CN112646813B

CN112646813B - Isolated nucleic acid molecules and uses thereof

Info

Publication number: CN112646813B
Application number: CN202011545673.7A
Authority: CN
Inventors: 唐克轩; 姚行浩; 刘品
Original assignee: Suzhou Tangji Biological Technology Co ltd; Shanghai Jiaotong University
Current assignee: Suzhou Tangji Biological Technology Co ltd; Shanghai Jiaotong University
Priority date: 2020-12-24
Filing date: 2020-12-24
Publication date: 2022-11-18
Anticipated expiration: 2040-12-24
Also published as: CN112646813A

Abstract

The invention discloses an isolated nucleic acid molecule and application thereof. The invention discloses application of a nucleic acid molecule in improving the yield of artemisinin in plants, wherein the nucleic acid molecule comprises a nucleic acid sequence shown as SEQ ID No. 1.

Description

Isolated nucleic acid molecules and uses thereof

Technical Field

The invention relates to the technical field of biology, in particular to a nucleic acid molecule and application thereof.

Background

Artemisia annua L is an herb of Artemisia of the family Compositae of the class Dicotyledoneae. The artemisia annua plant has strong volatile aroma, and contains a plurality of secondary metabolites: artemisinin, volatile oil, alpha-pinene, camphor, artemisone, and other components, and flavonoids. Artemisia annua is still the only natural source of artemisinin but the content is relatively low, which greatly limits the large-scale commercial production of this drug. Numerous studies suggest that glandular hairs are the major site of artemisinin synthesis. As with the classification of glandular hairs in nature, glandular hairs in Artemisia annua can also be classified into 2 types, namely secretory glandular hairs (GST) and non-secretory glandular hairs (TST). They all originate from epidermal cells. The two glandular hairs play a vital role in the growth, development, defense and pollen transmission of plants.

The three-dimensional regulation of temporal, spatial and quantitative higher plant genes has become a hotspot and introduction in the field of molecular biology research. Promoters are important elements for the regulation of gene expression, and are a component of genes (genes) and control the initiation time and degree of expression of genes (transcription). Promoters (Promoters), like "switches", determine the activity of a gene and exert their specific functions through the interaction of cis-acting elements and trans-acting factors. Promoters can be classified into three categories according to their transcription patterns: constitutive promoters, tissue or organ specific promoters and inducible promoters. In the current genetic engineering research of dicotyledons and even sweet wormwood, constitutive promoters are mostly adopted. For example, the cauliflower mosaic virus 35S promoter (CaMV 35S) has no obvious difference in gene expression of different tissues, organs and developmental stages under the control of the promoter. However, constitutive promoters are defective in application, for example, exogenous genes produce large amounts of proteins and secondary metabolites in plants, which break the original balance of plants, and some substances are toxic and prevent normal growth of plants and even cause death of plants. Therefore, it is necessary to design a more efficient tissue and organ specific promoter to replace a constitutive promoter so as to better regulate the three-dimensional expression of plant genes.

Therefore, those skilled in the art have endeavored to develop a specific promoter that ameliorates the adverse effects of conventional constitutive promoters on plant growth.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the technical problem to be solved by the present invention is how to improve the adverse effect of conventional constitutive promoters on plant growth.

To achieve the above object, the present application provides an isolated nucleic acid molecule characterized by comprising the nucleic acid sequence shown as SEQ ID NO. 1.

In certain embodiments, the nucleic acid molecule further comprises a nucleic acid sequence as set forth in SEQ ID No.2, said nucleic acid sequence as set forth in SEQ ID No.2 being located 5' of said nucleic acid sequence as set forth in SEQ ID No. 1.

In certain embodiments, the nucleic acid molecule comprises the nucleic acid sequence set forth as SEQ ID No. 3.

In certain embodiments, the nucleic acid molecule is a plant glandular hair-specific promoter capable of promoting gene expression selectively in a plant glandular hair.

In certain embodiments, the plant comprises artemisia annua, nicotiana benthamiana, and/or tomato.

In certain embodiments, the glandular hair is a secretory glandular hair.

In another aspect, the present application also provides a vector, wherein the vector comprises a nucleic acid molecule as described herein.

In certain embodiments, the vector is pCAMBIA-1391z.

In another aspect, the present application also provides a host cell, wherein the host cell comprises a nucleic acid molecule as described herein.

In certain embodiments, the host cell comprises a vector described herein.

In certain embodiments, the host cell is agrobacterium GV3101.

In another aspect, the present application also provides the use of a nucleic acid molecule as described herein, a vector as described herein, a host cell as described herein for increasing artemisinin production in a plant.

In certain embodiments, the plant comprises artemisia annua.

In the prior art, metabolic disturbance in a plant body is caused due to various defects of a constitutive promoter, so that the normal growth of the plant is influenced; in the application, the effective artemisia annua epidermal glandular hair tissue specific promoter is used for replacing a constitutive promoter to carry out transient transformation on leaves of plants (such as artemisia annua, nicotiana benthamiana and tomato) containing glandular hairs, and GUS reporter genes show that the promoters can be efficiently expressed in the glandular hairs of the leaves, so that the promoter can be widely applied to gene engineering breeding for expressing and producing metabolites by using the plant glandular hair tissue.

The conception, the specific structure and the technical effects of the present invention will be further described with reference to the accompanying drawings to fully understand the objects, the features and the effects of the present invention.

Drawings

FIG. 1 shows the sequence of the AaPro270 promoter of the present application.

FIG. 2 shows a staining pattern of GUS tissue of Artemisia annua leaves obtained after Agrobacterium tumefaciens-mediated transient transformation of Artemisia annua leaves by using a vector pCAMBIA1391z-AaPro270 obtained by fusing an glandular hair specific promoter AaPro270 with GUS gene in the present application.

FIG. 3 shows a GUS tissue staining pattern of Nicotiana benthamiana leaves obtained after Agrobacterium tumefaciens-mediated transient transformation of Nicotiana benthamiana leaves using a vector pCAMBIA1391z-AaPro270 obtained by fusing a glandular hair-specific promoter AaPro270 with a GUS gene in the present application.

FIG. 4 shows GUS tissue staining patterns of tomato leaves obtained after Agrobacterium-mediated transient transformation of tomato leaves with the vector pCAMBIA1391z-AaPro270 of the present application, which uses the glandular hair-specific promoter AaPro270 fused with GUS gene.

FIG. 5 is a statistical chart showing the results of the modified enhanced secretory glandular hair specific promoter pGreenII0800-LUC-AaPro270 expression activity and the basic promoter pGreenII0800-LUC-Origin activity using the Promega dual-luciferase reporter gene assay kit E1910.

Detailed Description

In the present application, the term "isolated" generally refers to a product obtained from a natural state by artificial means. If an "isolated" substance or component occurs in nature, it may be altered from its natural environment, or it may be isolated from its natural environment, or both. For example, a polynucleotide or polypeptide that is not isolated is naturally present in a living plant or animal, and the same polynucleotide or polypeptide isolated from such natural state in high purity is said to be isolated. The term "isolated" does not exclude the presence of artificially synthesized material, nor does it exclude the presence of other impurities which do not affect the activity of the material.

The present invention will now be further described with reference to the following examples, which are intended to be illustrative only, and the invention may be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein.

Experimental procedures without specific conditions noted in the examples below, generally following conventional conditions, such as molecular cloning by Sambrook et al: conditions described in the laboratory Manual (New York: cold spring harbor laboratory Press,1989 edition), or according to the conditions recommended by the manufacturers of the relevant materials reagents.

The agrobacterium involved in the present application is agrobacterium tumefaciens strain GV3101, which has been described in the literature "csaba koncz, jeff Schell; the promoter of TL-DNA gene 5controls The tissue-specific expression of Chinese genes carried by a novel type of Agrobacterium binary vector, mol Gen Genet,1986, 204:383-396 ". Agrobacterium tumefaciens GV3101, pCAMBIA1391z, is commercially available from open market, such as the CAMBIA corporation, australia, under the strain number Gambar3.

Example 1 analysis of promoter sequence of glandular hair high-efficiency expression gene from Artemisia annua transcriptome and genome

1. Analysis of glandular hair specific promoter sequence: the sequencing data of the artemisia annua transcriptome is taken as a database, a gene which is efficiently expressed in glandular hairs is searched in the artemisia annua transcriptome, the gene number of the gene is taken as the basis to find the position of the gene in an artemisia annua genome library, an initiation codon ATG is taken as the basis, and the sequence length of 823bp at the front end of the gene is selected as the basic sequence (shown as SEQ ID NO. 1) of the target promoter.

2. In order to enable the promoter to better regulate the expression of related genes, artificial design and modification are carried out, an enzyme cutting site Bam HI (CGGGATCC) and a plurality of cis-acting elements (GACGTACAACACTATAAAAATTTATATGT shown as SEQ ID NO. 2) are added at the 5 'end of a basic sequence of the promoter, an enzyme cutting site NcoI (CCATGGC) is added at the 3' end, the designed and modified promoter sequence information is delivered to a company Limited in the biological engineering (Shanghai) to be synthesized, and the final length is 867bp.

The sequence of the AaPro270 promoter to be synthesized by Biometrics is shown in FIG. 1. The sense strand of the AaPro270 promoter sequence is shown as SEQ ID NO. 3.

Example 2 analysis of cis-acting elements of AaPro270 promoter to determine the type of AaPro270 promoter

To analyze the number and type of cis-acting elements on the AaPro270 promoter, the online analysis software plantare (http:// bioinformatics. Psb. Element. Be/webutols/plantare/html /) was used. The analysis shows that the cis-acting element on the AaPro270 promoter comprises: ABRE, LTR, MYC, TCT-motif, GT1-motif, CAAT-Box, G-Box, TATA-Box, etc.

The cis-acting elements in the promoter sequence are shown in Table 1:

TABLE 1 analysis of regulatory elements in the AaPro270 promoter sequence

Name of element	Sequence of	Position of	Function(s)
				ABRE	ACGTG/CGTTGCGCCG	+189/-376	Abscisic acid induction
LTR	CCGAAA	+306	Low temperature induction
				MYC	GTTTAC/CATTTG	-564/+827	Is unknown
TCT-Motif	CATTCT	-816	Light responsive element
				GT1-Motif	GGTTAA	+337	Light responsive element
AT1-Motif	TTATTTTTT ATTAT	-145	Light response module

For positions-376, -564, -145, +306, etc. in Table 1, see the corresponding positions in the sequence listing listed in example 1.

ABRE is responsive to abscisic acid in plants; LTR is induced by low temperature; GT1-Motif and TCT-Motif are plant light response elements; AT1-Motif belongs to the optical response module. The analysis of the results shows that the AaPro270 promoter is an inducible promoter at the same time and can be induced by various factors.

Example 3 construction of the resulting promoter into pCAMBIA-1391z vector

In order to study the expression of the promoter in different tissue parts of plants, the AaPro270 promoter is connected to pCAMBIA-1391z vector (purchased from CAMBIA, australia and numbered as Gambar 1) to fuse GUS reporter genes, and in order to construct expression vector pCAMBIA1391z-AaPro270, a Bam HI enzyme cutting site and a NcoI enzyme cutting site are introduced when synthesizing the promoter sequence.

Example 4 transformation of Agrobacterium tumefaciens with pCAMBIA1391z-AaPro270 vector

The constructed plant expression vector is transferred into agrobacterium tumefaciens (GV 3101), primers are designed from pCAMBIA1391z vector and PCR verification is carried out, and PCR detection primers are shown in the following table 2. The results show that: the plant binary expression vector containing the AaPro270 promoter fragment is successfully constructed into the Agrobacterium tumefaciens strain, so that the Agrobacterium tumefaciens strain containing the plant expression vector pCAMBIA1391z-AaPro270 fused by the AaPro270 promoter and GUS gene is obtained.

TABLE 2 PCR detection primers

EXAMPLE 5 Agrobacterium tumefaciens-transformed plant containing pCAMBIA1391z-AaPro270 vector and determination of GUS reporter Gene expression site in plant

1. Plant cultivation (Artemisia annua/Ben's tobacco/tomato)

(1) And (3) artemisia annua: collecting top branches of the growing robust plants as cutting slips, and cutting the branches to 10-15 cm in length with bud eyes and leaves. Cutting the lower end into wedge shape during cutting, removing leaves at the base part, leaving 2-3 leaves at the top part, and performing cutting planting in a plug tray, wherein the cutting depth is about 5-8 cm, namely about half of the length of the cutting. When the plant grows for 1-2 months, agrobacterium is injected to the leaves for instantaneous infection.

(2) B, ben shi tobacco: the Nicotiana benthamiana seeds are sown in soil, and covered with a film. Approximately one week later, the film was removed and watered once every five days. After one month, the leaves were injected with agrobacterium for transient infection.

(3) Tomato: the tomato seeds purchased from the market are soaked in TSP solution for 1h, then sowed in soil, and covered with a film. The film was removed after one week. After the 4 th true leaf of the plant grows out, injecting agrobacterium tumefaciens to instantly infect the leaf.

2. Agrobacterium infected plant leaf and leaf culture

Detecting the positive agrobacterium tumefaciens GV3101 by bacteria liquid for overnight shake activation. After activation, the cells were transferred to LB (containing rifampicin and kanamycin) medium containing 10mM MES (pH 5.6) and 40. Mu.M AS (acetosyringone) at the final concentration, and then activated again for 24 hours in a shaker (28 ℃,200 rpm). Centrifuging at 4000rpm for 10min, collecting thallus, and adding 10mM MgCl ₂ Adjusting to OD600 ≈ 0.8, adding AS with final concentration of 200 μ M, standing for 3h, and performing plant leaf injection. The injected plants were cultivated in a dark room for 24h and then transferred to light for 48h.

3. GUS tissue staining observation of plant leaves

Cutting off the plant leaves injected with the target plasmid agrobacterium tumefaciens, and adding a commercialized GUS staining working solution to completely cover the material; wrapping with tin foil paper, and standing at room temperature overnight. The next day is 25%,50%,70%,95% ethanol gradient elution, shaking table gently for 20 minutes each time. The decolorized leaves were observed under an optical microscope to determine the position where the promoter drives GUS gene expression.

The results of GUS tissue staining are shown in FIGS. 2, 3 and 4, and the results show that the stained parts are specifically expressed in secretory glandular hairs of Artemisia annua, nicotiana benthamiana and tomato, which indicates that the AaPro270 promoter can guide the specific expression of exogenous genes in the glandular hairs of the three plants, so that the AaPro270 promoter designed by the invention can be used for gene engineering breeding and industrialization for expressing and producing metabolites by utilizing the glandular hairs of the plants.

Example 6 detection of Activity of artificially designed enhanced glandular-Hair-specific promoter

(1) A basic sequence of 823bp In front of the ATG start codon of the gene and an artificially designed AaPro270 promoter are used for constructing a Plant Fusion expression vector pGreenII-0800-LUC by using an In-Fusion technology (see the literature, "Transmission expression vectors for functional genes, quality of promoter activity and RNA cloning In plants, plant Methods,2005,1 13"), and a control vector pGreenII-0800-LUC-Origin and an experimental vector pGreenII-0800-LUC-AaPro270 are obtained. mu.L of each of the above plasmids was taken and transformed into Agrobacterium GV3101 competent cells, respectively. And (3) transforming agrobacterium by a freeze-thawing method to obtain the agrobacterium engineering strain.

(2) The Agrobacterium containing the plant expression vector was inoculated into LB medium containing rifampicin at 20. Mu.L/mL, kanamycin at 50. Mu.L/mL and MES at 10mM (pH 5.6) in a volume ratio of 1. Then centrifuged at 3000rpm/min for 10 minutes at room temperature, the supernatant was discarded, and 10mM MgCl was used ₂ The solution re-suspends the thallus, adjusts the OD600 of the bacteria liquid to be approximately equal to 0.8, adds acetosyringone with the final concentration of 200 mu M, and stands for 3 hours at room temperature. The above-described bacterial fluid was injected into leaves of Nicotiana benthamiana (Nicotiana benthamiana) grown for about 4 weeks by using a syringe. The tobacco after injection was cultured in the dark for 16-24 hours and then transferred to the light for 1-2 days.

(3) Tobacco leaves infected with agrobacterium were taken with a 1cm diameter punch, and 6 samples were taken for each infected leaf. Placing into a 1.5mL centrifuge tube containing 2 steel balls with diameter of 2mm, cooling in liquid nitrogen, and grinding into powder with a tissue grinder. Stored at-80 ℃.

(4) The relative expression activity of the promoters of the control group and the experimental group is obtained by adopting a dual-luciferase reporter gene detection kit E1910 of Promega company and detecting the activities of firefly luciferase and Renilla luciferase according to the method of the instruction. The detection result of the relative expression activity of the promoter is shown in figure 5, and the result shows that the expression activity of the modified enhanced secretory glandular hair specific promoter pGreenII0800-LUC-AaPro270 is stronger than that of the pGreenII0800-LUC-Origin basic promoter.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concept. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Sequence listing

<110> Shanghai university of traffic

SUZHOU TANGJI BIOLOGICAL TECHNOLOGY Co.,Ltd.

<120> isolated nucleic acid molecules and uses thereof

<130> CN084-20008PICN

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 823

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> promoter base sequence

<400> 1

gattcttttg tttatatagc aaagtttatt tacaaaaaat ttaacaaata cctaacgatt 60

tacaccgcta gaaacgcgtc ctcattacaa caaaaaataa aataaaataa aataaaataa 120

aaaataataa aaaatctaat attaatatac ttttaatata cgtgcgcttt ttaaaaaaaa 180

ttaaaagaat taaaatttag catatattac atatctagca atgttttaat aataaaatat 240

aaccgaacat gccataatat tacgaagaaa gggagcccga aactttaatc gaacaatgac 300

atatcgaggt taaaaagagt ttgccaaatt tggtgaaagc cccgccgcaa cgcggcgagc 360

tccttctact tgtatatttc tatagccaaa gatcttgtct tgtttattct agtttctcac 420

ctatgatgtt agcaaattaa atgaaaaatt aagttacttg gttttacatt ctagataaaa 480

atagtacaac atttactcaa acaattttca ccatatcaaa cttgacatat tcatcaaatg 540

gtgtgtttag ttcttttaga aggttcggtt tatgataaat atagcaaagt caatttccat 600

caaactcttt aaagatatag gtataaggta tgccatacca actataatct agaaatgccc 660

ttaaaataag aactaaatgg tattttagta attactacaa gaaactaaga ccttttatgt 720

atatgcacaa ttatataagt agcaaaacct tcccataatc ctttcatccc actccaaaag 780

aacaaagtaa gagtacacat ttgcaactta tatcaaacca aac 823

<210> 2

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> cis-acting element

<400> 2

gacgtacaac actataaaaa tttatatgt 29

<210> 3

<211> 852

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> AaPro270 promoter

<400> 3

gacgtacaac actataaaaa tttatatgtg attcttttgt ttatatagca aagtttattt 60

acaaaaaatt taacaaatac ctaacgattt acaccgctag aaacgcgtcc tcattacaac 120

aaaaaataaa ataaaataaa ataaaataaa aaataataaa aaatctaata ttaatatact 180

tttaatatac gtgcgctttt taaaaaaaat taaaagaatt aaaatttagc atatattaca 240

tatctagcaa tgttttaata ataaaatata accgaacatg ccataatatt acgaagaaag 300

ggagcccgaa actttaatcg aacaatgaca tatcgaggtt aaaaagagtt tgccaaattt 360

ggtgaaagcc ccgccgcaac gcggcgagct ccttctactt gtatatttct atagccaaag 420

atcttgtctt gtttattcta gtttctcacc tatgatgtta gcaaattaaa tgaaaaatta 480

agttacttgg ttttacattc tagataaaaa tagtacaaca tttactcaaa caattttcac 540

catatcaaac ttgacatatt catcaaatgg tgtgtttagt tcttttagaa ggttcggttt 600

atgataaata tagcaaagtc aatttccatc aaactcttta aagatatagg tataaggtat 660

gccataccaa ctataatcta gaaatgccct taaaataaga actaaatggt attttagtaa 720

ttactacaag aaactaagac cttttatgta tatgcacaat tatataagta gcaaaacctt 780

cccataatcc tttcatccca ctccaaaaga acaaagtaag agtacacatt tgcaacttat 840

atcaaaccaa ac 852

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Forward primer

<400> 4

aggctttaca ctttatgctt cc 22

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> reverse primer

<400> 5

gttggggttt ctacaggacg gac 23

Claims

1. An isolated nucleic acid molecule having the sequence shown in SEQ ID No. 1.

2. An isolated nucleic acid molecule consisting of the nucleic acid sequence shown as SEQ ID No.1 and the nucleic acid sequence shown as SEQ ID No.2, wherein the nucleic acid sequence shown as SEQ ID No.2 is located at the 5' end of the nucleic acid sequence shown as SEQ ID No. 1.

3. The nucleic acid molecule of claim 2, wherein the sequence of said nucleic acid molecule is set forth in SEQ ID No. 3.

4. A vector comprising the nucleic acid molecule of any one of claims 1-3.

5. The vector of claim 4, wherein said vector is pCAMBIA-1391z.

6. A host cell comprising the nucleic acid molecule of any one of claims 1-3, wherein the host cell is agrobacterium GV3101.

7. Use of the nucleic acid molecule of claims 1-3, the vector of claims 4-5, the host cell of claim 6 for increasing artemisinin production in plants.

8. The use of claim 7, wherein the plant comprises artemisia annua.