter Posseed is characterized in that the rice seed specific expression promoter consists of the following sequences:

the sequence shown as SEQ ID No. 1.

2. An expression cassette comprising the rice seed-specific promoter, Posseed, of claim 1.

3. A recombinant expression vector comprising the rice seed-specific promoter Posseed according to claim 1, wherein the rice seed-specific promoter is ligated to the upstream of a gene sequence to be expressed in the vector.

4. Use of the rice seed-specific expression promoter of claim 1 for growing transgenic plants, comprising: connecting a rice seed-specific promoter Posseed according to claim 1 to the upstream of a gene sequence to be expressed in a vector, thereby constructing a recombinant expression vector; transforming the recombinant expression vector into a plant cell, tissue or organ for cultivation.

5. Use according to claim 4 for breeding desired rice varieties or in bioreactor research.

6. A rice breeding method for promoting rice seed development, comprising:

(1) obtaining a rice seed specific promoter Posseed as claimed in claim 1;

(2) taking mature rice seeds, and carrying out callus induction culture;

(3) constructing a recombinant expression vector containing the rice seed-specific promoter Posseed as defined in claim 1, in which the rice seed-specific promoter is ligated to the upstream of a gene predetermined to promote seed development;

(4) transferring the obtained recombinant expression vector into agrobacterium tumefaciens;

(5) carrying out agrobacterium tumefaciens-mediated genetic transformation on the callus obtained in the step (2) by using agrobacterium tumefaciens into which the recombinant expression vector is transferred;

(6) differentiating and rooting the callus obtained after transformation to obtain transgenic seedlings;

(7) and (3) breeding the positively identified seedlings to obtain transgenic rice, and inducing the gene specific expression for promoting seed development by the rice seed specific promoter in the rice development process.