CN104946649B - A kind of Rice Anther specific expression promoter OsAnth1 - Google Patents
A kind of Rice Anther specific expression promoter OsAnth1 Download PDFInfo
- Publication number
- CN104946649B CN104946649B CN201510398912.3A CN201510398912A CN104946649B CN 104946649 B CN104946649 B CN 104946649B CN 201510398912 A CN201510398912 A CN 201510398912A CN 104946649 B CN104946649 B CN 104946649B
- Authority
- CN
- China
- Prior art keywords
- promoter
- osanth1
- plant
- rice
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention provides a kind of anther specific expression promoter OsAnth1 and its application.The present invention is separated to a promoter that can be specific expressed in plant anther.Described promoter can instruct target gene specificity overexpression in plant anther, and low expression or not expressed in other tissues of plant.Present invention also offers the expression cassette containing the promoter, plant expression vector, and utilize the method for the corresponding Host Strains of promoter acquisition and transformant.In addition, the present invention is applied in plant genetic engineering.The promoter has important theory and practical significance for the related research of Rice Anther.The present invention is in agriculture field by with wide application and market prospects.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to a kind of paddy rice
Anther specific expression promoter OsAnth1 and its application, the promoter can drive target in Transgenic Rice adjustment and control system
Gene specifically expressing in Rice Anther.
Background technology
Exogenous DNA array, so as to start the expression in plant host, starts subclass by being connected to specific promoter
The selection of type determines expression time and the position of gene.Plant gene regulatory is mainly what is carried out on transcriptional level, by a variety of
Cis-acting elements and trans-acting factor it is mutually coordinated.Promoter is important cis-acting elements, is to be located at structure base
Because of the 5 ' section of DNA sequence for holding the transcription of upstream region controlling gene, RNA polymerase can be activated, is allowed to tie exactly with template DNA
Close, it is ensured that transcription is accurately and effectively originated, and is played a crucial role in transcriptional control.Drive the difference of gene expression special according to it
Point, promoter is divided into constitutive promoter and specificity promoter.Constitutive promoter can in all cell or tissues, regardless of
Time and spatially startup transcription.
At present in wide variety of mainly some constitutive promoters of agricultural biological technical field, such as CaMV35S is opened
Mover and corn Ubiquitin-1 promoters, however using these promoters induction target gene rice transformation etc. crop with
During the quality of phase Crop Improvement, often due to the time (stage of development specificity) of destination gene expression or space (organizer
Official's specificity) it can not well control and cause improved effect unobvious, or due to these constitutive promoter induced genes
Expression quantity is too high and growing for plant is impacted, and these are all currently with composing type strong promoter binding function base
Because carrying out the obstacle run into during crop improvement quality.
Specificity promoter can be concentrated in specific condition, position or period and expressed.Specificity promoter can divide again
For tissue-specific promoter and inducible promoter, wherein inducible promoter does not start transcription or transcriptional activity usually very
It is low, but under the stimulation of some specific adverse circumstance signals, transcriptional activity can be significantly increased.
With transgenic crop being widely applied in the whole world, importance of the promoter in transgenosis is obtained widely
Common recognition.Rice Anther is the organ that rice male gamete pollen is produced, close with the yield of development, breeding and paddy rice of Rice Panicle etc.
Cut is closed.Therefore in the research field of rice tissue specific promoter, anther specific promoter is that people pay close attention to the most
One of promoter.
But the genetic resources for the anther specific promoter that people are had found not is very abundant at present, limits people
Lifting to flower pesticide character improvement ability.
Therefore, the present invention wishes to be separated to a kind of specific expressed promoter of Rice Anther, for driving in flower pesticide
In some specific expressed functional genes or structural gene, reach the purpose of breed improvement.
The content of the invention
In view of the above-mentioned problems, it is an object of the invention to provide one kind driving foreign gene in Rice Anther it is specific expressed
Promoter, obtain the application containing the transformant of the promoter sequence and the promoter.
Specifically, the present invention provides a kind of anther-specific strongly expressed promoter, and the Rice Anther strongly expressed starts
Attached bag contains：
1) SEQ ID NO:DNA molecular shown in 1；Or
2) under strict conditions with SEQID NO:DNA sequence dna hybridization in 1 and the DNA molecular with promoter function；Or
Person
3) with 1) or 2) defined in DNA sequence dna have more than 90% homology, and the DNA with promoter function
Molecule.
Preferably, the Rice Anther high specificity that the present invention is provided expresses promoter by SEQ ID No:Sequence shown in 1
Constitute.
SEQ ID No in sequence table:DNA sequence dna shown in 1 is from Nipponbare paddy rice (Oryza sativa L
Cv.Nipponbare anther-specific strongly expressed promoter), referred to herein as OsAnth1 or promoter OsAnth1.Specifically
For, inventors herein have recognized that Nipponbare paddy rice (Oryza sativa L cv.Nipponbare) upstream region of gene includes turning
The DNA sequence dna of 1753bp including record initiation site, with function specific expressed in driving target gene Rice Anther, and
And separation is cloned and identifies the function of the DNA sequence dna.
On the other hand, the Rice Anther high specificity expression that the present invention is also provided described in one group of amplification claim 1 or 2 is opened
The primer pair of the whole of mover or its any fragment, it is characterised in that the primer pair includes forward primer and reverse primer, institute
State the nucleotide sequence such as SEQ ID NO of forward primer：Described in 2, the nucleotide sequence such as SEQ ID NO of the reverse primer：3
It is shown.
On the other hand, the present invention also provides the weight that promoter is expressed containing Rice Anther high specificity described in claim 1
Group carrier or expression cassette, in the recombinant vector or expression cassette, the Rice Anther high specificity expression described in claim 1 is opened
Mover is connected to the upstream of gene to be expressed, and the gene to be expressed is included with the gene for changing Rice Anther character ability.
Another aspect, the present invention also provides a kind of recombinant expression carrier, and the recombinant expression carrier includes above-mentioned paddy rice
Anther-specific strongly expressed promoter, in the recombinant expression carrier, the Rice Anther high specificity expression promoter connects
It is connected to the upstream of gene order to be expressed.In one implementation, the gene to be expressed is Gus genes.The restructuring
Expression vector is by SEQ ID No:Sequence shown in 1 is that OsAnth1 or promoter OsAnth1 are implemented in pCAMBIA1391
Obtained recombinant expression carrier, referred to herein as pCAMBIA1391-OsAnth1.Or gene to be expressed can be any to water
Rice flower pesticide has the gene for improving function.
On the other hand, the present invention also provides a kind of method that Host Strains are obtained using the promoter.The Host Strains are will
Above-mentioned Rice Anther high specificity expression promoter, above-mentioned expression cassette or the above-mentioned recombinant expression carrier that the present invention is provided are transferred to
Agrobacterium tumefaciems and obtain.
On the other hand, the present invention provides a kind of method that transformant is obtained using the promoter.The transformant is that incite somebody to action this
Above-mentioned Rice Anther high specificity expression promoter, above-mentioned expression cassette, above-mentioned recombinant expression carrier or above-mentioned place that invention is provided
Main bacterium is transferred to transgenic cell line, callus or plant and obtained.
Another further aspect, the present invention provides above-mentioned Rice Anther high specificity expression promoter in genetically modified plants are cultivated
Using.The application include providing the present invention above-mentioned Rice Anther high specificity expression promoter is connected to carrier treats table
The gene order upstream (for example, the promoter sequence is placed in before target gene) reached, so that recombinant expression carrier is built,
The recombinant expression carrier is transformed into plant cell, tissue or organ and cultivated.
And preferably, the application can be used for the flower pesticide growth characteristics of improving plant growth characteristic, especially paddy rice.
The plant is monocotyledon, such as paddy rice, wheat, corn, barley, jowar or oat, preferably paddy rice.
It should be noted that in promoter sequence provided by the present invention, sequence beginning
" AAAATCCACCCATTGCCTCCAG " is the retention sequence of the forward primer used during acquisition promoter, altogether 22bp；
The sequence " TCCTCCTCCGTCGTTCGCGTGC " at sequence end is the retention of the reverse primer used during acquisition promoter
Sequence (the retention sequence and the corresponding sequence of reverse primer complementary), altogether 22bp；Remaining part is then to obtain in the DNA sequence dna
DNA sequence dna from Nipponbare paddy rice.It is emphasized that promoter mentioned herein can both refer to above-mentioned whole DNA
Sequence, can also refer to the DNA sequence dna removed after above-mentioned primer retention sequence.Even if it should be noted that those skilled in the art
On the basis of the present invention, similar sequence is obtained using other primers, it is also fallen within protection scope of the present invention.
In summary, the inventors found that, extract and identify Nipponbare paddy rice (Oryza sativa L
Cv.Nipponbare) 1753bp of the OsAnth1 upstream region of gene including transcription initiation site DNA sequence dna, and being named
For promoter OsAnth1.The sequence is connected to after digestion on plant binary expression vector pCAMBIA1391, obtains corresponding
Recombinant plasmid (i.e. recombinant expression carrier), using recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then use agriculture bar
The method of bacterium mediation carries out the conversion of paddy rice, obtains transgenic rice plant.Gus systematisms are carried out to the transgenic paddy rice of acquisition
Learn dyeing detection and find that the flower pesticide position Gus genes of transfer-gen plant are significantly expressed, and are not had in such as root, stem and leaf of other positions
There is obvious GUS activity, so as to prove the activity that there is the sequence of the 1753bp driving gene to be expressed in flower pesticide site specific.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.
Also, the promoter sequence can be connected with required target gene, build recombinant plant expression vector, it is inverted after, in water
The expression of the driving target gene of the flower pesticide site specific of rice, increases the effect of transgenosis, it is to avoid express band in unnecessary position
The matter energy come is wasted, effectively the characteristic of improvement paddy rice.
Technique effect
The rice starter OsAnth1 that the present invention is cloned being capable of controlling gene specific concentration table in Rice Anther
Reach, in actual applications with notable value.Carrying out genetic modification to variety of crops by the promoter improves plant anther
Growth characteristics, such as by the promoter drive target gene expressed in plant, for example, during anther development can be strengthened
To the resistance of environment, such as cold resistance, heat resistance etc., so as to cultivate preferable genetically modified plants kind.
Brief description of the drawings
Hereinafter, embodiment of the present invention is described in detail with reference to accompanying drawing, wherein：
Fig. 1 is that OsAnth1 promoters are implemented in A in schematic diagram in pCAMBIA1391 vector plasmids, wherein Fig. 1 to be
B is pCAMBIA1391-OsAnth1 schematic diagrames in pCAMBIA1391 schematic diagrames, Fig. 1, illustrated therein is and is started using OsAnth1
The Gus gene expressions of son driving downstream；
Fig. 2 is the result schematic diagram that digestion verification is carried out to promoter of the present invention；
Fig. 3 is the OsAnth1 of 12 weeks seedling ages::GUS transfer-gen plant tissue stainings figure (scale=5mm).
Embodiment
Illustrate the present invention referring to specific embodiment.It will be appreciated by those skilled in the art that these embodiments are only
For illustrating the present invention, it does not limit the scope of the present invention in any way.
Experimental method in following embodiments, is conventional method unless otherwise specified.Medicine used in following embodiments
Material raw material, reagent material etc., unless otherwise specified, are commercially available products.
The acquisition of OsAnth1 promoters containing restriction enzyme site
Step 1, the design of primer
According to rice varieties Nipponbare (the Oryza sativa L cv.Nipponbare) full-length genome provided in NCBI
Sequence, according to the sequences Design amplimer of rice Os Anth1 genes, and according to the characteristics of the carrier and target gene of selection,
Design the restriction enzyme site of primer.
CAMBIA (is come from, open to use carrier, peace with paddy rice binary expression vector pCAMBIA1391 in the present embodiment
Genetically modified organism product composition supervision and inspection center of the emblem Ministry of Agriculture of Shanxi Academy of Agricultural Sciences paddy rice group is preserved) exemplified by, target base
Because Gus genes, the primer of specific design is：Forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site
(AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band EcoRI, restriction enzyme site (GAATTC), primer sequence is as follows：
Forward primer：AAGCTTAAAATCCACCCATTGCCTCCAG HindIII
Reverse primer：GAATTCGCACGCGAACGACGGAGGAGGA EcoRI
By Shenzhen, Huada gene company is synthesized.
The acquisition of step 2, promoter OsAnth1
Using rice varieties Nipponbare DNA as template, promoter OsAnth1 is expanded using forward primer, reverse primer, by normal
PCR system is advised, using following amplification program：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extensions
2min30s, is circulated 35 times；Last 72 DEG C of extensions 10min.
The purpose fragment of PCR amplifications is reclaimed, purpose fragment length 1753bp is connected to the (purchase of PGEM-T-Easy carriers
From Promega companies, mixed in the ratio in carrier specification) on, convert Escherichia coli XL-Blue competence according to cold shock method
After cell, competent cell is activated, and then purpose fragment is transferred to the competent cell of activation, then, sieved through bacterium colony PCR
Choosing obtains positive colony, and picking monoclonal bacterium solution upgrading grain carries out double digestion checking, as shown in Figure 2 with HindIII and EcoRI.
Positive colony by identification is sent and the sequencing of Invitrogen companies.The correct clone of checking is the promoter to be obtained
OsAnth1, its nucleotide sequence such as SEQ ID No:Shown in 1.
The structure of plant expression vector and the conversion of Agrobacterium
Extract plasmid in the positive colony obtained from above during " promoter OsAnth1 acquisition ", with HindIII and
EcoRI digestions, reclaim promoter OsAnth1 fragments.PCAMBIA1391 is linearized using HindIII and EcoRI simultaneously
Processing, recovery pCAMBIA1391, above-mentioned OsAnth1 fragments and pCAMBIA1391 fragments (are purchased from T4 ligases
TaKaRa companies) it is attached, obtain promoter OsAnth1 and Gus Gene Fusions plant expression vector pCAMBIA1391-
OsAnth1, Agrobacterium tumefaciems (Agrobacterium tumefaciens) is transferred to using freeze-thaw method by plant expression vector
EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved).
Expressed using promoter OsAnth1 driving Gus reporter genes in paddy rice
Step 1：Agriculture bacillus mediated rice transformation
Mature seed removes after glume, with 70% alcohol-pickled seed 1min, outwells alcohol.Drip Tween20's with containing 1
50% sodium hypochlorite (stoste effective chlorine density is more than 4%) solution immersion seed 40min (150r/min).Outwell sodium hypochlorite,
Sterile washing 3-6 is clarified all over to solution, no sodium hypochlorite taste.Sterilized water immersion seed is stayed overnight.Paste with scalpel along seed
Bisque peels embryo, and embryo is inoculated on calli induction media.At 30 DEG C light culture after 10-12 days by callus and endosperm and embryo
Bud is separated, and is used for Agrobacterium after the primary callus in good condition, that division is vigorous for removing bud is carried out into preculture 3~5 days
Conversion.
Using it is above-mentioned " plant expression vector structure and Agrobacterium conversion " during be transferred to recombinant expression carrier
Agrobacterium tumefaciems carries out Agrobacterium-mediated genetic transformation, obtains OsAnth1::Gus transgenic rice plants, the genetic transformation,
Transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et
al.An efficient and high-throughput protocol for Agrobacterium mediated
transformation based on phOsphomannOse isomerase pOsitive selection in
Japonica rice(Oryza sativa L.)[J].Plant Cell Report,2012.DOI10.1007/s00299-
The method of proposition such as 01201275-3.).
The histoorgan dyeing of step 2, transgenic paddy rice seedling
The histoorgan of the transgenic paddy rice of OsAnth1 promoters, i.e. root, stem, leaf, floral organ will have been converted to carry out respectively
GUS is dyed：Each tissue is dipped in GUS dyeing liquors respectively, 37 DEG C, 24 hours overnight, 75% ethanol decolorization, by the leaf in tissue
Green element is taken off.Then the result of GUS dyeing is observed and recorded under disecting microscope.As a result as shown in figure 3, gus gene only exists
There is strongly expressed in the flower pesticide of transgenic paddy rice children's fringe, show the very strong blueness that naked eyes can be observed substantially；And other each
In organ (root, stem and blade), the expression of gus gene is not detected substantially.This shows that promoter of the invention can turn
Gus protein downstream is instructed to express in the flower pesticide of gene plant, this expression has anther tissue expression specificity.
Although the present invention is described by taking paddy rice as an example, it is applicant's understanding that the present invention obtains the application of promoter
Scene is not limited to paddy rice, and promoter of the present invention can be used for various monocotyledons, such as paddy rice, wheat, corn, barley, height
Beam or oat, preferably paddy rice.
Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this
Invention is variously modified or deformed, and without departing from the spirit of the present invention, all should belong to the model of appended claims of the present invention
Enclose.
Claims (8)
1. a kind of Rice Anther high specificity expression promoter OsAnth1, it is characterised in that the Rice Anther high specificity table
Up to promoter by SEQ ID NO:DNA molecular shown in 1 is constituted.
2. Rice Anther specific expression promoter OsAnth1 as claimed in claim 1, it is characterised in that the Rice Anther
Specific expression promoter OsAnth1 is separated from paddy rice platymiscium and obtained.
3. the whole of the Rice Anther high specificity expression promoter OsAnth1 described in one group of amplification claim 1 or 2 or its
The primer pair for fragment of anticipating, it is characterised in that the primer pair includes forward primer and reverse primer, the nucleosides of the forward primer
Acid sequence such as SEQ ID NO：Described in 2, the nucleotide sequence such as SEQ ID NO of the reverse primer：Shown in 3.
4. the recombinant vector or expression cassette of promoter are expressed containing Rice Anther high specificity described in claim 1, described heavy
In group carrier or expression cassette, the Rice Anther specific expression promoter OsAnth1 described in claim 1 is connected to gene to be expressed
Upstream, the gene to be expressed include with change Rice Anther character ability gene.
5. the Rice Anther specific expression promoter OsAnth1 described in a kind of utilization claim 1 obtains corresponding transformant
Method, it is characterised in that methods described includes Rice Anther high specificity expression promoter being transferred in the first strain, profit
Plant expression is built with the first strain and plant vector for being transferred to the Rice Anther specific expression promoter OsAnth1 to carry
Body, then the plant expression vector is transferred in recipient bacterium, and obtain transgenic plant cells, tissue using the recipient bacterium
Or plant.
6. a kind of Rice Anther specific expression promoter OsAnth1 according to claim 1 is in genetically modified plants are cultivated
Application, it is characterised in that the application includes：By the special table of Rice Anther according to any one in claim 1
The promoter OsAnth1 reached is connected to gene order upstream to be expressed in carrier, so as to build recombinant expression carrier；Will be described
Recombinant expression carrier is transformed into plant cell, tissue or organ and cultivated.
7. application according to claim 6, it is characterised in that the application is used for improving plant growth characteristic, the plant
Thing is paddy rice.
8. application according to claim 7, it is characterised in that the application is used for the growth characteristics for improveing plant anther.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510398912.3A CN104946649B (en) | 2015-07-07 | 2015-07-07 | A kind of Rice Anther specific expression promoter OsAnth1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510398912.3A CN104946649B (en) | 2015-07-07 | 2015-07-07 | A kind of Rice Anther specific expression promoter OsAnth1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104946649A CN104946649A (en) | 2015-09-30 |
| CN104946649B true CN104946649B (en) | 2017-10-20 |
Family
ID=54161713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510398912.3A Active CN104946649B (en) | 2015-07-07 | 2015-07-07 | A kind of Rice Anther specific expression promoter OsAnth1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104946649B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671049B (en) * | 2016-03-17 | 2020-03-27 | 安徽省农业科学院水稻研究所 | Rice anther specific expression promoter OsAnth3 and application thereof |
| CN105602956B (en) * | 2016-03-25 | 2019-10-11 | 安徽省农业科学院水稻研究所 | A kind of paddy pollen strongly expressed promoter OsPoll4 and its application |
| CN105602955B (en) * | 2016-03-25 | 2020-04-21 | 安徽省农业科学院水稻研究所 | Rice stamen specific expression promoter OsAnth2 and application thereof |
| CN105647925B (en) * | 2016-03-25 | 2020-03-27 | 安徽省农业科学院水稻研究所 | Rice anther strong expression promoter OsAnth4 and application thereof |
| CN106480026B (en) * | 2016-09-29 | 2019-01-29 | 北京大学 | A kind of anther early development specific expressing promoter and its application |
| CN108070595B (en) * | 2018-01-25 | 2020-03-31 | 中国农业科学院生物技术研究所 | Rice anther specific expression promoter POsFT1 and application thereof |
| CN116676306B (en) * | 2023-04-04 | 2024-01-30 | 安徽省农业科学院水稻研究所 | Crop anther specific expression promoter SDGMS S1 and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102465128B (en) * | 2010-11-12 | 2015-02-18 | 中国科学院上海生命科学研究院 | Anther specific expression promoter and application thereof |
| CN103834653B (en) * | 2012-11-22 | 2016-02-24 | 中国农业大学 | Rice Cold evoked promoter p-LTT1 and application thereof |
| CN103146747A (en) * | 2013-02-22 | 2013-06-12 | 上海大学 | Specific expression vector for anther and construction method thereof |
| CN103725677B (en) * | 2013-11-18 | 2016-06-08 | 北京大北农科技集团股份有限公司 | Tissue-specific promoter and purposes thereof |
| CN104711262B (en) * | 2015-04-13 | 2017-06-23 | 安徽农业大学 | Maize Anther specificity promoter and its application |
-
2015
- 2015-07-07 CN CN201510398912.3A patent/CN104946649B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104946649A (en) | 2015-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946649B (en) | A kind of Rice Anther specific expression promoter OsAnth1 | |
| CN105695466B (en) | A kind of strong specific expression promoter OsPoll3 of paddy pollen and its application | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN105671049B (en) | Rice anther specific expression promoter OsAnth3 and application thereof | |
| CN105063047B (en) | Vegetable seeds specific expression promoter OsSee1 | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN103740719B (en) | The separation of Rice Vascular Bundle specific expression promoter POsvas 1 and application | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN104087588B (en) | The rice drought-inducible promoter POsDro4 of response environment water stress | |
| CN103540592A (en) | Rice endosperm specific expression promoter as well as application thereof | |
| CN104046629B (en) | A kind of plant salt abduction delivering promotor POsSalt1 and application thereof | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN105861506B (en) | A kind of paddy endosperm does not express promoter SAFES2 and its separation method and application | |
| CN105087589B (en) | A kind of promoter element OsEmb2 and the methods and applications that transgenic paddy rice is cultivated using it | |
| CN103710344B (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
| CN103773766B (en) | A kind of rice root specific expressing promoter POsRo1 and application thereof | |
| CN103031303B (en) | Identification and applications of plant pulvinus specific expression promoter ProCol1 | |
| CN104946652B (en) | Plant gynoecium specific expression promoter OsPis1 and its derivative | |
| CN105087591B (en) | Paddy rice root tip specific expression promoter POsRo3 | |
| CN105567694A (en) | High-expression-activity rice non-seed expression promoter SAFES4 and application thereof | |
| CN106047878B (en) | Rice root specific expression promoter POsr1 and application thereof | |
| CN104845974B (en) | The DNA fragmentation POscold5 of long-term cold stress can be responded | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
| CN104087587A (en) | Plant drought stress induction expression promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |