CN104087588A - Rice drought-induced promoter POsDro4 responding to environmental water stress - Google Patents
Rice drought-induced promoter POsDro4 responding to environmental water stress Download PDFInfo
- Publication number
- CN104087588A CN104087588A CN201410324435.1A CN201410324435A CN104087588A CN 104087588 A CN104087588 A CN 104087588A CN 201410324435 A CN201410324435 A CN 201410324435A CN 104087588 A CN104087588 A CN 104087588A
- Authority
- CN
- China
- Prior art keywords
- posdro4
- rice
- water stress
- inducible promoter
- drought
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention provides a rice drought-induced promoter POsDro4 responding to environmental water stress and an application of the rice drought-induced promoter POsDro4. The invention also provides an expression cassette containing the promoter and a plant expression vector. Particularly, the rice drought-induced promoter is discovered, extracted and identified by the inventor of the invention, and the promoter is applied to plant genetic engineering. The promoter provided by the invention specifically drives expression of an exogenous gene in a plant when being in the environmental water stress. Therefore, the rice drought-induced promoter can be used for improving the growth characteristics and the stress tolerance of the rice, thereby developing ideal rice varieties.
Description
Technical field
The present invention relates to biotechnology and plant gene engineering technology field.Particularly, the present invention relates to a kind of plant drought inducing genes and express promotor and application thereof, when this promotor can drive target gene to be subject to ambient moisture to coerce in Transgenic Rice adjustment and control system, express in right amount.
Background technology
Paddy rice is important food crop, and more than 1/3rd population is all taking rice as staple food in the world, and its production-scale stable and development occupies very important position in grain-production.The abiotic stresses such as arid are the important factors of restriction plant growth and output always, and along with the variations such as global environment deterioration, climatic anomaly will endanger the grain-production safety of China day by day.
In recent years, along with expanding economy, in global range, yield of brown rice and quality are proposed to more and more higher requirement, due to molecular biological development, transgenosis has become the effective means of research functional genomics, and is just progressively obtained feasibility study and generally accepted by transgenosis approach improvement stress resistance of plant.Therefore, go research and improve rice yield, improvement rice quality by molecular biology and engineered means, in agriculture production, there is good application prospect.
Because promotor is the most important factor in Factor of gene expression, substantially determine whether a gene expresses, when expresses and where express.Because making the expression of gene, inducible promoter is often only limited to some specific organ and position, can not only make the expression product of goal gene in this Organ and tissue accumulation, increase Zonal expression amount, can avoid nutrition waste unnecessary in plant materials to reduce the side effect to plant-growth simultaneously.Therefore, utilize this type of promoters driven foreign gene at corresponding organizing specific expression, can adapt to better the natural physiological law of plant, make foreign gene orientation, safety, expression efficiently in plant.
The today day by day lack in water resources, drought taking place frequently, reduce the water consumption of paddy rice, the effective rate of utilization that improves water resources has become the major subjects that breeding men pay close attention to.Paddy rice is again water consumption the first rich and influential family, and therefore, cultivating drought-enduring rice varieties is an important channel of saving water resource and raising water utilization rate.
Summary of the invention
The object of this invention is to provide a kind of response environment water stress rice drought-inducible promoter, obtain contain this promoter sequence transformant and the application of this promotor.To achieve these goals, the present inventor finds, has cloned and identified the plant endogenous drought-inducible promoter of a response environment water stress, and utilize this promotor to build gene related to drought tolerance expression vector, reach the object of the drought resistance that improves plant by genetic transforming method.
Particularly, on the one hand, the invention provides a kind of rice drought-inducible promoter of response environment water stress, the rice drought-inducible promoter of described response environment water stress comprises the DNA sequence dna shown in SEQ ID No:1 in sequence table.In sequence table, the DNA sequence dna shown in SEQ ID No:1, for deriving from the rice drought abduction delivering promotor of Japanese fine paddy rice (Oryza sativa L cv.Nipponbare), is called POsDro4 or promotor POsDro4 herein.
Preferably, the DNA sequence dna of the rice drought-inducible promoter of response environment water stress provided by the invention is the sequence shown in SEQ ID No:1, i.e. POsDro4 or promotor POsDro4.
On the other hand, the invention provides a kind of rice drought-inducible promoter of response environment water stress, the rice drought-inducible promoter of described response environment water stress is in the DNA sequence dna shown in SEQ ID No:1, to add, replace, insert or delete mutant or allelotrope or the derivative that one or more Nucleotide generate.
On the other hand, the present invention also provides a kind of expression cassette of the rice drought-inducible promoter that comprises above-mentioned response environment water stress.
Another aspect, the present invention also provides a kind of recombinant expression vector, the rice drought-inducible promoter that described recombinant expression vector comprises above-mentioned response environment water stress, in described recombinant expression vector, the rice drought-inducible promoter of described response environment water stress is connected in the upstream of gene order to be expressed; Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-POsDro4, this recombinant expression vector is to be that POsDro4 or promotor POsDro4 are implemented in the recombinant expression vector obtaining in pCAMBIA1391 by the sequence shown in SEQ ID No:1, is called pCAMBIA1391-POsDro4 herein.
On the other hand, the invention provides a kind of transformant, the rice drought-inducible promoter that described transformant comprises above-mentioned response environment water stress provided by the invention, above-mentioned expression cassette, above-mentioned recombinant expression vector.Wherein, described transformant is preferably transgenic cell line, callus or plant.
Again on the one hand, the rice drought-inducible promoter that the invention provides above-mentioned response environment water stress is in the application of cultivating in transgenic plant.Described application comprise the rice drought-inducible promoter of above-mentioned response environment water stress provided by the invention is connected in to carrier gene order upstream to be expressed (for example, before described promoter sequence is placed in to target gene), thereby structure recombinant expression vector, is transformed into described recombinant expression vector in vegetable cell, tissue or organ and cultivates.
And preferably, described application can be for improving plant growth characteristic, and described plant is monocotyledons, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice.
The DNA sequence dna of the promotor providing in the present invention is (with identical in SEQ ID No:1 in sequence table):
TGCACGACCTGAGTCTTATTGGGCCCCTGCCTGGGTTGAGTGTGCGGCCCAAGGGCTGGCACGGTCCAGCCCGACGTGTAGGTCGGGCCATGGCGGCCCAATTGACCTAAGGCTAGGCCCGGTCATGCCTGGGCCGTGCTGGGCTAGGTGGCCTAGTTGGCCATCTATACCACTGACCCGTGGGGCCCACACTACTACAGAAACAGAGATTAGTGCCGATTGGGAAACCCCCTTAGGTGCCGGTTTTCCCAATCGGCACAAGGGAGGTGGCGCTGATTTGAAATCAAATATGTCCTGGTTACTTAGAACCGACACCTTTTAGGTTCGACGAATAAAAAAAAGCCGGTCCTATGCATCGGCTTGAGCCGAGCAGTCCCTCAACTACTCTACTCATCAAGAACAAGACTGAATAAGTAAATCCGCATCACATTCATCAAGAACAAGAATGAACAAGAACATTCATCACAGCAAGCACATCCGCATCCACATCCAACATTCATCCACAACACAAAATTTGCATCAAATTTATGCAATAAAAAAAAGAAGGGATTCACACCTCTTCGAGCCGTCGTCTATTGTATGAATTGATACAATAGTTGCTTACTATTGTATGAATTGGCTATTACATTGGTCATAAATGATTTAGAGTTAGCAGCTGCCTATACTATTAAACTTGCTCTAATTCTATAGAGGTTGTTATTATTCTTAATTAAGTGTCCTTTCAGTAAAAGCATTTATATAGAGAGAGAGAGGATTATAAGTCGGAATTGCATACTGTAGTTCTGTACATTTTTATCTCGCATACGTTTCTCCTCGCTCAAATGTCAACAAGTAATATAGGTGATGTGTTACAGCGCGTACTCCGTTACGGCACGTGTTCACTCGGTGATACACATCAACTTTATTATTTGCTCCTTTGGATTAGATTACATTAAATACCTTTATGTGCAAAATCTCCCTCGTGCAGTCTACATATGCACTGTCACTACATCAAGGACAAACGTACGTGTCCCTATGCTCCAACAATAAGGAACATATTCTCAGAGCAGCCCATCTCTCGTCAGCTAGCTCATCACGCAACTCGCACCCTCCTCGCTTCTTTTAGTCCTATATTTGTAAATCAAAATTTAAATGTTGAAACCTAATTTTATGATTTTATCACCGTAATTTGCTTTATAATATTTATTTTTAAATCCCAAAAATACATACATAAAAGTTTATTTATAAATCTATCTTCTATTATATATTAGTAAAAGTTTAATAAACTTTATACAAAAGCTCATAAGTCATAAGACATCACTTGACACTCTACTAAATCGCCACGTGACATTTTAATAATTGAAGAAAATTAGAAAAAACAAAAAACATTAGCTTTTAATTTTTATTATGACTAGAAAAAAATGCCCGTACGTTACAACGGGTGAAAATTATTTTAATCTTATTTTTGTTATACAGTATAACTAAAGTAAAATTTCACTGTGAGAATTCGCTTGATATATATTCTTTTAGAAAATCAGGAGCTGTAATTAGGAATCCGATCATCTCAAGTTATATTGCAAACAAACTTCTCAAATACGGATATGCATTTTTAAATGCAAATAAACTTACAAATAGACTCATACACGGATAACGTACTAAAATACGAGCAAAAATATCTTTAATTTTTATAATAGTAGAGATTAATAAAGCATGTTGAATATATGGATAGGTATAAGCTAAACGAGGGGACATTGAGTTCAGTCTACGATACGCCTGGAAAAGATAACAAAAATAACCGAAAGAATGCCGTGAAACCCAACACGCGTCCCATGCAAATCCTATCCGTTTTGCAGCTTGCCACGCTTCTACACACAACCAGAAGAAGTCACAGGCCAACGACGAATCTATAAATGATACATCCACCAAACTGCACAGCACTTCAGCTGCAACGGAGAAATCGACGCAAAAACAAACCGCAGAAAGAAAGAAAAAAACAAGAAAGGCAAGAAAGCTACTGGTTTTCAGCTCGATCATCTTGTGATTAGCTCACACACTTTTTGCCACCTTTTTGC
It should be noted that: in the DNA sequence dna of above-mentioned promotor, the retention sequence of the forward primer that the sequence " TGCACGACCTGAGTCTTATTGG " that sequence beginning represents taking italic overstriking is used in obtaining promotor process, 22bp altogether; The retention sequence (the corresponding sequence complementation of this retention sequence and reverse primer) of the reverse primer that the sequence " ACACTTTTTGCCACCTTTTTGC " that sequence end represents taking italic overstriking is used in obtaining promotor process, altogether 22bp; In this DNA sequence dna, remaining part is available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that the promotor mentioned both can refer to above-mentioned whole DNA sequence dna herein, also can refer to remove above-mentioned primer and retain the DNA sequence dna after sequence.Even if follow-up those skilled in the art by other primers, have also extracted the core of above-mentioned promotor based on description of the invention, it also falls into protection scope of the present invention.
In sum, the DNA sequence dna of the present inventor separating clone LOC_Os10g09850.1 upstream region of gene 2051bp including transcription initiation site from the fine paddy rice of Japan (Oryza sativa L cv.Nipponbare), and by its called after POsDro4 (the SEQ ID No:1 in sequence table).This sequence after cutting, enzyme is connected on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (being recombinant expression vector), utilize this recombinant plasmid transformed agrobacterium tumefaciens bacterial strain EHA105, then carry out the conversion of paddy rice by agriculture bacillus mediated method, obtain transgenic rice plant.The transgenic paddy rice obtaining is carried out to histological chemistry and detect discovery, transfer-gen plant is after drought-induced processing, the relatively high and aobvious blueness of the Gus gene expression dose of the each tissue of root, stem, leaf, thereby the sequence that proves this 2051bp has the activity that drives genetic expression, and the Gus gene of this promoters driven is expressed after rice drought induction is processed.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.And this promoter sequence can be connected with required target gene, build recombinant plant expression vector, after transforming, after drought-induced processing, can drive target gene specific expressed in plant, thereby improve the expression amount of external source target gene in plant, increase genetically modified effect.
Technique effect
It is abduction delivering in plant being subject to that ambient moisture coerces that the rice starter POsDro4 that the present invention clones can control driven gene, particularly in stress resistance of plant improvement, has remarkable value in actual applications.Carry out genetic engineering modified by this promotor to variety of crops, as expressed in plant by this promoter regulation target gene in good time, can improve and improve growth characteristics and the environmental compatibility of paddy rice, thereby cultivate the transgenic plant kind of practicability and effectiveness.
Brief description of the drawings
Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:
POsDro4 promotor is implemented in the schematic diagram in pCAMBIA1391 vector plasmid by Fig. 1, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, B is pCAMBIA1391-POsDro4 schematic diagram, wherein shows the gus gene that utilizes POsDro4 promoters driven to be positioned at its downstream and expresses;
Fig. 2 is the result schematic diagram of promotor of the present invention being carried out enzyme and cut checking.
Fig. 3 is GUS dyeing picture after drought-induced processing, in figure, A, B, C are respectively as leaf, stem and the root tissue GUS dyeing result of 24 hours of non-POsDro4::GUS transfer-gen plant of coercing contrast (normally watering), and D, E, F are leaf, stem and the root tissue GUS dyeing coloration results of 24 hours of drought stress POsDro4::GUS transfer-gen plant of (stopping watering) after 3 weeks.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiment are only for the present invention is described, the scope that it does not limit the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Biochemical reagents, consumptive material raw material etc. used in following embodiment, if no special instructions, is commercially available purchase product.
The acquisition of the POsDro4 promotor that contains restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan providing in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy rice POsDro4 gene, and according to the feature of the carrier of selecting and target gene, the restriction enzyme site of design primer.
In the present embodiment with paddy rice binary expression vector pCAMBIA1391 (Figure 1A, come from CAMBIA, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site (AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band BamHI, restriction enzyme site (GGATCC), primer sequence is as follows:
Forward primer: AAGCTTTGCACGACCTGAGTCTTATTGG HindIII
Reverse primer: GGATCCGCAAAAAGGTGGCAAAAAGTGT BamHI is synthetic by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor POsDro4
Taking the fine DNA of rice varieties Japan as template, utilize forward primer, reverse primer amplification promotor POsDro4, PCR system routinely, adopts following amplification program:
95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C are extended 2min30s, circulate 35 times; Last 72 DEG C are extended 10min.
Reclaim the object fragment of pcr amplification, object fragment length 2051bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, mix in the ratio in carrier specification sheets) on, transform after intestinal bacteria XL-Blue competent cell according to heat shock method, competent cell is activated, and then object fragment is transferred in the competent cell of activation, then, obtain positive colony through bacterium colony PCR screening, picking mono-clonal shakes bacterium liquid upgrading grain, carries out double digestion checking with HindIII and BamHI, as shown in Figure 2.The order-checking of Invitrogen company will be delivered through the positive colony of qualification.Verify that correct clone is the promotor POsDro4 that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.
The structure of plant expression vector and the conversion of Agrobacterium
In the positive colony obtaining " acquisition of promotor POsDro4 " process from above, extract plasmid, with HindIII and BamHI double digestion, reclaim promotor POsDro4 fragment.Utilize HindIII and BamHI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned POsDro4 fragment is connected with T4 ligase enzyme for pCAMBIA1391 fragment (being purchased from TaKaRa company), obtain the plant expression vector pCAMBIA1391-POsDro4 (Figure 1B) of promotor POsDro4 and Gus gene fusion, utilize freeze-thaw method that plant expression vector is proceeded to agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved).
Utilize promotor POsDro4 to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
Mature seed removes after clever shell, with 70% alcohol-pickled seed 1min, outwells alcohol.With 50% clorox that contains 1 Tween20 (stoste effective chlorine density is greater than 4%) solution soaking seed 40min (150r/min).Outwell clorox, aseptic washing 5 times is to solution clarification, without clorox taste.Sterilized water soaks seed and spends the night.Along the aleurone layer of seed, embryo is peeled with scalper, embryo is inoculated on calli induction media.Dark cultivation after 11 days callus and endosperm and germ separation at 30 DEG C, by go bud in good condition, divide vigorous elementary callus carry out preculture after 3～5 days for Agrobacterium-mediated Transformation.
Adopt the agrobacterium tumefaciens that has proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process to carry out agriculture bacillus mediated genetic transformation, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.) [J] .Plant Cell Report, method 2012.DOI10.1007/s00299-012-1275-3.) etc. proposing.
Obtain altogether 33 strain POsDro4-pCAMBIA1391 plant (POsDro4::gus transgenic rice plant).
The water stress processing of step 2, POsDro4::gus transgenic rice plant
Taking the normal growth transgenic rice plant of 3 weeks as material, high at the 75cm that fills up soil, in 20cm diameter pvc pipe, plant, irrigating after moisture, continue not water for three weeks, plant leaf is done to occurring wilting, gets blade material and carries out GUS histochemical stain.Meanwhile, taking the plant material that continues to water as contrast.
Step 3, GUS histochemical stain
With reference to Jefferson (the people .GUS fusion such as Jefferson RA: β-Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J] .EMBO J., 1987, method 6:3901-3907) etc. proposing, the tissue of needs dyeing is vacuumized, then immerse in staining fluid, 37 DEG C are dyeed 24 hours.When decolouring, under 37 DEG C of conditions, use 95% Ethanol Treatment, extremely negative control material is white in color.Result demonstration, the root of the POsDro4::gus transgenic rice plant that continues not water, stem, leaf texture present blueness after GUS dyeing, and keep root, stem, leaf texture's dye-free of the contrast POsDro4::gus transgenic rice plant watering.Presentation of results, under water stress (lack of water) condition, promotor POsDro4 can drive Gus gene high level expression in rice plant, the results are shown in Figure 3.
Specific description of embodiments of the present invention above does not limit the present invention, and those skilled in the art can make according to the present invention various changes or distortion, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (6)
1. a rice drought-inducible promoter POsDro4 for response environment water stress, is characterized in that, described rice drought-inducible promoter comprises the DNA sequence dna shown in SEQ ID No:1.
2. the rice drought-inducible promoter POsDro4 of response environment water stress according to claim 1, is characterized in that, the DNA sequence dna of the rice drought-inducible promoter of described response environment water stress is the sequence shown in SEQ ID No:1.
3. the rice drought-inducible promoter POsDro4 of response environment water stress according to claim 1, it is characterized in that, the rice drought-inducible promoter POsDro4 of described response environment water stress add, replace, insert or delete mutant or allelotrope or the derivative that one or more Nucleotide generate in the DNA sequence dna shown in SEQ ID No:1.
4. expression cassette, transformant or a recombinant expression vector, is characterized in that, the rice drought-inducible promoter POsDro4 that described expression cassette, transformant or recombinant expression vector comprise the response environment water stress described in any one in claim 1-3.
5. the application in cultivation transgenic plant according to the rice drought-inducible promoter of the response environment water stress described in any one in claim 1-3, it is characterized in that, described application comprises: will be connected in gene order upstream to be expressed in carrier according to the rice drought-inducible promoter of the response environment water stress described in any one in claim 1-3, thereby build recombinant expression vector; Described recombinant expression vector is transformed in vegetable cell, tissue or organ and is cultivated.
6. application according to claim 5, is characterized in that, described application is for improving plant growth characteristic, and described plant is monocotyledons: paddy rice, wheat, corn, barley, Chinese sorghum or oat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410324435.1A CN104087588B (en) | 2014-07-08 | 2014-07-08 | The rice drought-inducible promoter POsDro4 of response environment water stress |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410324435.1A CN104087588B (en) | 2014-07-08 | 2014-07-08 | The rice drought-inducible promoter POsDro4 of response environment water stress |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087588A true CN104087588A (en) | 2014-10-08 |
| CN104087588B CN104087588B (en) | 2016-06-22 |
Family
ID=51635348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410324435.1A Expired - Fee Related CN104087588B (en) | 2014-07-08 | 2014-07-08 | The rice drought-inducible promoter POsDro4 of response environment water stress |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087588B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357449A (en) * | 2014-11-04 | 2015-02-18 | 安徽省农业科学院水稻研究所 | Method for acquiring plant stamen expression promoter STA3 and corresponding promoter |
| CN111961668A (en) * | 2020-06-29 | 2020-11-20 | 湖南科技学院 | Rice stress inducible promoter POsSalT1And uses thereof |
| CN113151273A (en) * | 2021-04-14 | 2021-07-23 | 新疆农业大学 | Abiotic stress inducible promoter and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010125036A2 (en) * | 2009-04-29 | 2010-11-04 | Basf Plant Science Company Gmbh | Plants having enhanced yield-related traits and a method for making the same |
| WO2011074959A1 (en) * | 2009-12-15 | 2011-06-23 | Edwin Henricus Antonius Holman | Transgenic ozone-resistant plants |
| CN102586247A (en) * | 2011-01-10 | 2012-07-18 | 华中农业大学 | Application of stress inducible promoter on controlling gene in drought induced expression |
| CN102732526A (en) * | 2011-04-02 | 2012-10-17 | 华中农业大学 | Application of OsSRO1c gene in controlling rice drought resistance |
| WO2012159196A1 (en) * | 2011-05-20 | 2012-11-29 | Frontier Agri-Science Inc. | Plants having enhanced abiotic stress resistance |
| WO2013138354A1 (en) * | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| CN103421784A (en) * | 2013-03-26 | 2013-12-04 | 华中农业大学 | Identification and utilization of drought and high-salt induced paddy rice promoter PDS1 |
-
2014
- 2014-07-08 CN CN201410324435.1A patent/CN104087588B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010125036A2 (en) * | 2009-04-29 | 2010-11-04 | Basf Plant Science Company Gmbh | Plants having enhanced yield-related traits and a method for making the same |
| WO2011074959A1 (en) * | 2009-12-15 | 2011-06-23 | Edwin Henricus Antonius Holman | Transgenic ozone-resistant plants |
| CN102586247A (en) * | 2011-01-10 | 2012-07-18 | 华中农业大学 | Application of stress inducible promoter on controlling gene in drought induced expression |
| CN102732526A (en) * | 2011-04-02 | 2012-10-17 | 华中农业大学 | Application of OsSRO1c gene in controlling rice drought resistance |
| WO2012159196A1 (en) * | 2011-05-20 | 2012-11-29 | Frontier Agri-Science Inc. | Plants having enhanced abiotic stress resistance |
| WO2013138354A1 (en) * | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| CN103421784A (en) * | 2013-03-26 | 2013-12-04 | 华中农业大学 | Identification and utilization of drought and high-salt induced paddy rice promoter PDS1 |
Non-Patent Citations (1)
| Title |
|---|
| BUELL,C.R.ET AL.: "Oryza sativa chromosome 3 BAC OSJNBa0027J18 genomic sequence, complete sequence，", 《GENBANK》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357449A (en) * | 2014-11-04 | 2015-02-18 | 安徽省农业科学院水稻研究所 | Method for acquiring plant stamen expression promoter STA3 and corresponding promoter |
| CN111961668A (en) * | 2020-06-29 | 2020-11-20 | 湖南科技学院 | Rice stress inducible promoter POsSalT1And uses thereof |
| CN113151273A (en) * | 2021-04-14 | 2021-07-23 | 新疆农业大学 | Abiotic stress inducible promoter and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087588B (en) | 2016-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105647925A (en) | Rice anther high-expression promoter OsAnth4 and application thereof | |
| CN104946649A (en) | Specific expression promoter OsAnth1 for rice anthers | |
| CN103849622B (en) | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN104087588B (en) | The rice drought-inducible promoter POsDro4 of response environment water stress | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN103740719B (en) | The separation of Rice Vascular Bundle specific expression promoter POsvas 1 and application | |
| CN103540592A (en) | Rice endosperm specific expression promoter as well as application thereof | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN103849621B (en) | The cold abduction delivering promotor Poscold1 of one kind of plant and application thereof | |
| CN105063047A (en) | Plant seed specific expression promotor OsSee1 | |
| CN103882021B (en) | One Plants drought-induced expression promoter PosDro1 and application thereof | |
| CN104046629A (en) | Plant salt inducible expression promoter POsSalt1 and application thereof | |
| CN104087587B (en) | A kind of plant drouhgt stress abduction delivering promotor and application | |
| CN103773766B (en) | A kind of rice root specific expressing promoter POsRo1 and application thereof | |
| CN103031303B (en) | Identification and applications of plant pulvinus specific expression promoter ProCol1 | |
| CN103834661B (en) | A kind of vegetable hot abduction delivering promotor Posheat1 and application thereof | |
| CN103710344B (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
| CN105087589A (en) | Promoter element OsEmb2 as well as method and application thereof in breeding transgenic rice | |
| CN104073490B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro3 | |
| CN104073493A (en) | Cold-induced and strong-expressed plant promoter Poscold4 and application thereof | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN104073492B (en) | A kind of crop aleurone specific expression promoter PosAL1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160622 Termination date: 20200708 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |