CN105063053B - The cold-induced expression promoter POsCold9 of plant and its derivative - Google Patents

Abstract

The present invention discloses a kind of cold-induced expression promoter POsCold9 of plant.Present invention also offers the derivative containing the promoter, the derivative includes expression cassette, plant expression vector, Host Strains and transformant.And the present invention is applied in plant genetic engineering.Present inventor to the specific gene group of rice varieties Nipponbare by being expanded, being separated, being analyzed, utilization and experimental verification, so as to obtain and demonstrate the section of DNA sequence with specific function --- Rice Cold inducible expression's promoter POsCold9.Promoter provided by the invention specifically can drive foreign gene to be expressed under the conditions of cold-induced, therefore constitutive promoter driving target gene is substituted with the promoter in genetic engineering, both can be with specific expression target gene, the invalid expression of other genes will be avoided again, so as to have the function that to improve rice varieties.

Description

The cold-induced expression promoter POsCold9 of plant and its derivative

Technical field

The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to a kind of rice Cold-induced expression promoter POsCold9 and its application, the promoter can conditionally drive in Transgenic Rice adjustment and control system The expression of moving-target gene.

Background technology

Rice is important cereal crops, and it is one of important restriction factor for influenceing Rice Production to damage to plants caused by sudden drop in temperature.Sprouting stage, seedling stage and Booting florescence experience damages to plants caused by sudden drop in temperature, and will cause that young rice seedlings growth is slow, tiller is reduced, and ultimately causes the significantly drop of rice yield It is low.Analysis of Rice Chilling Injury refers to that rice meets with the temperature below minimum critical-temperature needed for development, causes the physiological damage of rice, Cause rice to be unable to normal growth and development and make yield reduction.Rice Growing is interim, which to have 4 periods most easily to be damaged to plants caused by sudden drop in temperature, influences, respectively It it is sprouting stage, seedling stage, boot stage and flowering and grouting phase, wherein boot stage damages to plants caused by sudden drop in temperature has close relationship with rice yield.Boot stage Damage to plants caused by sudden drop in temperature and refer to that rice enters reproductive growth and influenceed between beginning full heading time by low temperature, cause pollen development abnormal after And influence one kind that normal pollination of blooming forms ghost and damage to plants caused by sudden drop in temperature.It is this kind of to damage to plants caused by sudden drop in temperature often in northeastern Japan portion and Hokkaido, Philippine north Portion, north India mountain area, Indonesia mountain area, Nepal, northeast, the Yunnan-Guizhou Plateau round-grained rice in California, USA and China Occur in the late rice of rice region and In Middle And Lower Reaches of Changjiang River.

Harm of the chilling injury to rice is many.Rice has a boundary requirement to temperature, illumination etc., when super It is gently then aggrieved when going out the high/low temperature limit endured, it is heavy then downright bad.Rice, which runs into low temperature in spring, not only reduces quality of seedlings postponement Transplanting date, it is bigger the problem of be that delay is turned green tiller and Spike development, heading is influenceed maximum.By low temperature cold in vegetative growth phase Evil, the differentiation of fringe initial body is general to postpone 5-10d, evening heading 7d or so.The harm of cool summer damage due to impotency meets with rice reproductive stage By chilling damage, turn into not Yukon grain so that the obvious underproduction.Rise's boot period easily causes infertile to low-temperature sensitive；Heading is opened Glume was not opened flower pesticide and not ftractureed, pollen agensis by chilling damage florescence, so causing sterile grain.Mixed cold harm one As harm to rice it is maximum.Chilling injury can also cause the generation of rice blast, rice sheath rot etc..

In addition, temperature is also to influence an important environmental factor of rice grain quality.Therefore, solve paddy cool injury to ask Inscribe for world's food security, promote the economic development in rice producing region to be of great practical significance.

There is a complicated low temperature stress signal response network system in plant.Plant energy after by low temperature stress A series of gene genetic modification is carried out by the system, metabolism and growth to itself are adjusted to adapt to the unfavorable factor Influence to caused by it.Using key gene in this response network, tolerance of the plant to low temperature can be effectively improved.

Zhong Kang etc. (2007) is by zinc finger protein albuminoid OsCOIN genes overexpression render transgenic rice in rice Middle proline content rise, improve the cold resistance of plant.Zhang Hongsheng etc. (2009) is by paddy rice zinc finger protein ZFP245 genes in water Overexpression in rice, find overexpression ZFP245 trans-genetic hybrid rice make in the case where the cold side of body is near Proline Accumulation related gene OsP5CS and The expression quantity of proline transport gene OsProT genes improves, and promoting the amount of proline increases, and strengthens the cold resistance of plant.Yu Shu U.S.s etc. (2010) find that MYBS3 overexpressions rice can survive after being handled at 4 DEG C, and do not influence its Main Agronomic Shape.In addition, the cold resistance of rice can be improved to the overexpression of some transcription factors such as including DREB/CBF, NAC.

China's rice pest insects enrich, and excavate, position from rice, cloning cold-resistant related gene and its cold induced promoter general Seed selection to rice cold tolerance kind has important theory and practical significance, in agriculture field by with wide application and market Prospect.Therefore, people are highly desirable finds more specificity promoters, for improving the cold resistance of rice.

The content of the invention

In view of the above-mentioned problems, it is an object of the invention to provide it is a kind of separate identification background signal be low, that inductivity is high is new Promoter, this promoter will have great significance to crop gene engineering, especially paddy cool injury tolerance aspect.

To achieve these goals, on the one hand, the present invention provides a kind of Rice Cold induced expression promoter POsCold9, institute Stating Rice Cold induced expression promoter POsCold9 can drive target gene specific expressed under the conditions of cold-induced.

Preferably, the Rice Cold induced expression promoter POsCold9 is included：

(a)SEQ ID NO:Nucleotide sequence shown in 1；Or

(b) in SEQ ID NO:Substitute one or more nucleotides in nucleotide sequence shown in 1 and mesh can be driven Mark gene nucleotide sequence specific expressed under the conditions of cold-induced；Or

(c) in SEQ ID NO:One or more nucleotides are added in nucleotide sequence shown in 1 and mesh can be driven Mark gene nucleotide sequence specific expressed under the conditions of cold-induced；Or

(d)SEQ ID NO:Sequential nucleotide deletion one or more nucleotides shown in 1 and target base can be driven Because of nucleotide sequence specific expressed under the conditions of cold-induced；Or

(e) with SEQ ID NO:Nucleotide sequence shown in 1 has at least 90% homology, and can drive target base Because of nucleotide sequence specific expressed under the conditions of cold-induced；Or

(f) under strict conditions with SEQ ID NO:Nucleotide sequence hybridization shown in 1 and target gene can be driven The specific expressed nucleotide sequence under the conditions of cold-induced；

(g)SEQ ID NO:Nucleotide sequence shown in 2；Or

(h) with SEQ ID NO:It is that nucleotide sequence shown in 2 has at least 90% homology and target can be driven Gene nucleotide sequence specific expressed under the conditions of cold-induced；Or

(i) in SEQ ID NO:Substitute one or more nucleotides in nucleotide sequence shown in 2 and mesh can be driven Mark gene nucleotide sequence specific expressed under the conditions of cold-induced；Or

(j) in SEQ ID NO:One or more nucleotides are added in nucleotide sequence shown in 2 and mesh can be driven Mark gene nucleotide sequence specific expressed under the conditions of cold-induced；Or

(k) in SEQ ID NO:Sequential nucleotide deletion one or more nucleotides shown in 2 and target can be driven Gene nucleotide sequence specific expressed under the conditions of cold-induced；Or

(l) under strict conditions with SEQ ID NO:Nucleotide sequence hybridization shown in 2 and target gene can be driven The specific expressed nucleotide sequence under the conditions of cold-induced.

These Rice Cold induced expression promoter sequences and SEQ ID No:DNA sequence dna shown in 1 and 2 has identical work( Can, that is, drive target gene to be expressed under the conditions of cold-induced in plant.

SEQ ID No in sequence table:DNA sequence dna shown in 1 and 2 is from Nipponbare rice (Oryza sativa L Cv.Nipponbare Rice Cold induced expression promoter), referred to herein as POsCold9 or promoter POsCold9.Specifically For, inventors herein have recognized that Nipponbare rice (Oryza sativa L cv.Nipponbare) upstream region of gene includes turning The DNA sequence dna of 2015bp including record initiation site, there is the function that driving target gene is expressed under the conditions of cold-induced, and Separation is cloned and identifies the function of the DNA sequence dna.

On the other hand, the present invention also provides a kind of expression for including above-mentioned Rice Cold induced expression promoter POsCold9 Box.

Another aspect, the present invention also provide a kind of recombinant expression carrier, and the recombinant expression carrier includes above-mentioned rice Cold-induced expression promoter POsCold9, in the recombinant expression carrier, the Rice Cold induced expression promoter POsCold9 is connected to the upstream of gene order to be expressed；Preferably, the gene to be expressed is Gus genes, described heavy Group expression vector is pCAMBIA1391-POsCold9, and the recombinant expression carrier is by SEQ ID No:Sequence shown in 1 is POsCold9 or promoter POsCold9 are implemented in the recombinant expression carrier obtained in pCAMBIA1391, referred to herein as pCAMBIA1391-POsCold9。

Another further aspect, the present invention provide application of the above-mentioned Rice Cold induced expression promoter in genetically modified plants are cultivated. The application includes for above-mentioned Rice Cold induced expression promoter provided by the invention being connected to the gene sequence to be expressed of carrier Upstream (for example, the promoter sequence is inserted before target gene) is arranged, so as to build recombinant expression carrier, by the restructuring Expression vector is transformed into plant cell, tissue or organ and cultivated.

And preferably, the application can be used for improving plant growth characteristic, the plant is monocotyledon, such as Rice, wheat, corn, barley, jowar or oat, preferably rice.

The DNA sequence dna of promoter provided in the present invention is (with SEQ ID No in sequence table:It is identical in 1)：

GATGGTTATTGACGTGTACGTCTATATATGAACGCCCCTCATATTTGTATCCCCAGCTGTGAGAGATCAGCGTCGAG AGGGTTCTCGTGGTCCATAGTGGCGGAAGAGAAGAGAAGGGAGCCGATGAGCTCAAGCTCACCAAGCATGTGCGAGA AGGAGGCGGCGGCGGTGGCGGTGGGCAGCTAGAGTGGATGAGGCCGCAGCCTACAGCAGCGGAGGAGGAGAGGACGG AGGTGATGGAGAAGATGCGCCCAAAATTTTAAGGTGTGCTTAGTTCCACGATAAAATTGGAAGTTTGACTAATATTG AAAGTTTGAAGAAAAAAGTTGGAAGTTTATGTGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTGGAAGTTTGAATA AAAAGTTGGGAACTAAATAAGGGCTTAGTCTATAAATTTCAAAAGTTGAAAGGTTGGGCTGATTTTTTTTTTTTTTT ATGTTTTGAGGTTAAGAGAAATGATTGAGTTGGACTATGAAAGATCCCATGGCCTATGGCCCATTACCACCCTTTCA AGCTCAACAAGTTCGAGATGGCCCAACTTGTTGCAGCCGATCGAGCCTATCCTACCCTAGCTAAGCATGACTCGAAA TGAACAAGACGTGCCAGCAGGAGTCATGCTGCCTTGTGTAGGAAGCACCCGAGCCGCTGAACAATCAACTGGAGTAT TGAAATTTGAAAGGTGCTCTCGTGGAATATTTGCACAGCTGGTGGACGTGCGAGGACTAGGAGACCTCGAATCGGGC TACGGAAAATCCCAAAACGCTAGCGACGTCAACGTGTGCTTTTCTTGGCTTCCAAGCAGGTCTGCCTCCTGCCTTCC TGCCTCCTATGGTGTCCACCAGTTCTCTCCTGGTCAAAGTATGTAAAGTTTAACTGGGCGTTCGGCTTGACTAGAAA GGGATAGATTATTAATGAATAATTAATTAATTATTAACTATTTTCAATTTTAAAAATAGATTCCTTTTTATTTTTTA AAACCTTCTATATATAAAGTTTTTTTAAAAGAAATATATACTTTTAACAATTTAAGAAGTGTGCTCACGAAAACGAT AAAGTTGCTCAGTCAAAATGTGGAATCAAATCCAGCTAGGTGAAGGCCTTGCCATTTGCAAATTGCAGTGGCACATT CATGAGGGTGTGTCGCTAAGGTGACAGTGACCTGAAGAATTCCTAGTTCTAGATGTATTGATCTGCTCTACCGTAAA GGATACTCCAGGTTTATATTACTCTCTCTATTTCAAAATATAAGAAGTTTTGATTGGATAGAAAATATTTTTTAAGT ACGAATCAGATTCATAATAGTATGATGTGTTCCATCTAATCAAGATTTTTTTATATTTTGAAACGGAGGGAGCATTA GTTTGCTCAAAGCTCGTACGAAATTGACCGTTGGTATCTGCATCAGAAAACATGGATCGGTATTTTACACACGTGTA TGTGTGGCGCTAGGCATTTTTTGCGATCACGTGGAAGATTCACACGTATAACACGCACGTAACGTATGTACGCGCAG ACGTCCTATTGCCCAGCTAGCCAGCATCGATTGCCTGAACGTACATGCATCGGGACGCCACGACGAAGATTTCGGCC CCAGTTGAAAATTCAGCTAATGATCACGCAGAAAAGGAACAGCAGTACGTACAGCTGAAGAAAAACAACACGGGTCT TGGGCTCGTCGCGCTCATACTTGTGGTTGTGTAATCTTTGCAAAATCCTGGCGTAATCACATGGCTAGTACATCCCG CCTTCCCCGTCAGTTCCATTTTCCAAGCACCGAAAAAACAGGAGTGCGCGTAACAGTCAAAATCCTGCACAGGAAAT GCCTATATATGCAGGTACCTCCTCCACCCAGTGATGTCACCCAGCTCGAGCAAATAGGCTGTAGCTAGCCGGCCGGC GAGAAAAATGGACGAGTCAGGCAGAGGAACAGGTGATGATCATGGC

Or it is (identical with SEQ ID No.2)：

GATGGTTATTGACGTGTACGTCTATATATGAACGCCCCTCATATTTGTATCCCCAGCTGTGAGAGATCA GCGTCGAGAGGGTTCTCGTGGTCCATAGTGGCGGAAGAGAAGAGAAGGGAGCCGATGAGCTCAAGCTCACCAAGCAT GTGCGAGAAGGAGGCGGCGGCGGTGGCGGTGGGCAGCTAGAGTGGATGAGGCCGCAGCCTACAGCAGCGGAGGAGGA GAGGACGGAGGTGATGGAGAAGATGCGCCCAAAATTTTAAGGTGTGCTTAGTTCCACGATAAAATTGGAAGTTTGAC TAATATTGAAAGTTTGAAGAAAAAAGTTGGAAGTTTATGTGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTGGAAG TTTGAATAAAAAGTTGGGAACTAAATAAGGGCTTAGTCTATAAATTTCAAAAGTTGAAAGGTTGGGCTGATTTTTTT TTTTTTTTATGTTTTGAGGTTAAGAGAAATGATTGAGTTGGACTATGAAAGATCCCATGGCCTATGGCCCATTACCA CCCTTTCAAGCTCAACAAGTTCGAGATGGCCCAACTTGTTGCAGCCGATCGAGCCTATCCTACCCTAGCTAAGCATG ACTCGAAATGAACAAGACGTGCCAGCAGGAGTCATGCTGCCTTGTGTAGGAAGCACCCGAGCCGCTGAACAATCAAC TGGAGTATTGAAATTTGAAAGGTGCTCTCGTGGAATATTTGCACAGCTGGTGGACGTGCGAGGACTAGGAGACCTCG AATCGGGCTACGGAAAATCCCAAAACGCTAGCGACGTCAACGTGTGCTTTTCTTGGCTTCCAAGCAGGTCTGCCTCC TGCCTTCCTGCCTCCTATGGTGTCCACCAGTTCTCTCCTGGTCAAAGTATGTAAAGTTTAACTGGGCGTTCGGCTTG ACTAGAAAGGGATAGATTATTAATGAATAATTAATTAATTATTAACTATTTTCAATTTTAAAAATAGATTCCTTTTT ATTTTTTAAAACCTTCTATATATAAAGTTTTTTTAAAAGAAATATATACTTTTAACAATTTAAGAAGTGTGCTCACG AAAACGATAAAGTTGCTCAGTCAAAATGTGGAATCAAATCCAGCTAGGTGAAGGCCTTGCCATTTGCAAATTGCAGT GGCACATTCATGAGGGTGTGTCGCTAAGGTGACAGTGACCTGAAGAATTCCTAGTTCTAGATGTATTGATCTGCTCT ACCGTAAAGGATACTCCAGGTTTATATTACTCTCTCTATTTCAAAATATAAGAAGTTTTGATTGGATAGAAAATATT TTTTAAGTACGAATCAGATTCATAATAGTATGATGTGTTCCATCTAATCAAGATTTTTTTATATTTTGAAACGGAGG GAGCATTAGTTTGCTCAAAGCTCGTACGAAATTGACCGTTGGTATCTGCATCAGAAAACATGGATCGGTATTTTACA CACGTGTATGTGTGGCGCTAGGCATTTTTTGCGATCACGTGGAAGATTCACACGTATAACACGCACGTAACGTATGT ACGCGCAGACGTCCTATTGCCCAGCTAGCCAGCATCGATTGCCTGAACGTACATGCATCGGGACGCCACGACGAAGA TTTCGGCCCCAGTTGAAAATTCAGCTAATGATCACGCAGAAAAGGAACAGCAGTACGTACAGCTGAAGAAAAACAAC ACGGGTCTTGGGCTCGTCGCGCTCATACTTGTGGTTGTGTAATCTTTGCAAAATCCTGGCGTAATCACATGGCTAGT ACATCCCGCCTTCCCCGTCAGTTCCATTTTCCAAGCACCGAAAAAACAGGAGTGCGCGTAACAGTCAAAATCCTGCA CAGGAAATGCCTATATATGCAGGTACCTCCTCCACCCAGTGATGTCACCCAGCTCGAGCAAATAGGCTGTAGCTAGC CGGCCGGCGAGAAAAATGGACGAGTCAGGCAGAGGAACAGGTGATGATCATGGC

It should be noted that：In first DNA sequence dna of above-mentioned promoter, sequence beginning is with the italic sequence that simultaneously overstriking represents Row " AGGGCTTCTTTATGACATGGTA " are the retention sequence for obtaining the forward primer used during promoter, are amounted to 22bp；During the sequence " CGGGAGACGAAGGATGCTGCGG " that sequence end is represented with italic and overstriking is acquisition promoter The retention sequence (the retention sequence and the corresponding sequence of reverse primer complementary) of the reverse primer used, altogether 22bp；The DNA sequences Remaining part is then obtained from the DNA sequence dna in Nipponbare rice, as shown in second sequence in row.It is emphasized that Promoter mentioned herein can both refer to above-mentioned whole DNA sequence dna, can also refer to after removing above-mentioned primer retention sequence DNA sequence dna.It should be noted that even if those skilled in the art obtain class on the basis of the present invention, using other primers Like sequence, it is also fallen within protection scope of the present invention.

In summary, the inventors found that, extract and identify Nipponbare rice (Oryza sativa L Cv.Nipponbare) 2015bp of the POsCold9 upstream region of gene including transcription initiation site DNA sequence dna, and ordered Entitled promoter POsCold9.The sequence is connected to after digestion on plant binary expression vector pCAMBIA1391, obtains phase The recombinant plasmid (i.e. recombinant expression carrier) answered, using recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then use agriculture The method of bacillus mediation carries out the conversion of rice, obtains transgenic rice plant.Gus expression is carried out to the transgenic paddy rice of acquisition Quantitative detection finds that the Gus gene expression doses under the conditions of cold-induced of transfer-gen plant improve, so as to prove the 2015bp's Sequence has driving gene activity specific expressed under the conditions of cold-induced.

Rice Cold induced expression promoter POsCold9 of the present invention can be connected with plant binary expression vector, be used for Substitute constitutive promoter.Also, the promoter sequence can be connected with required target gene, structure recombinant plant expression carries Body, after inverted, the expression of target gene is driven under the conditions of cold-induced, increases the effect of transgenosis, improves the characteristic of rice.

Technique effect

The rice starter POsCold9 that is cloned of the present invention can controlling gene expression is concentrated under the conditions of cold-induced, There is significantly value in practical application.Genetic modification is carried out to variety of crops by the promoter, such as driven by the promoter Moving-target gene is expressed in plant, can improve and improve the cold resistant property of rice, is planted so as to cultivate preferable transgenosis Article kind.

Brief description of the drawings

Hereinafter, embodiment of the present invention is described in detail with reference to accompanying drawing, wherein：

Fig. 1 is that POsCold9 promoters are implemented in schematic diagram in pCAMBIA1391 vector plasmids, and A is in wherein Fig. 1 PCAMBIA1391 schematic diagrames, B is pCAMBIA1391-POsCold9 schematic diagrames in Fig. 1, illustrated therein is and is opened using POsCold9 The Gus gene expressions of mover driving downstream；

Fig. 2 is the result schematic diagram that digestion verification is carried out to promoter of the present invention；

Fig. 3 is to drive gus reporter gene transgenic paddy rice as material using the POsCold9 of 10 days after sprouting, cold at 4 DEG C Stress treatment.After stress 24 hours, pass through the qualitative dyeing to Reporter gene GUS.As a result show, in each tissue of root, stem and leaf In all go out to represent GUS activity blue signal；And respectively tissue does not detect that GUS is expressed to the plant without Stress treatment； This shows that POsCold9 promoters can be cooled and coerces significantly induction.(scale=5mm)

Fig. 4 is in different stress times (0 hour/untreated, 4 hours, 8 hours, 12 hours, 24 hours, 48 hours) The POsCold9 of 10 days after collection sprouting:GUS Transgenic Rice Seedlings plant, quantitatively detect Gus expression intensities.As a result show： After low temperature induction, POsCold9 expression intensities significantly improve with processing time lengthening, and after processing in 48 hours, activity is up to processing First active 45.28 times.

Embodiment

Illustrate the present invention referring to specific embodiment.It will be appreciated by those skilled in the art that these embodiments are only For illustrating the present invention, its scope not limiting the invention in any way.

Experimental method in following embodiments, it is conventional method unless otherwise specified.Medicine used in following embodiments Material raw material, reagent material etc., unless otherwise specified, it is commercially available products.

The acquisition of POsCold9 promoters containing restriction enzyme site

Step 1, the design of primer

According to rice varieties Nipponbare (the Oryza sativa L cv.Nipponbare) full-length genome provided in NCBI Sequence, according to the sequences Design amplimer of rice POsCold9 genes, and according to the characteristics of the carrier and target gene of selection, Design the restriction enzyme site of primer.

CAMBIA (is come from, open to use carrier, peace with rice binary expression vector pCAMBIA1391 in this experimental example Genetically modified organism product composition supervision and inspection center of the emblem Ministry of Agriculture of Shanxi Academy of Agricultural Sciences rice group preserves) exemplified by, target base Because Gus genes, the primer of specific design is：Forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site (AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band BamHI, restriction enzyme site (GGATCC), primer sequence is as follows：

Forward primer：AAGCTTAGGGCTTCTTTATGACATGGTA HindIII

Reverse primer：GGATCCCCGCAGCATCCTTCGTCTCCCG BamHI

Synthesized by Shenzhen Huada gene company.

The acquisition of step 2, promoter POsCold9

Using rice varieties Nipponbare DNA as template, promoter POsCold9 is expanded using forward primer, reverse primer, is pressed Standard PCR system, using following amplification program：

95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min30s, are circulated 35 times；Finally 72 DEG C of extension 10min.

The purpose fragment of PCR amplifications is reclaimed, purpose fragment length 2015bp, is connected to (the purchase of PGEM-T-Easy carriers From Promega companies, mixed in the ratio in carrier specification) on, convert Escherichia coli XL-Blue competence according to cold shock method After cell, competent cell is activated, and then purpose fragment is transferred to the competent cell of activation, then, sieved through bacterium colony PCR Choosing obtains positive colony, picking monoclonal bacterium solution upgrading grain, carries out digestion verification with HindIII and BamHI, as shown in Figure 2.Will Positive colony by identification is sent and the sequencing of Invitrogen companies.Correctly clone is the promoter to be obtained for checking POsCold9, its nucleotide sequence such as SEQ ID No:Shown in 1.

The structure of plant expression vector and the conversion of Agrobacterium

Plasmid is extracted in the positive colony obtained from above during " promoter POsCold9 acquisition ", uses HindIII With BamHI digestions, promoter POsCold9 fragments are reclaimed.Line is entered to pCAMBIA1391 using HindIII and BamHI simultaneously Propertyization processing, recovery pCAMBIA1391, above-mentioned POsCold9 fragments and pCAMBIA1391 fragments (are purchased from T4 ligases TaKaRa companies) it is attached, obtain promoter POsCold9 and Gus Gene Fusions plant expression vector pCAMBIA1391- POsCold9, plant expression vector is transferred to Agrobacterium tumefaciems (Agrobacterium tumefaciens) using freeze-thaw method EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture rice group preserves).

Expressed using promoter POsCold9 driving Gus reporter genes in rice

Step 1：Agriculture bacillus mediated rice transformation

After mature seed removes glume, with 70% alcohol-pickled seed 1min, alcohol is outwelled.Drip Tween20's with containing 1 50% sodium hypochlorite (stoste effective chlorine density is more than 4%) solution immersion seed 40min (150r/min).Outwell sodium hypochlorite, It is sterile to wash 5 times to solution clarification, no sodium hypochlorite taste.Sterilized water immersion seed is stayed overnight.With aleuron of the scalpel along seed Layer peels embryo, and embryo is inoculated on calli induction media.Light culture divided callus and endosperm and plumule after 11 days at 30 DEG C From being used for the conversion of Agrobacterium after in good condition, the vigorous primary callus of division that remove bud are carried out into preculture 3~5 days.

Using it is above-mentioned " plant expression vector structure and Agrobacterium conversion " during be transferred to recombinant expression carrier Agrobacterium tumefaciems carries out Agrobacterium-mediated genetic transformation, obtains POsCold9::Gus transgenic rice plants, the heredity turn Change, transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phOsphomannOse isomerase pOsitive selection in Japonica rice(Oryza sativa L.)[J].Plant Cell Report,2012.DOI10.1007/s00299- The method of proposition such as 01201275-3.).

The histoorgan dyeing of step 2, transgenic paddy rice seedling is with quantifying

Gus is dyed：Gus reporter gene transgenic paddy rice was driven as material using the POsCold9 of 10 days after sprouting, at 10 DEG C Lower low temperature stress processing.After stress 24 hours, the root, stem and leaf of material are dyed respectively, and takes pictures.

Gus is quantified：Processing 0h, 4h, 8h, 12h, 24h complete stool material are taken as sample, it is limited using Tiangeng biochemical technology The plant total RNA extraction reagent box extraction sample total serum IgE of company, reuses a day Fastquant for root growth Science and Technology Ltd. The reverse transcription of RT kits is cDNA, using cDNA as template, using ACTIN genes as internal reference, with Tiangeng biochemical technology Co., Ltd SuperReal PreMix Plus real-time fluorescence quantitative PCRs premixed liquids are reaction reagent, in the PRISM7500 fluorescence of ABI companies In PCR instrument, pass through the Gus expression intensities of qRT-PCR reaction detection POscold9 and PActin promoter driving.Wherein, it is used for Demarcation ACTIN genes quantitative qRT-PCR primers be：

ACTIN sense primers：5’-CCTTCAACACCCCTGCTATG-3’,

ACTIN anti-sense primers：5’-CAATGCCAGGGAACATAGTG-3’

It is for detecting the qRT-PCR primers that gus gene is expressed：

Gus sense primers：5’-TACGGCAAAGTGTGGGTCAATAATCA-3’

Gus anti-sense primers：5’-CAGGTGTTCGGCGTGGTGTAGAG-3’

As a result show, after low temperature induction, POsCold9 expression intensities significantly improve with processing time lengthening, at 48 hours After reason, activity is up to 45.28 times of before processing activity, and therefore, POsCold9 is a plant cold induced promoter.

Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this Invention is variously modified or deformed, and without departing from the spirit of the present invention, all should belong to the models of appended claims of the present invention Enclose.

Claims (2)

1. a kind of recombinant expression carrier, it is characterised in that the recombinant expression carrier is in plant expression vector pCAMBIA1391 Multiple cloning sites insert the recombinant plasmid that high induced expression amount Rice Cold induced expression promoter POsCold9 is obtained, the height Induced expression amount Rice Cold induced expression promoter POsCold9 is by SEQ ID NO:Nucleotide sequence shown in 1 is formed, In the recombinant expression carrier, the promoter sequence is connected to the upstream of gene order to be expressed in carrier, described to treat table It is cold tolerance gene up to gene.

2. a kind of applications of high induced expression amount Rice Cold induced expression promoter POsCold9 in genetically modified plants are cultivated, its It is characterised by, the high induced expression amount Rice Cold induced expression promoter POsCold9 is by SEQ ID NO:Core shown in 1 Nucleotide sequence is formed, and the application includes：By the high induced expression amount Rice Cold induced expression promoter POsCold9 connections The gene order upstream to be expressed in carrier, so as to build recombinant expression carrier；The recombinant expression carrier is transformed into water Cultivated in rice cell, tissue or organ, the gene to be expressed is cold tolerance gene.