CN111235181B - Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof - Google Patents
Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof Download PDFInfo
- Publication number
- CN111235181B CN111235181B CN202010217689.9A CN202010217689A CN111235181B CN 111235181 B CN111235181 B CN 111235181B CN 202010217689 A CN202010217689 A CN 202010217689A CN 111235181 B CN111235181 B CN 111235181B
- Authority
- CN
- China
- Prior art keywords
- pds
- gene
- vector
- ptrv2
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8203—Virus mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and a construction method and application thereof, and relates to the technical field of plant gene editing; a stretch of sgRNA specifically targeting the PDS gene was inserted into the TRV2 vector. In T1 generation plants without the foreign gene of Cas9, the leaves still keep normal green due to no cutting of Cas 9; therefore, tomato plants which have genetic mutation at the T1 generation and do not contain Cas9 can be intuitively and efficiently separated according to the change of the leaf color. The method can efficiently screen the non-transgenic plants which are subjected to target gene editing in the T1 generation (the efficiency is more than 80 percent), saves time and labor, and has positive influence on basic research and a genome editing technology for crop improvement.
Description
Technical Field
The invention belongs to the technical field of gene editing, and particularly relates to a virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and a construction method and application thereof.
Background
CRISPR/Cas 9-mediated gene editing technology has been successfully and widely used in plants (Ma et al, 2016). At present, in most cases, the application of CRISPR/Cas9 requires stable integration of Cas9 endonuclease and guide rna (sgrna) genes into the plant host genome by means of genetic transformation (Yin et al, 2017). After the target gene editing is completed, exogenous gene fragments such as CRISPR/Cas9 and the like need to be removed to obtain a plant of Cas9-free, so as to ensure genetic stability and phenotypic stability and obtain any supervision and approval for commercial application. However, the removal of transgenes by genetic segregation, backcrossing and genotyping is very time consuming and laborious.
Among plants, Tobacco Rattle Virus (TRV) is a vector effective for Virus-induced gene silencing (VIGS), and has been widely used in functional genomics research of various plants, such as Tobacco, tomato, cotton, and the like. TRV has a bi-component genome consisting of two positive single-stranded RNAs, RNA1 and RNA2, respectively, and was engineered into pTRV1 and pTRV2, respectively, for application in VIGS. pTRV2 can carry and express foreign gene fragments for post-transcriptional gene silencing (DineshKumar et al, 2003). Compared with plant transgenic technologies such as gene knockout, transgenosis and mutant screening, the VIGS does not need to construct transgenic plants, has the advantages of short period, simplicity and convenience in operation, rapidness in phenotype acquisition, low cost and the like, is widely applied to research on related gene functions such as plant disease resistance, adversity stress, cell signal transduction and growth and development (Zhou and Huang, 2012; Kandoth et al, 2013; Pfleger et al, 2013) and plays an important role in the field of plant functional genomics. Phytoene Desaturase (PDS) is one of the key rate-limiting enzymes in the carotenoid synthesis pathway, often used as a reference gene to evaluate the success of VIGS (bennplaul et al, 2012). In plants with carotenoids as the major pigment, carotenoids have photoprotective effect, and if the PDS gene is successfully silenced, young leaves of the plant show albino symptoms, and the phenotype is obviously changed and is easy to observe and distinguish (Sun et al, 1998).
Disclosure of Invention
In view of the above, the present invention aims to provide a viral vector for efficiently screening a gene-edited crop without exogenous DNA, a construction method and an application thereof, which can efficiently screen a gene-edited plant selecting Cas 9-free.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a construction method of a virus vector for efficiently screening gene editing crops without exogenous DNA, which comprises the following steps: (1) carrying out synonymous mutation on 1 BsaI enzyme cutting site on the pTRV2 vector skeleton to obtain the vector skeleton without the function of the BsaI enzyme cutting site;
(2) inserting the specific targeting sgRNA into the vector framework without BsaI enzyme cutting site function to obtain a vector pTRV 2-sgRNA; the nucleotide sequence of the specific targeting sgRNA is shown in SEQ ID NO. 1;
(3) annealing a primer pair of a target sg sequence of a tomato PDS gene into a PDS double-chain sg; the primer pair comprises PDS-sg-F and PDS-sg-R, and the nucleotide sequence of the PDS-sg-F is shown as SEQ ID NO. 2; the nucleotide sequence of the PDS-sg-R is shown as SEQ ID NO. 3;
(4) the vector pTRV2-sgRNA is purified after being cut by BsaI enzyme; connecting the PDS double strand sg with the vector after enzyme digestion and purification by using T4 DNA ligase, and transforming Escherichia coli DH5 a to obtain the viral vector pTRV 2-sgPDS.
Preferably, the synonymous mutation in step (1) is a mutation from GGTCTC to GGTCTG.
Preferably, the step (2) inserts the sgRNA specifically targeting the PDS gene between the EcoRI and BamHI multiple cloning sites of the vector skeleton without BsaI cleavage site function.
Preferably, the target sg sequence of the tomato PDS gene in the step (3) is shown as SEQ ID No. 4.
Preferably, when the target sg sequence of the tomato PDS gene is designed, the PAM sequence is GGG.
Preferably, the temperature of enzyme digestion in the step (4) is 37 ℃, and the time of enzyme digestion is 10-12 h.
The invention also provides a viral vector pTRV2-sgPDS constructed by the construction method.
The invention also provides application of the viral vector pTRV2-sgPDS in obtaining a gene editing plant of Cas 9-free.
The invention also provides a method for obtaining a gene editing plant of Cas9-free, which comprises the following steps: infecting the germinated seeds by using the viral vector pTRV2-sgPDS, culturing, and screening plants with normal and un-whitened leaves to obtain the gene editing plants of Cas 9-free.
Preferably, after the gene editing plant of Cas9-free is obtained, DNA is extracted, and genotyping is carried out through PCR.
The invention provides a virus vector for efficiently screening gene editing crops without exogenous DNA, wherein a sgRNA of a specific targeting PDS gene is inserted into a TRV2 vector, the sgRNA is simultaneously transcribed while a2 x 35s promoter drives the TRV virus RNA2 fragment to be transcribed, and the sgRNA is cut under the action of a gene silencing mechanism after the transcription of a plant body. Then in a T1 generation plant containing a Cas9 exogenous gene, sgRNA guides a Cas9 protein to be combined on a genome of PDS and cuts DNA, so that the PDS gene is induced to generate base insertion or deletion and other mutations, and the plant generates a leaf whitening phenomenon; in the T1 generation plant without the exogenous gene of Cas9, the PDS gene is not mutated because of no cutting of Cas9, and leaves still keep normal green; therefore, tomato plants which have genetic mutation at the T1 generation and do not contain Cas9 can be intuitively and efficiently separated according to the change of the leaf color. The method can efficiently screen the non-transgenic plants which finish the target gene editing in the T1 generation (the efficiency is more than 80%), saves time and labor, and has positive influence on basic research and a genome editing technology for crop improvement.
Drawings
FIG. 1 shows the structure of the viral vector pTRV 2-sgPDS;
FIG. 2 is visual screening of T1 generation plants for genetic mutations;
figure 3 is a Sanger sequencing verification PDS genetic mutation map.
Detailed Description
The invention provides a construction method of a virus vector for efficiently screening gene editing crops without exogenous DNA, which comprises the following steps: (1) carrying out synonymous mutation on 1 BsaI enzyme cutting site on the pTRV2 vector skeleton to obtain the vector skeleton without the function of the BsaI enzyme cutting site;
(2) inserting the specific targeting sgRNA into the vector framework without BsaI enzyme cutting site function to obtain a vector pTRV 2-sgRNA; the nucleotide sequence of the specific targeting sgRNA is shown in SEQ ID NO. 1;
(3) annealing a primer pair of a target sg sequence of a tomato PDS gene into a PDS double-strand sg; the primer pair comprises PDS-sg-F and PDS-sg-R, and the nucleotide sequence of the PDS-sg-F is shown as SEQ ID NO. 2; the nucleotide sequence of the PDS-sg-R is shown in SEQ ID NO. 3;
(4) the vector pTRV2-sgRNA is purified after being cut by BsaI enzyme; connecting the PDS double chain sg with the vector after enzyme digestion and purification by using T4 DNA ligase, and transforming Escherichia coli DH5 a to obtain the viral vector pTRV 2-sgPDS.
The invention carries out synonymous mutation on 1 BsaI enzyme cutting site on pTRV2 vector skeleton to obtain the vector skeleton without BsaI enzyme cutting site function. In the invention, the original pTRV2 vector backbone contains 1 BsaI enzyme cutting site (GGTCTC), and the BsaI enzyme cutting site is destroyed by modifying the BsaI enzyme cutting site (GGTCTG) by using codon synonymous mutation. The specific method of the synonymous mutation of codon is not particularly limited in the present invention, and a conventional protocol in the art may be used.
According to the invention, a specific targeting sgRNA is inserted into the vector framework without BsaI enzyme cutting site function to obtain a vector pTRV 2-sgRNA; the nucleotide sequence of the specific targeting sgRNA is shown in SEQ ID NO. 1. The specific targeting sgRNA is preferably inserted between the multiple cloning sites EcoRI and BamHI in the present invention. The specific targeting sgRNA of the invention contains two BsaI enzyme cutting sites (cross-hatching part), and the specific sequence is shown in SEQ ID NO. 1: GTGATTGAGACCATCTAGACG GTCTCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT are provided. The BsaI site of the vector pTRV2-sgRNA can be inserted with an optional target sg sequence specific to a target gene.
Annealing a primer pair of a target sg sequence of a tomato PDS gene into a PDS double-chain sg; the primer pair comprises PDS-sg-F and PDS-sg-R, and the nucleotide sequence of the PDS-sg-F is shown as SEQ ID NO. 2; the nucleotide sequence of the PDS-sg-R is shown in SEQ ID NO. 3. The tomato PDS gene has the sequence number of Solyc03g 123760. The invention designs a tomato PDS gene specific target sg sequence (SEQ ID NO. 4: AGTGACGGTAGTGCAATCGA), wherein the PAM sequence is GGG, joints are added at two ends of a primer, and a forward primer PDS-sg-F (SEQ ID NO.2) is TGATTGAGTGACGGTAGTGCAATCGA; the reverse primer is PDS-sg-R (SEQ ID NO.3): AAACTCGATTGCACTACCGTCACTCA. The annealing conditions of the present invention are preferably 20 μ L system: 10. mu.l of PDS-sg-F (10. mu.M) and 10. mu.l of PDS-sg-R (10. mu.M); the annealing procedure is preferably as follows: and (3) annealing is completed after the temperature is 95 ℃ for 5min in a PCR instrument and then is reduced to 25 ℃ at the speed of 5 ℃ per minute, thus obtaining PDS double-chain sg.
The invention uses BsaI enzyme to carry out enzyme digestion on the vector pTRV2-sgRNA and then purification; connecting the PDS double strand sg with the vector after enzyme digestion and purification by using T4 DNA ligase, and transforming Escherichia coli DH5 a to obtain the viral vector pTRV 2-sgPDS. The enzyme cutting temperature is preferably 37 ℃, and the enzyme cutting time is preferably 10-12 h. The purification method of the present invention is not particularly limited, and a conventional purification method in the art may be used. After the transformation of Escherichia coli DH5 a, the invention preferably further comprises plasmid Sanger sequencing verification, wherein the correctly sequenced product is the viral vector pTRV 2-sgPDS.
The invention also provides a viral vector pTRV2-sgPDS constructed by the construction method. The viral vector pTRV2-sgPDS of the invention preferably has the structure shown in FIG. 1.
The invention also provides application of the viral vector pTRV2-sgPDS in obtaining a gene editing plant of Cas 9-free.
The invention also provides a method for obtaining a gene editing plant of Cas9-free, which comprises the following steps: infecting the germinated seeds by using the viral vector pTRV2-sgPDS, culturing, and screening plants with normal and un-whitened leaves to obtain the gene editing plants of Cas 9-free.
The infestation according to the invention preferably comprises: germinating the seeds in a flask with sterile water, placing the flask in a 25-gauge flask, and shaking at 200rpm for 24 hours; transferring the seeds to a plate with filter paper and sterile water; after sprouting for about 24 hours, the sprouting length of the seeds reaches 0.5-1 cm, and vacuumizing and infecting are carried out. When the vacuumized infection is carried out, the invention preferably comprises the following steps: pTRV1 and pTRV2-sgPDS were introduced into Agrobacterium tumefaciens strain GV3101 by a freeze-thaw method. Agrobacterium containing the target gene was applied to LB plates (containing 3 antibiotics kanamycin (50. mu.g/mL), rifampicin (25. mu.g/mL), gentamicin (25. mu.g/mL)) and cultured at 28 ℃ for about 2 days to form a single colony. Single colonies were picked in 10mL centrifuge tubes containing 3mL LB medium, shaken at 28 ℃ and 200rpmAnd (5) 24 h. According to the following steps: 100 proportion, the above-mentioned Agrobacterium liquid is added into 50mLB culture medium of 3 same antibiotics, and expanded to OD600 value between 0.8-1.0 (about 12 h). 4000g, 4 ℃, centrifugate for 10min, and discard the supernatant. The pre-cooled infection solution was suspended and precipitated until OD600 was 1-1.5 (infection solution: 10mM magnesium chloride, 10mM MES, pH 5.7, acetosyringone added to 150. mu.M). Standing at room temperature for 3h, pTRV 1: pTRV2-gene is mixed with 1: 1. The osmotic mixture and germinated seeds (approximately 10) were placed in 1.5 or 2.0ml centrifuge tubes. The centrifuge tube was then placed in a vacuum desiccator. The agrobacteria are infiltrated into the sprouts using a vacuum infiltration system for the sprouts a vacuum dryer connected to a portable air compressor (GAST). The relative vacuum was-25 kpa. The vacuum pressure was maintained for about 30 seconds and then rapidly released to atmospheric pressure, which was repeated 5 times. The treated sprouts were sown in nutrient soil. Seedling culture conditions: (21 +/-2 ℃, 20-30% relative humidity) and the illumination intensity is 300 mu M/M 2 (s), light-dark period 16/8 h.
After the gene editing plant of Cas9-free is obtained, the method preferably further comprises the steps of extracting DNA and carrying out genotyping through PCR.
The following examples are provided to describe in detail the viral vectors of the present invention for efficient screening of gene-editing plants free of foreign DNA, and the construction method and application thereof, but they should not be construed as limiting the scope of the present invention.
Example 1
1. Vector construction:
1.1 enzyme cutting sites of a modified pTRV2 framework, wherein the original pTRV2 vector framework contains 1 BsaI enzyme cutting site (GGTCTC), and the BsaI enzyme cutting site is damaged by modifying the BsaI enzyme cutting site (GGTCTG) by utilizing codon synonymous mutation.
1.2 a sgRNA sequence (GTGATTGAGACCATCTAGACGGTCTCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT) containing two BsaI cutting sites is inserted between the EcoRI and BamHI multiple cloning sites, and a target sg sequence specific to the target gene can be inserted into the BsaI site optionally, and the vector is named as pTRV2-sgRNA.
1.3 designing a specific target sg sequence (AGTGACGGTAGTGCAATCGA) according to a tomato PDS gene sequence (Solyc03g123760), wherein the PAM sequence is GGG, joints are added at two ends of a primer, a forward primer PDS-sg-F is TGATTGAGTGACGGTAGTGCAATCGA, a reverse primer PDS-sg-R is AAACTCGATTGCACTACCGTCACTCA, and two primers are annealed into a double chain; carrying out enzyme digestion on the modified pTRV2 vector at 37 ℃ by BsaI overnight, and purifying; the PDS double strand sg is ligated to the digested and purified vector with T4 DNA ligase, and transformed into E.coli DH5 a. The plasmid Sanger sequencing verified to obtain pTRV 2-sgPDS.
2. And (3) infection process: seeds were germinated in flasks with sterile water. The bottles were placed in 25 gauge bottles and shaken at 200rpm for 24 hours. The seeds were transferred to the plate using filter paper and sterile water. After sprouting for about 24 hours, the sprouting length of the seeds reaches 0.5-1 cm, and vacuumizing and infecting are carried out.
pTRV1 and pTRV2-sgPDS were introduced into Agrobacterium tumefaciens strain GV3101 by freeze-thawing. Agrobacterium containing the target gene was applied to LB plates (containing 3 antibiotics kanamycin (50. mu.g/mL), rifampicin (25. mu.g/mL), gentamicin (25. mu.g/mL)) and cultured at 28 ℃ for about 2 days to form a single colony. Single colonies were picked in 10mL centrifuge tubes containing 3mL LB medium, and shaken at 200rpm for 24h at 28 ℃. According to the following steps: 100 proportion, the above-mentioned Agrobacterium liquid is added into 50mLB culture medium of 3 same antibiotics, and expanded to OD600 value between 0.8-1.0 (about 12 h). 4000g, 4 ℃, centrifugate for 10min, and discard the supernatant. The pre-cooled infection solution is suspended and precipitated until OD600 is 1-1.5 (prepared by infection solution: 10mM magnesium chloride, 10mM MES, pH 5.7, and acetosyringone is added to 150 μ M when used). Standing at room temperature for 3h, pTRV 1: pTRV2-gene is mixed with 1: 1.
The osmotic mixture and germinated seeds (approximately 10) were placed in each 1.5 or 2.0ml centrifuge tube. The centrifuge tube was then placed in a vacuum desiccator. Vacuum drier connected to portable air compressor (GAST) using vacuum infiltration system of sprouts]The agrobacteria were infiltrated into the sprouts. The relative vacuum was-25 kpa. The vacuum pressure was maintained for about 30 seconds and then rapidly released to atmospheric pressure, which was repeated 5 times. The treated sprouts were sown in nutrient soil. Seedling culture conditions: (21 +/-2 ℃, 20-30% relative humidity) and the illumination intensity is 300 mu M/M 2 (s), light-dark period 16/8 h.
3. And (4) screening. The plants obtained in the last step, which leaves are normally not whitened, are sampled, DNA is extracted, genotyping is carried out through PCR, Cas9-free gene editing plants (figure 2 and figure 3) are screened, and the statistical results are shown in table 1.
TABLE 1 comparison of screening efficiency
| Method | Number of cas9-free | Screening of Total amount | Efficiency of screening |
| |
10 | 50 | 20％ |
| TRV2- |
10 | 12 | 83.3％ |
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.
xuliebiao
<110> university of Jiangsu science and technology
<120> viral vector for efficiently screening gene editing crops without exogenous DNA, and construction method and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 109
<212> DNA
<213> Artificial sequence
<400> 1
gtgattgaga ccatctagac ggtctctgtt ttagagctag aaatagcaag ttaaaataag 60
gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgctttttt 109
<210> 2
<211> 26
<212> DNA
<213> Artificial sequence
<400> 2
tgattgagtg acggtagtgc aatcga 26
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
aaactcgatt gcactaccgt cactca 26
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
agtgacggta gtgcaatcga 20
Claims (8)
1. A method for constructing a viral vector for screening a gene-editing crop free of exogenous DNA, comprising the steps of: (1) carrying out synonymous mutation on 1 BsaI enzyme cutting site on the pTRV2 vector skeleton to obtain the vector skeleton without the function of the BsaI enzyme cutting site;
(2) inserting the specific targeting sgRNA between the EcoRI and BamH I of the multiple cloning site of the vector framework without BsaI enzyme cutting site function to obtain a vector pTRV 2-sgRNA; the nucleotide sequence of the specific targeting sgRNA is shown in SEQ ID NO. 1;
(3) annealing a primer pair of a target sg sequence of a tomato PDS gene into a PDS double-chain sg; the primer pair comprises PDS-sg-F and PDS-sg-R, and the nucleotide sequence of the PDS-sg-F is shown as SEQ ID NO. 2; the nucleotide sequence of the PDS-sg-R is shown as SEQ ID NO. 3; the target sg sequence of the tomato PDS gene is shown as SEQ ID NO. 4;
(4) the vector pTRV2-sgRNA is purified after being cut by BsaI enzyme; connecting the PDS double strand sg with the vector after enzyme digestion and purification by using T4 DNA ligase, and transforming Escherichia coli DH5 a to obtain the viral vector pTRV 2-sgPDS.
2. The method of claim 1, wherein the synonymous mutation in step (1) is a mutation from GGTCTC to GGTCTG.
3. The construction method according to claim 1, wherein the target sg sequence of the tomato PDS gene is designed, and the PAM sequence is GGG.
4. The construction method according to claim 1, wherein the temperature of enzyme digestion in the step (4) is 37 ℃, and the time of enzyme digestion is 10-12 h.
5. A viral vector pTRV2-sgPDS constructed by the construction method according to any one of claims 1 to 4.
6. Use of the viral vector pTRV2-sgPDS of claim 5 to obtain a gene-edited plant of Cas 9-free.
7. A method for obtaining a gene editing plant of Cas9-free is characterized by comprising the following steps: infecting the germinated seeds by using the viral vector pTRV2-sgPDS of claim 5, culturing, and screening plants with normal and un-whitened leaves to obtain Cas9-free gene editing plants.
8. The method of claim 7, further comprising extracting DNA and genotyping by PCR after obtaining the gene-editing plant of Cas 9-free.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010217689.9A CN111235181B (en) | 2020-03-25 | 2020-03-25 | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010217689.9A CN111235181B (en) | 2020-03-25 | 2020-03-25 | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111235181A CN111235181A (en) | 2020-06-05 |
| CN111235181B true CN111235181B (en) | 2022-09-23 |
Family
ID=70873774
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010217689.9A Active CN111235181B (en) | 2020-03-25 | 2020-03-25 | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111235181B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115747233B (en) * | 2022-11-25 | 2023-10-13 | 四川农业大学 | FaPDS gene for regulating and controlling leaf color of strawberry and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988160A (en) * | 2015-07-31 | 2015-10-21 | 中国农业科学院蔬菜花卉研究所 | Preparation method of pink tomato material |
| CN105255918A (en) * | 2015-11-17 | 2016-01-20 | 中国农业科学院生物技术研究所 | Verticillium dahliae phospholipase target gene fragment and interference vector and application thereof |
| WO2016084084A1 (en) * | 2014-11-27 | 2016-06-02 | Danziger Innovations Ltd. | Nucleic acid constructs for genome editing |
| WO2016185411A1 (en) * | 2015-05-18 | 2016-11-24 | King Abdullah University Of Science And Technology | Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference |
| CN109234310A (en) * | 2018-11-13 | 2019-01-18 | 云南省烟草农业科学研究院 | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant |
| CN110468147A (en) * | 2018-10-24 | 2019-11-19 | 中国农业大学 | A kind of gene editing carrier system based on hordeivirus |
| CN110777163A (en) * | 2019-12-09 | 2020-02-11 | 新疆农业科学院园艺作物研究所 | Method for preparing tomato material with high lycopene content |
-
2020
- 2020-03-25 CN CN202010217689.9A patent/CN111235181B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016084084A1 (en) * | 2014-11-27 | 2016-06-02 | Danziger Innovations Ltd. | Nucleic acid constructs for genome editing |
| WO2016185411A1 (en) * | 2015-05-18 | 2016-11-24 | King Abdullah University Of Science And Technology | Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference |
| CN104988160A (en) * | 2015-07-31 | 2015-10-21 | 中国农业科学院蔬菜花卉研究所 | Preparation method of pink tomato material |
| CN105255918A (en) * | 2015-11-17 | 2016-01-20 | 中国农业科学院生物技术研究所 | Verticillium dahliae phospholipase target gene fragment and interference vector and application thereof |
| CN110468147A (en) * | 2018-10-24 | 2019-11-19 | 中国农业大学 | A kind of gene editing carrier system based on hordeivirus |
| CN109234310A (en) * | 2018-11-13 | 2019-01-18 | 云南省烟草农业科学研究院 | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant |
| CN110777163A (en) * | 2019-12-09 | 2020-02-11 | 新疆农业科学院园艺作物研究所 | Method for preparing tomato material with high lycopene content |
Non-Patent Citations (2)
| Title |
|---|
| TRV-GFP: a modified Tobacco rattle virus vector for efficient and visualizable analysis of gene function;Ji Tian;《J Exp Bot》;20131111;第65卷(第1期);第311-322页 * |
| 桑树PDS基因VIGS转化体系的构建与鉴定;李瑞雪;《南方农业学报》;20181231;第49卷(第7期);第1432-1438页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111235181A (en) | 2020-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988229B (en) | Method for obtaining tillering-changed rice by modifying OsTAC1 gene through CRISPR-Cas | |
| WO2020007331A1 (en) | Method for site-specific mutagenesis of medicago sativa gene by using crispr/cas9 system | |
| CN103981211B (en) | A kind of breeding method formulating cleistogamous rice material | |
| Araújo et al. | An efficient transformation method to regenerate a high number of transgenic plants using a new embryogenic line of Medicago truncatula cv. Jemalong | |
| AU2019297209B2 (en) | Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant | |
| CN111334527B (en) | Virus vector capable of carrying out plant polygene editing and construction method and application thereof | |
| CN109234310B (en) | Recombinant vector for rapidly obtaining transgenic gene-free edited plant and use method thereof | |
| JP7011327B2 (en) | Genome-editing plant production method using plant virus vector | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN111718954B (en) | Genome editing tool and application thereof | |
| US11365423B2 (en) | Method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants | |
| CN102676564A (en) | Method enabling scion variety to obtain virus resistance, RNA (ribonucleic acid) interference vector and transgenosis method | |
| CN111235181B (en) | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof | |
| WO2001096583A2 (en) | Removal of selectable markers from transformed cells | |
| Rezaei et al. | In planta removal of nptII selectable marker gene from transgenic tobacco plants using CRISPR/Cas9 system | |
| EP4328311A1 (en) | Negative-strand rna viral vector and plant genome editing method without transformation | |
| US20220090107A1 (en) | Rna viral rna molecule for gene editing | |
| CN116555226A (en) | CasF2 protein, CRISPR/Cas gene editing system and application thereof in plant gene editing | |
| CN112522299A (en) | Method for obtaining rice with increased tillering by using OsTNC1 gene mutation | |
| CN111909956A (en) | Method for improving drought resistance of rice by blocking or weakening gene expression of OsNAC092 of rice | |
| CN112795571A (en) | Herbicide-resistant corn transformant and preparation method thereof | |
| CN113832182B (en) | Preparation method of rice Osspin 2 mutant plant | |
| CN113430194B (en) | White birch gene editing method based on CRISPR/Cas9 | |
| US20240218385A1 (en) | Negative-strand rna viral vector and plant genome editing method without transformation | |
| CN117384948A (en) | Gene sequence for realizing A/T accurate replacement at target site-4 position and replacement method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |