CN103865930B - A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof - Google Patents
A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof Download PDFInfo
- Publication number
- CN103865930B CN103865930B CN201410123835.6A CN201410123835A CN103865930B CN 103865930 B CN103865930 B CN 103865930B CN 201410123835 A CN201410123835 A CN 201410123835A CN 103865930 B CN103865930 B CN 103865930B
- Authority
- CN
- China
- Prior art keywords
- poscold3
- promotor
- cold
- leaf
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention provides the cold abduction delivering promotor Poscold3 of a kind of plant stem-leaf and application thereof.Present invention also offers the expression cassette containing this promotor, plant expression vector, Host Strains and transformant.Specifically, present invention obtains above-mentioned promotor and above-mentioned promotor is applied in transgenic plant genetic engineering.Promotor provided by the invention can drive foreign gene specific expressed in the stem of plant and leaf under cold inductive condition, this promotor is applicable to unifacial leaf cereal plants, especially foreign gene abduction delivering in the stem and leaf of rice plant can be driven, therefore may be used for the growth characteristics and the cold tolerance that improve and improve paddy rice, thus cultivate desirable rice varieties.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to a kind of plant stem-leaf cold acclimation protein and express promotor and application thereof, this promotor can drive target gene to express in plant in plant transgene adjustment and control system under cold inductive condition.
Background technology
Paddy rice is the important food crop of China, and damaging to plants caused by sudden drop in temperature is one of important limiting factor affecting Rice Production.The affect main manifestations of chilling injury on rice yield is that setting percentage reduces, and pollen development postpones, and anther dehiscence is not smooth, affects fertilization, causes output to reduce.Rice breeding men thirst for by breeding technique, transfer on Cultivar by the strong resistance to cold of local resources, to improve resistance to cold, reduce and damage to plants caused by sudden drop in temperature the Rice Yield Loss Caused caused.But local cold-resistant Rice Resources often unfavorable proterties is more, improvement difficulty is very big.Therefore, in the urgent need to excavating rice cold tolerance germ plasm resource and favorable genes, thus rice cold tolerance new variety are cultivated.
So far, researchist both domestic and external has carried out insistent Exploration & stu dy, has carried out anti-ly coldly to coerce breeding of new variety work, achieves certain achievement.Zhong Kang etc. (2007), by the proline content rising in overexpression render transgenic paddy rice in paddy rice of zinc finger protein albuminoid OsCOIN gene, improve the resistance to cold of plant.Zhang Hongsheng etc. (2009) are by paddy rice zinc finger protein ZFP245 gene overexpression in paddy rice, find that overexpression ZFP245 trans-genetic hybrid rice makes the expression amount of Proline Accumulation genes involved OsP5CS and proline transport gene OsProT gene improve under cold coercing, impel the amount of proline(Pro) to increase, strengthen the resistance to cold of plant.Remaining virtuous and beautiful grade (2010) finds that MYBS3 overexpression paddy rice can survive after processing under 4 DEG C of conditions, and does not affect its Other Main Agronomic Characters.In addition, the overexpression some being comprised to the transcription factors such as DREB/CBF, NAC can improve the resistance to cold of paddy rice.
At present, along with the develop rapidly of molecular biology, information biology and reaching its maturity of transgenic technology, carry out by modern genetic engineering technology a kind of high effective way that molecular breeding has become improvement rice cold tolerance.
China's rice pest insects enriches, and excavates, locates, clones cold-resistant genes involved and cold induced promoter thereof, have important theory and practical significance by the seed selection of rice cold tolerance kind, will have wide application and market outlook at agriculture field from rice seed.
Summary of the invention
The object of this invention is to provide a kind of drive foreign gene specific expressed under cold inductive condition promotor, obtain containing the transformant of this promoter sequence and the application of this promotor.Wherein, involved herein " plant " refers to monocotyledons, such as paddy rice, wheat, corn, barley, Chinese sorghum or oat, is preferably paddy rice.
To achieve these goals, on the one hand, the invention provides the cold abduction delivering promotor Poscold3 of a kind of plant stem-leaf, the cold abduction delivering promotor Poscold3 of described plant stem-leaf comprises the DNA sequence dna shown in SEQ ID No:1.In sequence table, the DNA sequence dna shown in SEQ ID No:1 is for deriving from the cold abduction delivering promotor Poscold3 of stems and leaves of rice of Japanese fine paddy rice (Oryza sativa L cv.Nipponbare), is called Poscold3 or promotor Poscold3 herein.
Preferably, the DNA sequence dna of the cold abduction delivering promotor Poscold3 of plant stem-leaf provided by the invention is the sequence shown in SEQ ID No:1, i.e. Poscold3 or promotor Poscold3.
On the other hand, the invention provides the cold abduction delivering promotor Poscold3 of a kind of plant stem-leaf, the DNA sequence dna shown in its DNA sequence dna and SEQ ID No:1 has at least 90% homology; Or the cold abduction delivering promotor Poscold3 of described plant stem-leaf is the mutant that add, replace, insert or delete one or more Nucleotide generate in the DNA sequence dna shown in SEQ ID No:1 or allelotrope or derivative; Or the cold abduction delivering promotor Poscold3 of described plant stem-leaf has the product of hybridizing with the DNA sequence dna shown in SEQID No:1.DNA sequence dna shown in these plant stem-leafs cold abduction delivering promotor Poscold3 sequence and SEQ ID No:1 has identical function, namely drives target gene specific expressed in plant stem-leaf under cold inductive condition.
The cold induction that the present invention mentions refers to the low temperature (such as, 4 degrees Celsius) transfer-gen plant being applied to for some time, thus is expressed by promotor induction specific gene of the present invention.
On the other hand, the present invention also provides a kind of expression cassette comprising the cold abduction delivering promotor Poscold3 of above-mentioned plant stem-leaf.
Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector comprises the cold abduction delivering promotor Poscold3 of above-mentioned plant stem-leaf, in described recombinant expression vector, described plant stem-leaf cold abduction delivering promotor Poscold3 is connected to the upstream of gene order to be expressed; Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-Poscold3, this recombinant expression vector, for the sequence shown in SEQ ID No:1 and Poscold3 or promotor Poscold3 are implemented in the recombinant expression vector obtained in pCAMBIA1391, is called pCAMBIA1391-Poscold3 herein.More preferably, described gene is the gene with resistance to cold.
On the other hand, the present invention also provides a kind of Host Strains, and described Host Strains comprises above-mentioned plant stem-leaf provided by the invention cold abduction delivering promotor Poscold3, above-mentioned expression cassette or above-mentioned recombinant expression vector; Preferably, described Host Strains is agrobacterium tumefaciens.
On the other hand, the invention provides a kind of transformant, described transformant comprises above-mentioned plant stem-leaf provided by the invention cold abduction delivering promotor Poscold3, above-mentioned expression cassette, above-mentioned recombinant expression vector.Wherein, described transformant is preferably transgenic cell line, callus or plant.
Again on the one hand, the invention provides the cold abduction delivering promotor Poscold3 of above-mentioned plant stem-leaf and cultivate the application in transgenic plant.Described application comprises above-mentioned plant stem-leaf provided by the invention cold abduction delivering promotor Poscold3 is connected to the gene order upstream to be expressed of carrier (such as, before described promoter sequence is placed in target gene), thus structure recombinant expression vector, described recombinant expression vector is transformed in vegetable cell, tissue or organ and cultivates.Gene to be expressed in the present invention preferably has the gene of resistance to cold.
And preferably, described application may be used for improving plant growth characteristic, described plant is monocotyledons, such as paddy rice, wheat, corn, barley, Chinese sorghum or oat, is preferably paddy rice.
The DNA sequence dna of the promotor provided in the present invention is (identical with SEQ ID No:1 in sequence table):
It should be noted that: in the DNA sequence dna of above-mentioned promotor, sequence beginning is with italic and the sequence " aacgagcata acccgagcca ga " that overstriking represents is the retention sequence obtaining the forward primer used in promotor process, amounts to 22bp; Sequence end is with italic and the sequence " cagcgagagaacacaaact cac " that overstriking represents is the retention sequence (corresponding sequence of this retention sequence and reverse primer is complementary) obtaining the reverse primer used in promotor process, amounts to 22bp; In this DNA sequence dna, remaining part is then available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that mentioned promotor both can refer to above-mentioned whole DNA sequence dna herein, also can refer to the DNA sequence dna after removing above-mentioned primer retains sequence.
In sum, the present inventor's separating clone from the fine paddy rice of Japan (Oryza sativa L cv.Nipponbare) obtains the DNA sequence dna that structure comprises the 1833bp of transcription initiation site, and by the SEQ ID No:1 in its called after Poscold3(sequence table).This sequence is connected to after enzyme is cut on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (i.e. recombinant expression vector), utilize this recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then carry out the conversion of paddy rice by agriculture bacillus mediated method, obtain transgenic rice plant.Histological chemistry is carried out to the transgenic paddy rice obtained and detects discovery, transfer-gen plant is after cold induction process, the relatively high and aobvious blueness of Gus gene expression dose on the whole, thus prove that the sequence of this 1833bp has the activity driving genetic expression, and the Gus gene of this promoters driven is specific expressed after Rice Cold induction process.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.And, this promoter sequence can link with required target gene, build recombinant plant expression vector, after transforming, can drive in the cauline leaf of target gene plant specific expressed after cold induction process, thus improve the expression amount of exogeneous target gene in the cauline leaf of plant, increase genetically modified effect.
Technique effect
The rice starter Poscold3 that the present invention clones can concentrate expression in predefined conditions by regulatory gene in the cauline leaf of plant, has remarkable value in actual applications.By this promotor, genetic modification is carried out to variety of crops, as expressed in the cauline leaf of plant by this promoter regulation target gene, replacing the constitutive promoters such as 35S, thus cultivating the high cold-resistant transgenic plant kind of desirable biological safety.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is schematic diagram Poscold3 promotor be implemented in pCAMBIA1391 vector plasmid, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, in Fig. 1, B is pCAMBIA1391-Poscold3 schematic diagram, illustrated therein is the gus gene utilizing Poscold3 promoters driven to be positioned at its downstream and expresses;
Fig. 2 is the Poscold3::GUS transfer-gen plant tissue staining figure of sprouting after 21 days.The rice plant of normal growth under 28 DEG C of conditions, after dyeing in 24 hours, root (A), stem (B), leaf (C) are all active without GUS, and through 4 DEG C of deepfreezes 24 hours, express without GUS in root (D) after dyeing, but all have GUS strong expression (scale=10mm) in stem (E), leaf (F).
Fig. 3 is the result schematic diagram of promotor of the present invention being carried out to digestion verification.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.
The acquisition of the Poscold2 promotor containing restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan provided in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy rice PCole1 gene, and according to the feature of the carrier selected and target gene, the restriction enzyme site of design primer.
With the part A in paddy rice binary expression vector pCAMBIA1391(Fig. 1 in the present embodiment, this carrier comes from CAMBIA, for open use carrier, preserve in genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:2) 5 ' end band SalI, restriction enzyme site (GTCGAC), reverse primer (SEQ ID No:3) 5 ' end band EcoRI, restriction enzyme site (GAATTC), primer sequence is as follows:
Forward primer: GTCGACAACGAGCATAACCCGAGCCAGA SalI
Reverse primer: GAATTCGTGAGTTTGTGTTCTCTCGCTG EcoRI
Synthesized by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor Poscold3
With the fine DNA of rice varieties Japan for template, utilize forward primer, reverse primer to increase promotor Poscold3, routinely PCR system, adopt following amplification program:
95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min30s, perform 35 circulations extended to 72 DEG C from 95 DEG C of denaturations; Last 72 DEG C extend 10min.
Reclaim the object fragment of pcr amplification, object fragment length 1833bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, ratio mixing in carrier specification sheets) on, after heat shock method transformation of E. coli XL-Blue competent cell, competent cell is activated, and then object fragment is transferred in the competent cell of activation, then, screen through bacterium colony PCR and obtain positive colony, picking mono-clonal shakes bacterium liquid upgrading grain, carries out double digestion checking, as shown in Figure 3 with SalI and EcoRI.Positive colony through qualification is delivered the order-checking of Invitrogen company.Verify that correct clone is the promotor Poscold3 that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.
The structure of plant expression vector and the conversion of Agrobacterium
Extract plasmid in the positive colony obtained " acquisition of promotor Poscold3 " process from above, with SalI and EcoRI double digestion, reclaim promotor Poscold3 fragment.Utilize SalI and EcoRI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned Poscold3 fragment is connected with pCAMBIA1391 fragment T4 ligase enzyme (being purchased from TaKaRa company), obtain plant expression vector pCAMBIA1391-Poscold3(Figure 1B of promotor Poscold3 and Gus gene fusion), utilize freeze-thaw method plant expression vector to be proceeded to agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105(Academy of Agri-Science and Technology Anhui Province genetically modified organism product composition supervision and inspection center of Ministry of Agriculture paddy rice group to preserve), positive plasmid is extracted from freeze-thaw method products therefrom, digestion verification is carried out with SalI and EcoRI, the result as shown in Figure 3.
Promotor Poscold3 is utilized to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
After ripe rice paddy seed is removed clever shell, with 70% alcohol-pickled seed 1min, outwell alcohol.50% clorox (stoste effective chlorine density is greater than 4%) solution soaking seed 40min(150r/min with containing 1 Tween20).Outwell clorox, aseptic washing is clarified, without clorox taste to solution for 5 times.Sterilized water soaks seed and spends the night.With scalper, embryo is peeled along aleurone layer by seed, embryo is inoculated on calli induction media.At 30 DEG C light culture after 11 days by callus and endosperm and germ separation, by go bud in good condition, divide vigorous elementary callus and carry out preculture and be used for Agrobacterium-mediated Transformation after 3 ~ 5 days.
The agrobacterium tumefaciens having proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process is adopted to carry out Agrobacterium-mediated genetic transformation, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan(Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughput protocol for Agrobacterium mediatedtransformation based on phosphomannose isomerase positive selection inJaponica rice (Oryza sativa L.) [J] .Plant Cell Report, method 2012.DOI10.1007/s00299-012-1275-3.) etc. proposed.
Obtain 28 strain pCAMBIA1391-Poscold3 plant (Poscold3::gus transgenic rice plant) altogether.
Step 2, deepfreeze and GUS histochemical stain
Plant carries out GUS dyeing through 4 DEG C of deepfreezes after 24 hours, dyeing process is with reference to Jefferson (people .GUS fusion: β-Glucuronidase as a sensitive and versatilegene fusion marker in higher plant [J] the .EMBO J. such as Jefferson RA, 1987, method 6:3901-3907) etc. proposed, vacuumize needing the tissue of dyeing, then immerse in staining fluid, 37 DEG C are dyeed 24 hours.Under 37 DEG C of conditions, 95% Ethanol Treatment is used, to negative control material in white during decolouring.
The Poscold3::GUS transfer-gen plant tissue of sprouting after 21 days is dyeed.As shown in Figure 2, wherein, A-C is respectively root, stem, the result of leaf after dyeing in 24 hours of the rice plant of normal growth under 28 DEG C of conditions, and as can be seen from the figure, root (A), stem (B), leaf (C) are all active without GUS.In Fig. 2, D-F is root, stem, the leaf result that deepfreeze is dyeed for 24 hours again at 4 DEG C to rice plant, as shown in the figure, expresses after dyeing, but all have GUS strong expression in root (D) without GUS in stem (E), leaf (F).
As can be seen from above experimental result, promotor of the present invention under cold inductive condition, can drive the stem of transfer-gen plant and leaf specific expressed, and other positions can not be specific expressed.
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (5)
1. the cold abduction delivering promotor Poscold3 of plant stem-leaf, is characterized in that, the DNA sequence dna of the cold abduction delivering promotor Poscold3 of described plant stem-leaf is the sequence shown in SEQ ID No:1.
2. an expression cassette, is characterized in that, described expression cassette comprises the cold abduction delivering promotor Poscold3 of plant stem-leaf according to claim 1.
3. a recombinant expression vector, it is characterized in that, described recombinant expression vector comprises the cold abduction delivering promotor Poscold3 of plant stem-leaf according to claim 1, in described recombinant expression vector, described plant stem-leaf cold abduction delivering promotor Poscold3 is connected to the upstream of gene order to be expressed in plant expression vector.
4. recombinant expression vector according to claim 3, described gene to be expressed is Gus gene, or described gene to be expressed is the gene with resistance to cold, described plant stem-leaf cold abduction delivering promotor Poscold3 drives described genetic expression to be expressed under cold inductive condition.
5. the cold abduction delivering promotor Poscold3 of plant stem-leaf according to claim 1 is cultivating the application in transgenic paddy rice, it is characterized in that, described application comprises: cold for plant stem-leaf according to claim 1 abduction delivering promotor Poscold3 is connected to gene order upstream to be expressed in carrier, thus builds recombinant expression vector; Described recombinant expression vector is transformed in rice cell, tissue or organ and cultivates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410123835.6A CN103865930B (en) | 2014-03-27 | 2014-03-27 | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410123835.6A CN103865930B (en) | 2014-03-27 | 2014-03-27 | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103865930A CN103865930A (en) | 2014-06-18 |
| CN103865930B true CN103865930B (en) | 2015-10-14 |
Family
ID=50904940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410123835.6A Expired - Fee Related CN103865930B (en) | 2014-03-27 | 2014-03-27 | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103865930B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059919B (en) * | 2014-07-08 | 2016-10-12 | 安徽省农业科学院水稻研究所 | Plant heat shock evoked promoter Posheat3 and application |
| CN104845973B (en) * | 2015-06-11 | 2017-10-13 | 安徽省农业科学院水稻研究所 | The strong evoked promoter POscold6 of paddy rice low clone and application |
| CN104928295B (en) * | 2015-06-11 | 2018-06-12 | 安徽省农业科学院水稻研究所 | The cold-induced expression promoter POscold7 of rice seedling |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768590A (en) * | 2010-03-11 | 2010-07-07 | 中国农业大学 | Cold induced promoter p-LTT7 for rice and application thereof |
| CN102676572A (en) * | 2011-03-14 | 2012-09-19 | 中国科学院遗传与发育生物学研究所 | Plant disease resistant associated protein xa5PG1, coding genes thereof and application thereof |
-
2014
- 2014-03-27 CN CN201410123835.6A patent/CN103865930B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768590A (en) * | 2010-03-11 | 2010-07-07 | 中国农业大学 | Cold induced promoter p-LTT7 for rice and application thereof |
| CN102676572A (en) * | 2011-03-14 | 2012-09-19 | 中国科学院遗传与发育生物学研究所 | Plant disease resistant associated protein xa5PG1, coding genes thereof and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| AP004399;NCBI;《GenBank》;20080216;全文 * |
| 水稻病程相关蛋白质在逆境胁迫下的表达研究;高庆华 等;《生物化学与生物物理进展》;20131231;第40卷(第11期);1140-1147 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103865930A (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946649B (en) | A kind of Rice Anther specific expression promoter OsAnth1 | |
| CN103849622B (en) | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN103849621B (en) | The cold abduction delivering promotor Poscold1 of one kind of plant and application thereof | |
| CN104046629B (en) | A kind of plant salt abduction delivering promotor POsSalt1 and application thereof | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN103740719B (en) | The separation of Rice Vascular Bundle specific expression promoter POsvas 1 and application | |
| CN104087588B (en) | The rice drought-inducible promoter POsDro4 of response environment water stress | |
| CN103540592A (en) | Rice endosperm specific expression promoter as well as application thereof | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN105063047A (en) | Plant seed specific expression promotor OsSee1 | |
| CN103834661B (en) | A kind of vegetable hot abduction delivering promotor Posheat1 and application thereof | |
| CN104073493B (en) | The cold induction strongly expressed promoter Poscold4 of plant and application thereof | |
| CN104087587B (en) | A kind of plant drouhgt stress abduction delivering promotor and application | |
| CN103710344B (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
| CN103773766B (en) | A kind of rice root specific expressing promoter POsRo1 and application thereof | |
| CN103882021B (en) | One Plants drought-induced expression promoter PosDro1 and application thereof | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN104073490B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro3 | |
| CN104073492B (en) | A kind of crop aleurone specific expression promoter PosAL1 and application thereof | |
| CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
| CN105567695A (en) | Rice non-endosperm expression promoter SAFES3 and application thereof | |
| CN104845974A (en) | DNA (deoxyribonucleic acid) segment POscold5 capable of responding to long-term cold stress |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151014 Termination date: 20170327 |