CN103849622B - The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof - Google Patents
The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof Download PDFInfo
- Publication number
- CN103849622B CN103849622B CN201410119971.8A CN201410119971A CN103849622B CN 103849622 B CN103849622 B CN 103849622B CN 201410119971 A CN201410119971 A CN 201410119971A CN 103849622 B CN103849622 B CN 103849622B
- Authority
- CN
- China
- Prior art keywords
- plant
- poscold2
- cold
- promotor
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides the cold abduction delivering promotor Poscold2 of a kind of plant and application thereof.Present invention also offers the expression cassette containing this promotor, plant expression vector, Host Strains and transformant.Specifically, present invention obtains above-mentioned promotor and above-mentioned promotor is applied in transgenic plant genetic engineering.Promotor provided by the invention can drive foreign gene to express in plant under the condition of cold induction, be applicable to unifacial leaf cereal plants, especially foreign gene abduction delivering in rice plant can be driven, therefore may be used for the growth characteristics improving and improve paddy rice, thus cultivate desirable cold-tolerant rice.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to a kind of plant cold acclimation protein and express promotor and application thereof, this promotor can drive target gene to express in plant in Transgenic Rice adjustment and control system under cold inductive condition.
Background technology
Paddy rice is important food crop, belongs to the warm crop of happiness, more responsive to low-temp reaction, when temperature is lower than a certain critical temperature, rice growth will receive and suppress or harm, i.e. chilling injury, therefore, damaging to plants caused by sudden drop in temperature is one of important limiting factor affecting Rice Production.According to different on paddy rice impact, Japanese Rice expert is divided into delaying type, obstruction type, rice blast type, mixed cold harm damaging to plants caused by sudden drop in temperature.Paddy rice all may be damaged to plants caused by sudden drop in temperature each period from rudiment to maturation, worldwide, high latitude, high altitude localities cause the phenomenon of the paddy rice underproduction generally to occur because of chilling injury, in China with the Northeast, southwest is outstanding especially, China is about 30-50 hundred million kg because of chilling injury underproduction paddy every year, and loss is serious.Therefore in the urgent need to excavating rice cold tolerance germ plasm resource, rice cold tolerance kind is cultivated.
So far, researchist both domestic and external has carried out insistent Exploration & stu dy, has carried out anti-ly coldly to coerce breeding of new variety work, achieves certain achievement.Zhong Kang etc. (2007), by the proline content rising in overexpression render transgenic paddy rice in paddy rice of zinc finger protein albuminoid OsCOIN gene, improve the resistance to cold of plant.Zhang Hongsheng etc. (2009) are by paddy rice zinc finger protein ZFP245 gene overexpression in paddy rice, find that overexpression ZFP245 trans-genetic hybrid rice makes the expression amount of Proline Accumulation genes involved OsP5CS and proline transport gene OsProT gene improve under cold coercing, impel the amount of proline(Pro) to increase, strengthen the resistance to cold of plant.Remaining virtuous and beautiful grade (2010) finds that MYBS3 overexpression paddy rice can survive after processing under 4 DEG C of conditions, and does not affect its Other Main Agronomic Characters.In addition, the overexpression some being comprised to the transcription factors such as DREB/CBF, NAC can improve the resistance to cold of paddy rice.
At present, along with the develop rapidly of molecular biology, information biology and reaching its maturity of transgenic technology, carry out by modern genetic engineering technology a kind of high effective way that molecular breeding has become improvement rice cold tolerance.
China's rice pest insects enriches, and excavates, locates, clones cold-resistant genes involved and cold induced promoter thereof from rice seed, will be significant to Rice Production.
Summary of the invention
The object of this invention is to provide a kind of drive foreign gene specific expressed under cold inductive condition promotor, obtain containing the transformant of this promoter sequence and the application of this promotor.Wherein, involved herein " plant " refers to monocotyledons, such as paddy rice, wheat, corn, barley, Chinese sorghum or oat, is preferably paddy rice.
To achieve these goals, on the one hand, the invention provides the cold abduction delivering promotor Poscold2 of a kind of plant, the cold abduction delivering promotor Poscold2 of described plant comprises SEQ ID No: the DNA sequence dna shown in 1.SEQ ID No: the DNA sequence dna shown in 1, for deriving from the Rice Cold abduction delivering promotor of Japanese fine paddy rice (OryzasativaLcv.Nipponbare), is called Poscold2 or promotor Poscold2 herein.
Preferably, the DNA sequence dna of the cold abduction delivering promotor Poscold2 of plant provided by the invention is the sequence shown in SEQIDNo:1, i.e. Poscold2 or promotor Poscold2.
On the other hand, the invention provides the cold abduction delivering promotor Poscold2 of a kind of plant, the DNA sequence dna shown in its DNA sequence dna and SEQIDNo:1 has at least 80% homology; Or the cold abduction delivering promotor Poscold2 of described plant is the mutant that add, replace, insert or delete one or more Nucleotide generate in the DNA sequence dna shown in SEQIDNo:1 or allelotrope or derivative; Or the cold abduction delivering promotor Poscold2 of described plant has the product of hybridizing with the DNA sequence dna shown in SEQIDNo:1.These plants cold abduction delivering promotor Poscold2 sequence and the DNA sequence dna shown in SEQIDNo:1 have identical function, namely drive target gene specific expressed in plant under cold inductive condition.
The cold induction that the present invention mentions refers to the low temperature (such as, 4 degrees Celsius) transfer-gen plant being applied to for some time, thus is expressed by promotor induction specific gene of the present invention.
On the other hand, the present invention also provides a kind of expression cassette comprising the cold abduction delivering promotor Poscold2 of above-mentioned plant.
Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector comprises the cold abduction delivering promotor Poscold2 of above-mentioned plant, and in described recombinant expression vector, described plant cold abduction delivering promotor Poscold2 is connected to the upstream of gene order to be expressed; Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-Poscold2, this recombinant expression vector, for the sequence shown in SEQIDNo:1 and Poscold2 or promotor Poscold2 are implemented in the recombinant expression vector obtained in pCAMBIA1391, is called pCAMBIA1391-Poscold2 herein.Or, in actual applications, select cold tolerance gene as gene to be expressed, by promotor of the present invention under cold inductive condition, drive cold tolerance gene to express, thus improve the resistance to cold of plant.
On the other hand, the present invention also provides a kind of Host Strains, and described Host Strains comprises above-mentioned plant provided by the invention cold abduction delivering promotor Poscold2, above-mentioned expression cassette or above-mentioned recombinant expression vector; Preferably, described Host Strains is agrobacterium tumefaciens.
On the other hand, the invention provides a kind of transformant, described transformant comprises above-mentioned plant provided by the invention cold abduction delivering promotor Poscold2, above-mentioned expression cassette, above-mentioned recombinant expression vector.Wherein, described transformant is preferably transgenic cell line, callus or plant.
Again on the one hand, the invention provides the cold abduction delivering promotor Poscold2 of above-mentioned plant and cultivate the application in transgenic plant.Described application comprises above-mentioned plant provided by the invention cold abduction delivering promotor Poscold2 is connected to the gene order upstream to be expressed of carrier (such as, before described promoter sequence is placed in target gene), thus structure recombinant expression vector, described recombinant expression vector is transformed in vegetable cell, tissue or organ and cultivates.Described gene to be expressed preferably can provide resistance to cold for plant, i.e. cold tolerance gene.
And preferably, described application may be used for improving plant growth characteristic, described plant is monocotyledons, such as paddy rice, wheat, corn, barley, Chinese sorghum or oat, is preferably paddy rice.
The DNA sequence dna of the promotor provided in the present invention for (with SEQ ID No: identical in 1):
tccagttgattaccatcagatgacacatgaacatcaggatcagccgggagtgcacgtgat60
tgtgccaccatgggtccatggctgttttggacacattgcgtgtgacgacgcccctcaatc120
atctcaaacctgatcaggttttctcaccggagatgctcctatgatggctgtttggaataa180
ccaggtaggagtagtactagtactacccaagtggtgcacgtggcatggtgcgcctgacag240
gtcgggcccacgggtcacgatccacatcgcccccgaaaaaggtcagtggagaaaacaatg300
agcggttgagcgcaaaacatgtggccgaggcgtgtctcggagccctgcagcgccaacccg360
taagcttgtggccagggatagtccatttgttcctctcacggtggtacggagaagagaaca420
acaaacagcgggttctctccctgctgtgcgcctctggttgggcgacatgtggcgggcggt480
gagttggcagctgcgtgtctcggtggctttgacgtgtccaaaaagcgagcgggtgggggc540
cccctcctccgctgcgcttttcttttctttctatccatccaaacagggacagtcctgtct600
cctgtgcctagatttgcatgtcgccagatacgtctcctgtactcccttcgactacctccg660
tccaaaaatataataactttttactataaatctggacacacatgtgtccaaatttatagc720
taaaaatgcttacatttttttatggagggagtatttcaattgcagccatgattttccgtg780
tctaactttaaccgtctgttttatttaattttttttaaaaaaataaaaacataagtcagg840
agtaaagtattgtttatattttatcatctcataaaaaaaactaattacaaaattttttta900
aataagatggacgatcaaattatgatcgcacttaaaataaaacggagggagtagaagaga960
aaaagctcaataattcgtgtagtaccccgaaagccagccgaggtgacatcaccgcagttc1020
tgctcatagtttgatccaaaacagttttagagtttgttctcactactaagttcaaccccc1080
caagatattttcattctttgcttgccaaaaatcatcagcagaaaaaaacatgaactgctt1140
gttaattcgatctataccaaccgaagtttacctgaaactctgataactgcagcctatcat1200
gctccaccagctgccagggcaattatggtactatctccagagcacgcacacagtaaatag1260
cagcctaacatccttcgatcttatcgtcggcaaaacacacacgcatagagtggataggat1320
cacaggaacatgccatcgattcgtgaagacccacgaaagcgcacggttttactcctacac1380
ccacatactagtagtagtagcggtagcagtacggtacatgtggctagtactagcagtaat1440
gcttggtccggagcagcgagccgtgtggttgctgcagtgtgcgagtagccaactagtggc1500
aaccagacacatggacaagtagcagcgaagcaggcgaaggaaggggcaagtgagtgccgt1560
gaagcagcgagagccacaagaatcgagcggcttccggggctctctacaggattgaggcga1620
aaagtgcaaagccggaaagggagagagagaaaaaagcgtagaaaaatccgatccgacgtg1680
gcgccctggcctgtgccctttttctcctctctcctgcctcctcttggtctcatttcccct1740
tcctgccttgcctcctcgtctccttctctgctgctctccaagctcttcctgcttccatca1800
ggttgtctcgagaaagattggagtttttggtggtttgggttgtgcggttcttgcttttgt1860
tggcgcaagcgcatggctggttctgggacatagtgagctgagatagagttcttgtgttcg1920
gtggagtttggctttggtgaatcttcgattcaagtctggag1961
It should be noted that: in the DNA sequence dna of above-mentioned promotor, sequence beginning is with italic and the sequence " tccagttgattaccatcagatg " that overstriking represents is the retention sequence obtaining the forward primer used in promotor process, amounts to 22bp; Sequence end is with italic and the sequence " aatcttcgattcaagtctggag " that overstriking represents is the retention sequence (corresponding sequence of this retention sequence and reverse primer is complementary) obtaining the reverse primer used in promotor process, amounts to 22bp; In this DNA sequence dna, remaining part is then available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that mentioned promotor both can refer to above-mentioned whole DNA sequence dna herein, also can refer to the DNA sequence dna after removing above-mentioned primer retains sequence.
In sum, the present inventor's separating clone from the fine paddy rice of Japan (OryzasativaLcv.Nipponbare) obtains the DNA sequence dna that structure comprises the 1961bp of transcription initiation site, and by the SEQIDNo:1 in its called after Poscold2(sequence table).This sequence is connected to after enzyme is cut on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (i.e. recombinant expression vector), utilize this recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then carry out the conversion of paddy rice by agriculture bacillus mediated method, obtain transgenic rice plant.Histological chemistry is carried out to the transgenic paddy rice obtained and detects discovery, transfer-gen plant is after cold induction process, the relatively high and aobvious blueness of Gus gene expression dose on the whole, thus prove that the sequence of this 1961bp has the activity driving genetic expression, and the Gus gene of this promoters driven is specific expressed after Rice Cold induction process.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.Further, this promoter sequence can link with required target gene, builds recombinant plant expression vector, through transforming, target gene can be driven specific expressed in plant after cold induction process, thus improve the expression amount of exogeneous target gene in plant, increase genetically modified effect.When embody rule, target gene can be chosen as the gene (cold tolerance gene) having and improve plant resistance to cold function, like this, after cold induction process, this gene great expression, strengthens the resistance to cold of plant.
Technique effect
The rice starter Poscold2 that the present invention clones can concentrate expression by regulatory gene in plant in good time, has remarkable value in actual applications.By this promotor, genetic modification is carried out to variety of crops, as expressed in plant by this promoter regulation target gene, replacing the constitutive promoters such as 35S, thus cultivating the high cold-resistant transgenic plant kind of desirable biological safety.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is schematic diagram Poscold2 promotor be implemented in pCAMBIA1391 vector plasmid, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, in Fig. 1, B is pCAMBIA1391-Poscold2 schematic diagram, illustrated therein is the gus gene utilizing Poscold2 promoters driven to be positioned at its downstream and expresses;
Fig. 2 is the Poscold2::GUS transfer-gen plant tissue staining figure of sprouting after 21 days.The rice plant of normal growth under 28 DEG C of conditions, after dyeing in 24 hours, root (A), stem (B), leaf (C) is all active without GUS, and 4 DEG C of deepfreezes after 24 hours, then after 30min dyeing, at root (D), stem (E), all has GUS strong expression (scale=10mm) in leaf (F).
Fig. 3 is the result schematic diagram of promotor of the present invention being carried out to digestion verification.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.
The acquisition of the Poscold2 promotor containing restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan provided in NCBI fine (OryzasativaLcv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy rice PCole1 gene, and according to the feature of the carrier selected and target gene, the restriction enzyme site of design primer.
With paddy rice binary expression vector pCAMBIA1391(Figure 1A in the present embodiment, come from CAMBIA, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, and the primer of specific design is: forward primer (SEQIDNo:2) 5 ' end band SalI, restriction enzyme site (GTCGAC), reverse primer (SEQIDNo:3) 5 ' end band SmaI, restriction enzyme site (CCCGGG), primer sequence is as follows:
Forward primer: GTCGACTCCAGTTGATTACCATCAGATGSalI
Reverse primer: CCCGGGCTCCAGACTTGAATCGAAGATTSmaI
Synthesized by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor Poscold2
With the fine DNA of rice varieties Japan for template, utilize the amplification of forward primer, reverse primer promotor Poscold2, routinely PCR system, adopt following amplification program:
95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min30s, perform 35 circulations extended to 72 DEG C from 95 DEG C of denaturations; Last 72 DEG C extend 10min.
Reclaim the object fragment of pcr amplification, object fragment length 1961bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, ratio mixing in carrier specification sheets) on, after heat shock method transformation of E. coli XL-Blue competent cell, competent cell is activated, and then object fragment is transferred in the competent cell of activation, then, screen through bacterium colony PCR and obtain positive colony, picking mono-clonal shakes bacterium liquid upgrading grain, carries out double digestion checking, as shown in Figure 3 with SalI and SmaI.Positive colony through qualification is delivered the order-checking of Invitrogen company.Verify that correct clone is the promotor Poscold2 that will obtain, its nucleotide sequence is as shown in SEQIDNo:1.
The structure of plant expression vector and the conversion of Agrobacterium
Extract plasmid in the positive colony obtained " acquisition of promotor Poscold2 " process from above, with SalI and SmaI double digestion, reclaim promotor Poscold2 fragment.Utilize SalI and SmaI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned Poscold2 fragment is connected with pCAMBIA1391 fragment T4 ligase enzyme (being purchased from TaKaRa company), obtain plant expression vector pCAMBIA1391-Poscold2(Figure 1B of promotor Poscold2 and Gus gene fusion), utilize freeze-thaw method plant expression vector to be proceeded to agrobacterium tumefaciens (Agrobacteriumtumefaciens) EHA105(Academy of Agri-Science and Technology Anhui Province genetically modified organism product composition supervision and inspection center of Ministry of Agriculture paddy rice group to preserve), positive plasmid is extracted from freeze-thaw method products therefrom, digestion verification is carried out with SalI and SmaI, the result as shown in Figure 3.
Promotor Poscold2 is utilized to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
After ripe rice paddy seed is removed clever shell, with 70% alcohol-pickled seed 1min, outwell alcohol.50% clorox (stoste effective chlorine density is greater than 4%) solution soaking seed 40min(150r/min with containing 1 Tween20).Outwell clorox, aseptic washing is clarified, without clorox taste to solution for 5 times.Sterilized water soaks seed and spends the night.With scalper, embryo is peeled along aleurone layer by seed, embryo is inoculated on calli induction media.At 30 DEG C light culture after 11 days by callus and endosperm and germ separation, by go bud in good condition, divide vigorous elementary callus and carry out preculture and be used for Agrobacterium-mediated Transformation after 3 ~ 5 days.
The agrobacterium tumefaciens having proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process is adopted to carry out Agrobacterium-mediated genetic transformation, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to YongboDuan(YongboDuan, ChenguangZhai, etal.Anefficientandhigh-throughputprotocolforAgrobacteri ummediatedtransformationbasedonphosphomannoseisomerasepo sitiveselectioninJaponicarice (OryzasativaL.) [J] .PlantCellReport, method 2012.DOI10.1007/s00299-012-1275-3.) etc. proposed.
Obtain 22 strain pCAMBIA1391-Poscold2 plant (Poscold2::gus transgenic rice plant) altogether.
Step 2, deepfreeze and GUS histochemical stain
By the deepfreeze after 24 hours at 4 DEG C of obtained plant, dye through 30minGUS again, dyeing process is with reference to Jefferson (people .GUSfusion: β-Glucuronidaseasasensitiveandversatilegenefusionmarkerinh igherplant [J] .EMBOJ. such as JeffersonRA, 1987, method 6:3901-3907) etc. proposed, to the tissue of dyeing be needed to vacuumize, then immerse in staining fluid.Under 37 DEG C of conditions, 95% Ethanol Treatment is used, to negative control material in white during decolouring.
The Poscold2::GUS transfer-gen plant tissue of sprouting after 21 days is dyeed.As shown in Figure 2, the rice plant of normal growth under 28 DEG C of conditions, after dyeing in 24 hours, root (A), stem (B), leaf (C) are all active without GUS, and 4 DEG C of deepfreezes after 24 hours, then after 30min dyeing, in root (D), stem (E), leaf (F), all there is GUS strong expression.
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (6)
1. the cold abduction delivering promotor Poscold2 of a kind of plant, is characterized in that, the DNA sequence dna of the cold abduction delivering promotor Poscold2 of described plant is the sequence shown in SEQIDNo:1.
2. an expression cassette, is characterized in that, described expression cassette comprises the cold abduction delivering promotor Poscold2 of plant according to claim 1.
3. a recombinant expression vector, it is characterized in that, described recombinant expression vector comprises the cold abduction delivering promotor Poscold2 of plant according to claim 1, in described recombinant expression vector, described plant cold abduction delivering promotor Poscold2 is connected to the upstream of gene order to be expressed in carrier.
4. recombinant expression vector according to claim 3, is characterized in that, described gene to be expressed is Gus gene, and described recombinant expression vector is pCAMBIA1391-Poscold2, and wherein pCAMBIA1391 is plant binary expression vector.
5. recombinant expression vector according to claim 3, is characterized in that, described gene to be expressed is the gene with resistance to cold.
6. the cold abduction delivering promotor Poscold2 of plant according to claim 1 is cultivating the application in transgenic paddy rice, it is characterized in that, described application comprises: cold for plant according to claim 1 abduction delivering promotor Poscold2 is connected to gene order upstream to be expressed in carrier, thus builds recombinant expression vector; Described recombinant expression vector is transformed in rice cell, tissue or organ and cultivates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410119971.8A CN103849622B (en) | 2014-03-27 | 2014-03-27 | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410119971.8A CN103849622B (en) | 2014-03-27 | 2014-03-27 | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103849622A CN103849622A (en) | 2014-06-11 |
| CN103849622B true CN103849622B (en) | 2016-01-27 |
Family
ID=50857746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410119971.8A Expired - Fee Related CN103849622B (en) | 2014-03-27 | 2014-03-27 | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103849622B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059919B (en) * | 2014-07-08 | 2016-10-12 | 安徽省农业科学院水稻研究所 | Plant heat shock evoked promoter Posheat3 and application |
| CN104073493B (en) * | 2014-07-09 | 2016-06-22 | 安徽省农业科学院水稻研究所 | The cold induction strongly expressed promoter Poscold4 of plant and application thereof |
| CN104928295B (en) * | 2015-06-11 | 2018-06-12 | 安徽省农业科学院水稻研究所 | The cold-induced expression promoter POscold7 of rice seedling |
| CN105063053B (en) * | 2015-09-23 | 2018-02-27 | 安徽省农业科学院水稻研究所 | The cold-induced expression promoter POsCold9 of plant and its derivative |
| CN105087590B (en) * | 2015-09-23 | 2017-10-20 | 安徽省农业科学院水稻研究所 | A kind of promoter element POsCold8 and its application method and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766618B (en) * | 2012-05-24 | 2013-12-04 | 华南农业大学 | Rice OsICL protein and coding gene thereof, and application of the two |
-
2014
- 2014-03-27 CN CN201410119971.8A patent/CN103849622B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103849622A (en) | 2014-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103849622B (en) | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof | |
| CN104946649A (en) | Specific expression promoter OsAnth1 for rice anthers | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN103849621B (en) | The cold abduction delivering promotor Poscold1 of one kind of plant and application thereof | |
| CN104046629B (en) | A kind of plant salt abduction delivering promotor POsSalt1 and application thereof | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN103740719B (en) | The separation of Rice Vascular Bundle specific expression promoter POsvas 1 and application | |
| CN104087588B (en) | The rice drought-inducible promoter POsDro4 of response environment water stress | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN105063047A (en) | Plant seed specific expression promotor OsSee1 | |
| CN104087587B (en) | A kind of plant drouhgt stress abduction delivering promotor and application | |
| CN103834661B (en) | A kind of vegetable hot abduction delivering promotor Posheat1 and application thereof | |
| CN103882021B (en) | One Plants drought-induced expression promoter PosDro1 and application thereof | |
| CN104073493B (en) | The cold induction strongly expressed promoter Poscold4 of plant and application thereof | |
| CN103773766B (en) | A kind of rice root specific expressing promoter POsRo1 and application thereof | |
| CN103710344B (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
| CN104073490B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro3 | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
| CN104073492B (en) | A kind of crop aleurone specific expression promoter PosAL1 and application thereof | |
| CN105567695A (en) | Rice non-endosperm expression promoter SAFES3 and application thereof | |
| CN105087591A (en) | Rice root tip specific expression promoter posro3 | |
| CN104845973A (en) | Cloning and applications of low-temperature strong inducible promoter POscold6 of rice | |
| CN104845974A (en) | DNA (deoxyribonucleic acid) segment POscold5 capable of responding to long-term cold stress |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160127 Termination date: 20200327 |