CN1444651A - Generation of libraries of antibodies in yeast and uses thereof - Google Patents

Generation of libraries of antibodies in yeast and uses thereof Download PDF

Info

Publication number
CN1444651A
CN1444651A CN 01813639 CN01813639A CN1444651A CN 1444651 A CN1444651 A CN 1444651A CN 01813639 CN01813639 CN 01813639 CN 01813639 A CN01813639 A CN 01813639A CN 1444651 A CN1444651 A CN 1444651A
Authority
CN
China
Prior art keywords
library
sequence
protein
test
yeast
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 01813639
Other languages
Chinese (zh)
Inventor
朱力
华绍炳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetastix Corp
Original Assignee
Genetastix Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/603,663 external-priority patent/US6406863B1/en
Priority claimed from US09/603,658 external-priority patent/US6410246B1/en
Priority claimed from US09/602,373 external-priority patent/US6410271B1/en
Application filed by Genetastix Corp filed Critical Genetastix Corp
Publication of CN1444651A publication Critical patent/CN1444651A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Compositions, kits and methods are provided for generating highly diverse libraries of proteins such as antibodies via homologous recombination in vivo, and screening these libraries against protein, peptide and nucleic acid targets using a two-hybrid method in yeast. The method for screening a library of tester fusion proteins against a target protein or peptide comprises: expressing a library of tester proteins in yeast cells, the tester fusion protein comprising a first polypeptide subunit whose sequence varies within the library, a second polypeptide subunit whose sequence varies within the library independently of the first polypeptide, and a linker peptide which links the first and second polypeptide subunits; expressing one or more target fusion proteins in the yeast cells expressing the tester proteins, each of the target fusion proteins comprising a target peptide or protein; and selecting those yeast cells in which a reporter gene is expressed, the expression of the reporter gene being activated by binding of the tester fusion protein to the target fusion protein.

Description

In yeast, produce the application of antibody library and antibody library
Background of invention
Invention field
The present invention relates to composition, method and test kit, they in order to produce the recombinant expression vector library and use these library screenings affine-in conjunction with right, more specifically, in order to produce recombination human source antibody library and screening they and target antigen bonded avidity.
Description of related art
Antibody is the changeable different molecule of a class.Delves, P.J. (1997) " Antibodyproduction:essential techniques. " New York, John Wiley ﹠amp; Sons, the 90-113 page or leaf.According to estimates, even lack antigenic stimulation, a people can produce at least 10 15Different antibody molecules---be Permian antibody library (Permian antibody repertoire).The antigen binding site of many antibody can with various relevant but antigenic determinant cross reactions inequality, obviously, the Permian antibody library is so big, always so that in this storehouse, contain the antigen binding site that is fit to almost any potential antigenic determinant, although avidity is lower.
Structurally, antibody or title immunoglobulin (Ig) (Ig s) are made up of the unit of one or more Y type.For example: the molecular weight of immunoglobulin G (Ig G) is 150kDa, it only by these unitary one of them form.Typically, an antibody can be cut into two identical Fab (Fab) fragments and a Fc (FC) fragment by the decomposition of proteolytic enzyme papoid.Each Fab comprises an antigen binding site, but other aspects of the Fc of antibody part mediated immune reaction.
A typical antibody comprises four polypeptide---and the heavy chain (H) of two identical copies and the light chain (L) of two copies form general formula H 2L 2Every the L chain links to each other with a H chain by a cystine linkage.Article two, heavy chain also is connected with each other by disulfide linkage.The papoid cutting is with respect to the N-end of the disulfide linkage that the H chain is linked together.Every the Fab that is produced is made up of half of the N-end of total length L chain and H chain; Fc then by the C-of two H chains terminal half formed.The terminal a plurality of disulfide linkage of (inter-H) C-between stomach en-cutting heavy chain, the result produces the small segment of a divalence fragment [F (ab) '] and many Fc.Ig G heavy chain comprises the terminal variable region (V of a N- H) add the terminal constant region (C of three C- H1, C H2 and C H3).Light chain respectively comprises the variable region (V of a N-end L) and the terminal constant region (C of C- L).The different variable region of heavy chain or light chain and the length of constant region are very near (each district has 110 amino-acid residues approximately).Fab is respectively by a V L, V H, C HL and C LThe district forms.V LAnd V HPart contains hypermutation fragment (complementary determining region or CDR), and it forms the binding site of antibody.
The V of a monoclonal antibody LAnd V HPart also can connect by one section synthetic joint form a single chain protein matter (scFv), and this scFv remains with identical with monoclonal antibody itself to antigenic specificity and avidity.Bird, R.E. waits (1988) " Single-chainantigen-binding proteins " Science 242:423-426.Typical scFv is by the peptide chain of one section artificial design (Gly for example 4-Ser) 3With V LAnd V HThe recombinant polypeptide that is formed by connecting, the peptide chain of described artificial design connects V LC-terminal and V HThe N-terminal of sequence.The dna sequence dna of coding scFV can be with (the Gly that encodes 4-Ser) 3The universal primer of joint makes up by polymerase chain reaction (PCR).Lake, D.F. waits (1995) " Generation of diversesingle-chain proteins using a univerasl (Gly 4-Ser) 3Encodingoligonucleotide " Biotechniques 19:700-702.
During evolution, mammiferous immunity system has very unique genetic mechanism, and it can be by linking together them before isolating gene fragment is transcribed, and produces the almost different light chains and the heavy chain of unrestricted number with a kind of approach of obvious economy.And the economic almost heavy chain of unlimited amount and the genetic mechanism of light chain of producing.Ig chain for every type---κ light chain, lambda light chain and heavy chain---there is the separation storehouse of a gene fragment, the finally synthetic separation storehouse of gene fragment since then of each peptide chain.Each warehouse compartment generally includes the gene fragment in a large amount of coding Ig chain V district and the gene fragment in a spot of coding C district on different karyomit(e).In B cell development process, the complete encoding sequence of two each bars of Ig chain that coding will be synthesized is that the complete encoding sequence in will encode V district and C district fits together by site-specific genetic recombination.In addition, the V district of light chain is coded by the dna sequence dna that two fragment gene fragments (being that the V gene fragment is connected or the J gene fragment with short) assemble.The V district of heavy chain is then coded by the dna sequence dna that three fragment gene fragments (being V gene fragment, J gene fragment and D gene fragment (a diversity or D segment)) assemble.
V, J and the D gene fragment itself of the codified Ig chain that hands down by heredity in a large number can produce antibody diversity basically, and these segmental being connected have greatly increased the diversity of antibody.And coarse connection of gene fragment and the somatic mutation of being introduced when pre-B cell phase V-D-J connects have greatly increased the diversity in V district.
After at an antigen immune, Mammals can produce the antibody that this antigen is had high-affinity through a process that is called affinity maturation.The somatic hypermutation that this antigen orders about carries out fine tuning to this antigenic antibody response, and this process is estimated to be because the accumulation point mutation especially accumulates point mutation in heavy chain and light chain V district encoding sequence and the B cell clone that has high-affinity antibody selectively increased realize.
This at various antigens in simulation, the natural maturity aspect people of especially relevant with disease such as autoimmune disease, cancer, AIDS and asthma antigenic antibody have done a lot of effort.Especially, be extensive use of display technique of bacteriophage and expressed and showed the protein molecule of biological function in its surface, to produce big antibody fragment library by the ability of utilizing phage.The antibody combinatorial library has made up in the expression system of lambda particles phage and has formed, and this library can be screened by the bacterium colony of phage plaque or lysosome.(Huse waits (1989) Science246:1275; Caton and Koprowski (1990) Proc.Natl.Acad.Sci. (U.S.A.) 87:6450; Mullinax etc. (1990) Proc.Natl.Acad.Sci. (U.S.A.) 87:8095; Persson etc. (1991) Proc.Natl.Acad.Sci. (U.S.A.) 88:2432).Various embodiments (Kang etc. (1991) Proc.Natl.Acad.Sci. (U.S.A.) 88:4363 of phage antibody display libraries and lambda particles phage expression library has been described; Clackson etc. (1991) Nature 352:624; McCafferty etc. (1990) Nature 348:552; Burton etc. (1991) Proc.Natl.Acad.Sci. (U.S.A.) 88:10134; Hoogenboom etc. (1991) Nucleic Acid Res.19:4133; Chang etc. (1991) J.Immunol.147:3610; Breitling etc. (1991) Gene 104:147; Marks etc. (1991) J.Mol.Biol.222:581; Barbas etc. (1992) Proc.Natl.Acad.Sci. (U.S.A.) 89:4457; Hawkins and Winter (1992) J.Immunol.22:867; Marks etc. (1992) Biotechnology 10:779; Marks etc. (1992) J.Biol.Chem.267:16007; Lowman etc. (1991) Biochemistry 30:10832; Lerner etc. (1992) Science258:1313).Also see also Rader, C. and Barbas, the summary of C.F. (1997) " PhageDisplay of Combinatorial Antibody libraries " Curr.Opin.Biotechnol.8:503-508).
Also there is many reports (Marks etc. (1992) Biotechnology 10:779 in the various scFv library of showing in bacteriophage coat protein matter; Winter G and Milstein C (1991) Nature349:293; Clackson etc. (1991) op.cit.; Marks etc. (1991) J.Mol.Biol.222:581; Chaudhary etc. (1990) Proc.Natl.Acad.Sci. (U.S.A.) 87:1066; Chiswell etc. (1992) TIBTECH 10:80; With (1988) Proc.Natl.Acad.Sci. (U.S.A.) 85:5879 such as Huston).
In general, phage library be with a random oligonucleotide library or with an encoding antibody fragment (as V LAnd V H) the cDNA library insert M 13Or be built in the 3rd gene of fd phage (gene 3).The genetic expression of each insertion is at the N-of the 3rd gene product end, and the 3rd gene product is the minor coat protein of phage.As a result, the peptide storehouse of containing various peptide can be built into.Affine then screening is at for example antigenic phage library of the interested target molecule of immunity, reclaims the phage of specific combination and increases by the ehec infection host cell.Typically, with interested target molecule for example acceptor (as polypeptide, carbohydrate, glycoprotein, nucleic acid) be fixed on a kind of chromatographic resin with by affinity chromatography concentration response phage by being covalently bound to, and/or interested target molecule is carried out mark be used for screening plaque or colony lift.This process is called biological elutriation (Biopanning).At last, the phage after the amplification is checked order with the special peptide sequence of deriving.In the inherent state of nature process of phage display, the antibody that is illustrated in phage surface does not for example adopt its native conformation in mammlian system under external selection condition.In addition, bacterium is difficult for the antibody that processing, assembling or expression/secretion have function.
By using Abgenix company for example by company., Freemont, California and Medarex company., Annandale, the XENOMOUSE of New Jersey exploitation TMTechnology, transgenic animal such as mouse have been used to produce full humanized antibody.Designed the strain of mouse with the expression of human immunoglobulin gene by suppressing the mouse antibody genes expression and on function, replacing.The natural ability of this technology utilization mouse immune in supervision and affine maturation is to produce an antibody library of high-affinity completely.Yet the breeding of this class transgenic mice strain and the selection of high-affinity antibody need spend the time for a long time.And in order to start immune response, the selected antigen of human antibody library is undoubtedly taken as by mouse and is exotic antigen; Can not be selected at the antibody that does not have immunogenic target antigen in the mouse by using this technology.In addition, about the applying transgene animal for example transgenic goat (develop by Genzyme Transgenics, Framingham, MA) and transgenic chicken (develop by Geneworks company, Ann Arbor, MI) produce the problem that antibody also faces the rules and regulations aspect, and the safety problem that transgenic animal faced that recombinant viral vector is arranged is infected in containment.
Antibody and antibody fragment are also produced in transgenic plant.Transform plant with the carrier that carries antibody gene, for example maize plant (by Integrated Protein Technologies development, St.Louis, MO), this causes these foreign gene stable integrations in Plant Genome.By comparison, the microorganism after the overwhelming majority is transformed by plasmid can be lost this plasmid in secular fermenting process.Transgenic plant can produce antibody on a large scale as a kind of cheap instrument.Yet because the growth cycle of plant is very long, the high-affinity antibody that carries out the anti-target antigen of high flux screening in plant may not be effective and feasible.
Summary of the invention
Involved in the present invention is efficient make up and body in screening protein-protein or protein-DNA in conjunction with right composition, method and test kit.For high flux screening in vivo, can adopt produce and screening in conjunction with right method.
An aspect of of the present present invention provides some compositions.These compositions can be in vivo or externally are used for shaker test protein and target molecule comprises protein, peptide, DNA, affine in conjunction with right between RNA and small molecules.
In one embodiment, provide a Yeast expression carrier library.The Yeast expression carrier that forms in the library contains first nucleotide sequence of the first polypeptide subunit of encoding; Encode second nucleotide sequence of the second polypeptide subunit; The joint sequence that is connected the joint peptide of this first nucleotide sequence and this second nucleotide sequence with coding.The first polypeptide subunit, the second polypeptide subunit and joint polypeptide are expressed as a single fusion rotein.In addition, first nucleotide sequence and second nucleotides sequence are listed in that each makes a variation independently in the described expression vector library.
According to above-mentioned embodiment, Yeast expression carrier can be 2 μ plasmid vectors, is preferably the yeast one bacterium shuttle vectors that contains the bacterium replication orgin.
In another embodiment, provide an expression vector library.The expression vector that forms in the library comprises the activation structure territory of one section encoding transcription incitant or the transcription sequence of DNA binding domains; Encode first nucleotide sequence of the first polypeptide subunit, second nucleotide sequence of the second polypeptide subunit of encoding and coding connect the joint sequence of the joint peptide of first nucleotide sequence and second nucleotide sequence.The activation structure territory of activating transcription factor or DNA binding domains, the first polypeptide subunit, the second polypeptide subunit and joint expression of polypeptides become a single warm albumen.In addition, first nucleotide sequence and second nucleotides sequence are listed in that each makes a variation independently in the expression vector library.
According to this embodiment, expression vector can be a bacterium, phage, yeast, Mammals and virus expression carrier, preferred yeast expression vector, more preferably 2 μ plasmid Yeast expression carriers.
According to this embodiment, the activating transcription factor sequence can be positioned at respect to first nucleotide sequence equally, 5 ' end of the joint sequence and second Nucleotide.Perhaps, the activating transcription factor sequence can be positioned at respect to first nucleotide sequence, 3 ' end of the joint sequence and second nucleotide sequence.
The library of a transformed yeast cells is provided in another embodiment.Described yeast cell library comprises the Yeast expression carrier library.Expression vector in the transformed yeast cells library comprises: the activation structure territory of one section encoding transcription incitant or the transcription sequence of DNA binding domains; Encode first nucleotide sequence of the first polypeptide subunit; Encode second nucleotide sequence of the second polypeptide subunit; The joint sequence that is connected the joint peptide of first nucleotide sequence and second nucleotide sequence with coding.The activation structure territory of activating transcription factor or DNA binding domains, the first polypeptide subunit, the second polypeptide subunit and joint expression of polypeptides become single fused protein.In addition, first nucleotide sequence and second nucleotides sequence are listed in that each makes a variation independently in the described expression vector library.
According to this embodiment, yeast cell can be the diploid yeast cell, and alternatively, yeast cell can be for example a and the α bacterial strain of yeast haploid cell of monoploid.
Another aspect of the present invention provides to make up to can be used to screen protein-protein or the protein-DNA multinomial method in conjunction with right Yeast expression carrier library.
In one embodiment, described method comprises: will have 5 ' in the linearizing site-and the library of the nucleotide sequence of the linear Yeast expression carrier of 3 '-end sequence and linear and double-stranded insertion be transformed in the yeast cell.Described insertion sequence comprises first nucleotide sequence of the first polypeptide subunit of encoding, second nucleotide sequence of the second polypeptide subunit of encoding, and the joint sequence of the joint peptide that connects the first and second polypeptide subunits of encoding a section.Each insertion sequence also comprises 5 ' of the end that is positioned at insertion sequence-and 3 '-flanking sequence.5 ' of described insertion sequence-and 3 '-flanking sequence respectively with 5 ' of linearizing yeast table carrier-and 3 '-end sequence enough homologys are arranged, make it possible to take place homologous recombination.The homologous recombination that takes place between described carrier and described insertion sequence causes the inclusion of insertion sequence in by transformed yeast cells to enter into carrier.
In this embodiment, the first polypeptide subunit, the second polypeptide subunit, and the joint expression of polypeptides becomes a single fused protein.Equally, first nucleotide sequence and second nucleotides sequence are listed in that each makes a variation independently in the expression vector library.
According to above-mentioned embodiment, 5 ' of described insertion nucleotide sequence-or 3 '-flanking sequence preferably be about 30-120bp, more preferably be about 40-90bp, most preferably be about 60-80bp.
By using by the method that this embodiment comprised, having made up encodes has the Yeast expression carrier library in highly multifarious human single chain variable fragments antibody (scFv) library.
In another embodiment, provide a kind of method that produces the Yeast expression carrier library.Described method comprises:
A) be transformed in the yeast cell
I) have 5 ' in linearizing first site-and the linear Yeast expression carrier of 3 '-end sequence and
II) linearity and the first double-stranded insertion nucleotide sequence library, every kind of described first insertion sequence comprises first nucleotide sequence of the first polypeptide subunit of encoding, be positioned at the described first insertion sequence end 5 '-and 3 '-flanking sequence, they respectively with 5 ' of the carrier that is positioned at linearizing first site-and abundant homology of 3 '-end sequence, make homologous recombination can take place;
B) in described homologous recombination of carrying out in by transformed yeast cells between described carrier and described first insertion sequence, the insertion sequence of winning is incorporated in the carrier;
C) transformed to such an extent that separate the carrier that comprises the first insertion sequence library the yeast cell from described;
D) with the described carrier linearizing that includes the first insertion sequence library, to produce 5 ' in linearizing second site-and 3 '-end sequence;
E) be transformed into by in the transformed yeast cells
I) the linear Yeast expression carrier in the step d) and
II) existing property and the second double-stranded insertion nucleotide sequence library, every kind second insertion sequence comprises second nucleotide sequence of the second polypeptide subunit of encoding, be positioned at 5 ' of the described second insertion sequence end-and 3 '-flanking sequence, they respectively with 5 ' of the carrier that is positioned at the second linearizing site-and abundant homology of 3 '-end sequence so that homologous recombination can take place; With
F) between described linearizing Yeast expression carrier in the second linearizing site and described second insertion sequence, in by transformed yeast cells, carry out homologous recombination, make described second insertion sequence be integrated in the described carrier, and described first and second nucleotide sequences are linked to each other by one section joint sequence.
The expression vector of method formation is with the first polypeptide subunit thus, and the second polypeptide subunit and joint expression of polypeptides become a single warm albumen.Equally, described first and second nucleotides sequences are listed in that each makes a variation independently in the expression vector library that method forms thus.
According to this embodiment, 5 ' of insertion sequence-or 3 '-flanking sequence preferably be about 30-120bp, more preferably be about 40-90bp, most preferably be about 60-80bp.
In a kind of distortion of aforesaid method,, can increase the diversity in the expression vector library that forms with this method by chain reorganization (Chain shnffling) via site-specific reorganization.Therefore, described method can further comprise: between each member in Yeast expression carrier library 5 '-and 3 '-recombination site cause site-special reorganization, this reorganization causes the exchange of first or second nucleotide sequence between the member in described Yeast expression carrier library.
According to this deformation method, first or second insert 5 ' of nucleotide sequence end-and 3 '-flanking sequence comprise 5 ' respectively-and 3 '-recombination site, described recombination site can be discerned by site-specific recombinase.
Equally according to this deformation method, described 5 '-preferably be different site-specific recombination sites with 3 '-site-specific recombination site, more preferably these sites each be independently selected from IDNos:1-13 in SEQ, most preferably be the lox P of coliphase P1, another is the mutant of loxP sequence.
Equally according to this deformation method, described site-specific recombinase can be routinely to express or induced and obtain expressing in yeast cell.Site-specific recombinase can be the CRE recombinase that can cause the locus specificity reorganization.
Another aspect of the present invention, provide be used for the screening can with target peptide, protein, or the multinomial method of DNA bonded test protein.
At a target molecule is in target peptide or the proteinic embodiment, this method comprises: express a test protein library in yeast cell, each test protein is a kind of fused protein, the first polypeptide subunit that it is made a variation in the library by one section its sequence, one section its sequence is independent of the second polypeptide subunit of first polypeptide variation in the library, and one section joint peptide that connects the first and second polypeptide subunits is formed; Express one or more target fused proteins in the yeast cell of expressing test protein, each target fused protein comprises one section target peptide or target protein; And select those yeast cell of expressing reporter genes, by test combine with the target fused protein expression of activation reporter gene of fused protein.
According to this embodiment, the expression of reporter gene can be activated by a kind of function activating transcription factor, and described function activating transcription factor forms by test protein is combined in yeast two-hybrid system with target peptide or target protein.
Distortion according to the embodiment that relates to yeast two-hybrid system, the step of expressing test fused protein library can comprise that vector library is expressed in a test to be transformed in the yeast cell that contains a reporter gene construct, described reporter gene construct comprises reporter gene, under its control that is expressed in the activating transcription factor that comprises activation structure territory and DNA binding domains.Each test expression vector includes the activation structure territory of one section encoding transcription incitant or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.Randomly, the step of expression target fused protein comprises that vector library is expressed in a target expression vector and test to be transformed in the yeast cell synchronously or step by step.Described target expression vector comprises one section coding and is not expressed the activation structure territory of activating transcription factor or second transcription sequence of DNA binding domains by test expression vector library; And the target sequence of a section encode target protein or target peptide.
In another distortion of the embodiment that relates to yeast two-hybrid system, the step of expressing the test fused protein and expressing the target fused protein is included between first and second populations of haploid yeast cell of relative mating type carries out mating.First population of haploid yeast cell comprises the test in test fused protein library and expresses vector library.Each described test expression vector contains the activation structure territory of one section encoding transcription incitant or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.Second population of haploid yeast cell includes a target expression vector.This target expression vector contains one section coding not by the activation structure territory of the activating transcription factor of test expression vector library expression or second transcription sequence of DNA binding domains; And the target sequence of a section encode target protein or target peptide.First or second population of haploid yeast cell comprises a reporter gene construct, and it comprises the reporter gene under the control of transcribing that is expressed in activating transcription factor.
In this distortion, the haploid yeast cell of mating type can be preferably relatively αType and aThe yeast cell of type bacterial strain. αType and aMating between first and second populations of the haploid yeast cell of type bacterial strain can be carried out in being rich in the substratum of nutrition.
Randomly, a plurality of target fused proteins can be expressed and be screened at the test protein library simultaneously.According to this distortion, the step of expressing test fused protein library and expressing most target fused protein is included between first and second populations of haploid yeast cell of relative mating type carries out mating.The haploid yeast cell of first population comprises the test in test fused protein library and expresses vector library.Each described test expression vector contains the activation structure territory of one section encoding transcription incitant or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the joint peptide of one section coding connection first and second nucleotide sequence.The haploid yeast cell of second population includes a plurality of target expression vectors.The target expression vector contains one section coding not by the activation structure territory of the activating transcription factor of test expression vector library expression or second transcription sequence of DNA binding domains; And the target sequence of a section encode target protein or target peptide.The haploid yeast cell of first or second population includes a reporter gene construct, and it comprises the reporter gene under the control of transcribing that is expressed in activating transcription factor.
According to this distortion, the haploid yeast cell of mating type can be preferably relatively αWith aThe yeast of type bacterial strain. αWith aMating between first and second populations of the haploid yeast cell of type bacterial strain can be carried out in being rich in the substratum of nutrition.
By using, screened at human single chain variable fragments antibody (scFV) library of Ro 24-7472/000-8 (IL) and screened the scFV that people IL-8 is had a high-affinity and cloned by the method that this distortion comprised.
According to this distortion, the member that vector library is expressed in test can be arranged in independent yeast clone in one or more porous flat plates equally.
According to this distortion, a plurality of target expression vectors can be arranged in independent yeast clone in one or more porous flat plates equally.
According to this distortion, described mating can be based on clone's mating equally, and wherein each comprises test expression vector member's yeast clone and each mating individually of a plurality of target expression vectors.
According to this distortion, described a plurality of target expression vectors can be one and contain the people EST clone collection or the expression vector library of structural domain structure collection equally.
According to above-mentioned any one screening protein-protein bound right method, described target fused protein comprises the antigen with disease-related, for example a TSA.Randomly, described target fused protein can comprise human growth factor acceptor such as Urogastron, transferrin, rhIGF-1, transforming growth factor, interleukin 1 and interleukin II.
In another embodiment, provide a kind of protein-DNA that in yeast-one-hybrid system, screens in conjunction with right method.
Described method comprises: express the test protein library in the yeast cell that contains a reporter gene construct, described reporter gene construct comprises the reporter gene under the control of transcribing that is expressed in the target DNA sequence; Selection can be expressed the yeast cell of reporter gene, the expression of reporter gene tested fused protein combine with the target DNA sequence activate.Each test fused protein comprises the activation structure territory of an activating transcription factor, the first polypeptide subunit that its sequence makes a variation in the library, its sequence is independent of the second polypeptide subunit of first polypeptide subunit variation in the library, and a joint peptide that connects the first polypeptide subunit and the second polypeptide subunit.
In a distortion of this embodiment, the step of expressing test fused protein library comprises that vector library is expressed in the test in test fused protein library to be transformed in the yeast cell.Each test expression vector comprises the transcription sequence in the activation structure territory of one section encoding transcription incitant, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second subunit, and the joint sequence of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.
In another distortion of this embodiment, the step of expressing test fused protein library in yeast cell is included between first and second populations of haploid yeast cell of relative mating type carries out mating.First population of haploid yeast cell comprises the test of a test fused protein and expresses vector library, each test expression vector comprises the transcription sequence in the activation structure territory of one section encoding transcription incitant, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and coding connects the joint sequence of the joint peptide of first nucleotide sequence and second nucleotide sequence.Second population of haploid yeast cell comprises a reporter gene construct.
According to this distortion, the haploid yeast cell of mating type can be preferably relatively αWith aThe yeast of type bacterial strain. αWith aMating between first and second populations of the haploid yeast cell of type bacterial strain is carried out in being rich in the substratum of nutrition.
Select protein-DNA in conjunction with right method according to above-mentioned any, the target DNA sequence preference in the reporter gene construct is positioned at respect to 5 ' of reporter gene with 2-6 series connection multiple form to be held.Target DNA sequence preference in the described reporter gene construct is about 15-75bp, more preferably is about 25-55bp.
In another embodiment is existing, provide a kind of right method of protein-protein bound of in yeast-one-hybrid system, screening.Described method comprises: express test fused protein library in the yeast cell that includes a reporter gene construct, described reporter gene construct comprises and is expressed in the transcribing under the control of specific DNA binding site; In the yeast cell of expressing the test fused protein, express a kind of target protein, can be attached to special DNA binding site in target protein described in this cell; And the yeast cell of select expressing reporter gene, the expression of reporter gene tested fused protein combine with target protein activate.Each test fused protein comprises the activation structure territory of an activating transcription factor, the first polypeptide subunit, the second polypeptide subunit, and one section joint peptide that connects the first polypeptide subunit and the second polypeptide subunit, wherein each makes a variation the sequence of the first and second polypeptide subunits independently in described test fused protein library.
In a distortion of this embodiment, the step of expressing test fused protein library comprises that vector library is expressed in the test of a test fused protein to be transformed in the yeast cell.Each test expression vector comprises the transcription sequence in the activation structure territory of one section encoding transcription incitant, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the connecting joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.
In another distortion of this embodiment, express the warm protein library of test and express the warm proteinic step of target being included between first and second populations of haploid yeast cell of relative mating type and carrying out mating.First population of described haploid yeast cell comprises the test in a test fused protein library and expresses vector library.Each test expression vector comprises the transcription sequence in the activation structure territory of one section encoding transcription incitant, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.Second population of haploid yeast cell includes a target expression vector, and it comprises the target sequence of the target protein of encoding.First population or second population of haploid yeast cell comprise the reporter gene construct.
Above-mentioned any one selection can with the target peptide, in the method for the test protein that protein or DNA combine, described method can further comprise separation test expression vector from selected yeast cell; And first and second nucleotide sequences of the test expression vector that is separated to are carried out mutagenesis to produce an expression vector library after the mutagenesis.
The example of mutafacient system includes but are not limited to: fallibility PCR mutagenesis, site-directed mutagenesis, DNA reorganization and their combination.Expression vector library after the described mutagenesis can utilize the similar program of shaker test expression vector to identical or different target peptide, and protein or DNA screen.
By using fallibility PCR mutagenesis, random mutagenesis selected scFV at IL-8 in yeast two-hybrid system has the mutant of higher binding affinity to produce to people IL-8.
The Several Methods in preparation single-chain antibody library is provided in another aspect of this invention.In one embodiment, described method comprises: express a Yeast expression carrier library in yeast cell.Each Yeast expression carrier comprises first nucleotide sequence of one section encoding antibody variable region of heavy chain, second nucleotide sequence of one section encoding antibody variable region of light chain connects the joint sequence of the joint peptide of antibody heavy chain variable region and antibody chain variable region with one section coding.Described antibody heavy chain variable region, antibody chain variable region and joint peptide are expressed as a single fused protein.Equally, described first and second nucleotides sequences are listed in that each makes a variation independently in the expression vector library, have at least 10 with generation 6Multifarious single-chain antibody library.
According to this embodiment, the diversity preferred 10 in described single-chain antibody library 6-10 16, more preferably 10 7-10 16, most preferably 10 8-10 16
In another aspect of the present invention, provide the screening can be in conjunction with the target peptide, the test kit of the test protein of protein or DN.
In one embodiment, described test kit comprises: vector library and a kind of yeast cell system are expressed in a test.Each test expression vector comprises the activation structure territory of one section encoding transcription incitant or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.Described first and second nucleotides sequences are listed in that each makes a variation independently in the expression vector library.In yeast cell system, comprise a reporter gene construct.This report gene construct comprises a reporter gene under the control of transcribing that is expressed in the specific DNA binding site.
Randomly, this test kit can further comprise a target expression vector, and it comprises one section coding not by the activation structure territory of the expressed activating transcription factor in test expression vector library or second transcription sequence of DNA binding domains; And the target sequence of a section encode target protein or peptide.
In another embodiment, this test kit comprises: first and second populations of the haploid yeast cell of relative mating type.First population of haploid yeast cell comprises the test in test fused protein library and expresses vector library.Each test expression vector comprises the activation structure territory of one section encoding transcription incitant or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, and the joint sequence of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.Second population of haploid yeast cell comprises a target expression vector.This target expression vector codes is not by the activation structure territory or the DNA binding domains of the expressed activating transcription factor in test expression vector library; And the target sequence of a section encode target protein or peptide.First or second population of haploid yeast cell includes a reporter gene construct, and it comprises the reporter gene under the control of transcribing that is expressed in activating transcription factor.
Randomly, second population of haploid yeast cell comprises a plurality of target expression vectors.Each target expression vector codes is not by the activation structure territory or the DNA binding domains of the expressed activating transcription factor in test expression vector library, and the target sequence of a section encode target protein or peptide.First or second population of haploid yeast cell includes a reporter gene construct, and it comprises the reporter gene under the control of transcribing that is expressed in activating transcription factor.
According to above-described any composition, method and test kit are by the diversity preferred 10 of the first and/or second coded polypeptide subunit of first and second nucleotide sequences in the expression vector library 3-10 8, more preferably 10 4-10 8, most preferably 10 5-10 8
Equally according to above-described any composition, method and test kit are by the coded fusion rotein qualitative diversity in expression vector library preferably at least 10 6-10 18, more preferably at least 10 9-10 18, most preferably at least 10 10-10 18
Equally according to above-described any composition, method and test kit, the diversity of the first and second polypeptide subunits each can be derived from independently be not expressly to target peptide or protein and the library of the precursor sequence that designs.
Equally according to above-described any composition, method and test kit, the diversity of the first and second polypeptide subunits randomly is not to be derived from one or more known protein that combines with target peptide or protein.
Equally according to above-described any composition, method and test kit, the diversity of the first and second polypeptide subunits is not to produce by one or more known protein that combine with target peptide or protein of mutagenesis.
Equally according to above-described any composition, method and test kit, the first and second polypeptide subunits can be the subunits of the polymer protein that makes a variation in a polymer protein library of its sequence.The example of polymer protein includes, but are not limited to, growth factor receptors, TXi Baoshouti, cytokine receptor, Tyrosylprotein kinase associated receptor and MHC protein.
Equally according to above-described any composition, method and test kit, first nucleotide sequence can be at 5 ' end with respect to second nucleotide sequence.First nucleotide sequence in the expression vector library comprises the encoding sequence of one section antibody heavy chain variable region, and second nucleotide sequence comprises the encoding sequence of one section antibody chain variable region.The source of the encoding sequence of heavy chain of antibody and variable region of light chain can be the people, non-human primates or rodent.Randomly, the source of the encoding sequence of light chain of antibody and variable region of heavy chain can be from one or more non-immune animals.Preferably, the source of the encoding sequence of light chain of antibody and variable region of heavy chain can be from people's tire spleen, lymphoglandula and peripheral blood cells.
Equally according to above-described any composition, method and test kit, the joint peptide of being expressed by the expression vector library passes fused protein, and basic conservative conformation is provided between the first and second polypeptide subunits, and described fused protein is expressed by the expression vector library.This can guard substantially by the sequence that makes the joint peptide and pass the library and be achieved.
Equally according to above-described any composition, method and test kit, the conformation that contains the fused protein of the first and second polypeptide subunits that connect by the joint peptide can be simulated the conformation of a single-chain antibody.This point can be achieved with the joint peptide sequence that 3 or 4 series connection repetition forms comprise the Gly-Gly-Gly-Gly-Ser peptide by selection.
Equally according to above-described any composition, method and test kit, the preferably long 30-120bp of the joint sequence in the expression vector library, more preferably long 45-102bp, most preferably long 45-63bp.Joint sequence in the expression vector library can randomly comprise the Gly-Gly-Gly-Gly-Ser[SEQ ID NO:76 of one section coding with 3 or 4 series connection repetition forms] nucleotide sequence of aminoacid sequence.
According to above-described any composition, method and test kit, each expression vector can further comprise the sequence of one section coding affinity labeling thing equally.The example of affinity labeling thing includes, but are not limited to, polyhistidine tag thing, poly arginine marker, glutathione-S-transferase, maltose binding protein, staphylococcal protein A,SPA marker, and EE-epi-position marker.
According to above-described any composition, method and test kit, described activating transcription factor can be the activating transcription factors with separable DNA combination and transcriptional activation domain equally.The example of activating transcription factor includes, but are not limited to, GAL4, GCN4 and ADR1 activating transcription factor.
Equally according to above-described any composition, method and test kit can be any reporter genes by the report protein of reporter gene coding, and this expression of gene shows a kind of unique genotypes or phenotype in a kind of cell.The proteinic example of this report comprises, but be not limited to beta-galactosidase enzymes, alpha-galactosidase, luciferase, β-uronic acid glucosides the enzyme of crawling, paraxin is acyltransferase, secretor type embryo alkaline phosphatase, green fluorescent protein, enhanced blue fluorescent protein, enhanced yellow fluorescence protein and enhanced cyan fluorescent protein.
The accompanying drawing summary
Accompanying drawing 1 is described and be can be used for the schema that the present invention screens the method for high-affinity antibody.
Accompanying drawing 2 is described an embodiment of the method that produces the expression vector libraries, and the expression vector library is via homologous recombination, and linear expression vector produces by sequentially V1 and V2 fragment being inserted into.
Accompanying drawing 3 is described an embodiment of the method that produces the expression vector libraries, and the expression vector library is via homologous recombination, is inserted into by comprising the segmental individual chip of V1 and V2 that linear expression vector produces.
Accompanying drawing 4A describes the embodiment that a kind of reorganization via the CRE/LoxP mediation increases the method for expression vector library complicacy.
Accompanying drawing 4B is described in a kind of distortion of the method described in the accompanying drawing 4A, and wherein two expression vector libraries comprise different nutrition marks.
Accompanying drawing 5 is described in an embodiment selecting the right a kind of method of protein-protein bound in the two-hybrid system, and in this two-hybrid system, the expression vector cotransformation that has AD and BD structural domain is in yeast.
Accompanying drawing 6 is described in an embodiment selecting the right a kind of method of protein-protein bound in the two-hybrid system, in this two-hybrid system, the expression vector that has AD and BD structural domain is introduced into the diploid yeast cell via the mating between two haploid yeast bacterial strains.
Accompanying drawing 7 is described in an embodiment selecting the right a kind of method of protein-protein bound in the single crosses system, and in this single crosses system, the expression vector that has the AD structural domain is transformed in the yeast.
Accompanying drawing 8 is described in an embodiment selecting the right a kind of method of protein-protein bound in the single crosses system, and in this single crosses system, the expression vector that has the AD structural domain is transformed in the yeast.
Accompanying drawing 9 is described in an embodiment selecting the right high throughput method of protein-protein bound in the two-hybrid system, and in this two-hybrid system, vector library and the expression vector library of carrying the target expression vector are expressed in test, and each is arranged in the porous flat plate.
Accompanying drawing 10 is described an a kind of embodiment of method, and this method is used for mutagenesis and further screens the clone who chooses selection from the primary screen of test protein, and described test protein is entrained by expression vector of the present invention.
Accompanying drawing 11 is described single chain variable fragment (scFv), the secondary structure of antibody fragment (Fab) and the antibody that is assembled into fully.
Accompanying drawing 12 is described the example of antibody function expression system, and described antibody is that the method for the application of the invention is selected.
Accompanying drawing 13 is described the plasmid figure of pACT2, and the method for modifying pACT2 is with (G 4S) 4Joint is incorporated in this plasmid.
Accompanying drawing 14 is illustrated in and analyzes the scFv library in the yeast two-hybrid system.21 bacterium colonies (swimming lane 1-21) are chosen from the scFv library that is implemented in pACT2 double cross carrier randomly altogether.The preparation plasmid DNA.Carry out PCR by the primer that uses flank to have multiple clone site and reach electrophoretic analysis ScFv insertion fragment (about 850bp size) on sepharose subsequently.The M road is the 100bp marker.
Accompanying drawing 15 is represented the specificity analyses that anti--IL8 scFv clones.Utilize pGBK-IL8 to screen as bait, screening obtains totally 22 beta-galactosidase enzymes male clones from the scFv library.From these scFv clone, extract plasmid, then respectively with pGBK-IL8 or control vector pGBK-Lam and pGBKT7 cotransformation in the yeast AH109 cell (being arranged in row).Transformant is inoculated on the SD/-LW substratum, and analyzes betagalactosidase activity.Being cloned in the post top with the interactional scFv of hIL-8 specificity marks with (+).
Accompanying drawing 16 shows three special scFv clones' that represent accompanying drawing 15 described 16 clones DNA and aminoacid sequence.
The coimmunoprecipitation experiment of accompanying drawing 17 expression people IL-8 and its antibody.ScFv protein is expressed to merge at its carboxyl terminal in the periplasmic space of fused protein form at E.coli with HSV and 6xHis marker.They are used for the coimmunoprecipitation experiment then.A plate: the 1st road, all protein of pericentral siphon prepared product; The 2nd road is with the scFv of Ni-NTA purifying.The B plate: the 1st road, carry out the Western blot of total pericentral siphon prepared product with the antibody of anti-HSV marker.The C plate: at the Reactigel pan coating with Hil-8 (the 1st road), lamin C (the 2nd road), mouse p53 (the 3rd road), or do not have encrusting substance (the 4th road) mixes mutually with the anti-IL-8 of scFv (123-36 clone) then.After the washing, the antibody that uses anti-HSV marker is by western blot analysis bonded protein.The D plate: at the Reactigel pan coating with clone 123-36 (the 1st road), M8 (the 2nd road), M12 (the 3rd road), or do not have encrusting substance (the 4th road) mixes with hIL-8 under the condition that BSA exists then.After the washing, use the mouse monoclonal antibody of anti-hIL-8, by western blot analysis bonded protein.Hollow arrow indication scFv band.Solid arrow indication hIL8 band, the band of filled arrows indication may be the dimer of hIL-8.
The clone's of accompanying drawing 18 expression affinity maturations ONPG analyzes.Will be in yeast from the clone's (M8, M11 and M12) of anti-IL-8 scFv clone's 123-36 and affinity maturation thereof plasmid and pGBK-IL8 cotransformation.By quantitative ONPG analysis to measure betagalactosidase activity.The activity of beta-galactosidase enzymes shows that with respect to the mean value of cloning 123-36 with the parent multiple increases.Error bar is represented the standard error of three experiments.
Anti-IL-8 scFv clone 123-36 of accompanying drawing 19 expressions and affinity maturation clone's thereof aminoacid sequence contrast.
Accompanying drawing 20 is from the clone's of three affinity maturations of anti-IL-8 scFv clone 123-36 DNA and aminoacid sequence.
Accompanying drawing 21 is represented the complete human antibody of recombinant anti human IL-8 and the coimmunoprecipitation of people IL-8 by Western blot.ScFv is cloned the V of 123-36 HAnd V LThe constant region of people Ig γ 1 heavy chain and the N-end of λ constant region are cloned into respectively in the district.With the transfection of fully human antibodies construct in the COS cell.The ball (the 1st road) of end user IL-8 bag quilt or the ball (the 2nd road) that does not wrap quilt precipitate fully human antibodies from substratum.Similarly, ball (the 3rd road) precipitation of the IL-8 bag quilt substratum of the COS cell of analog carrier transfection.
Detailed Description Of The Invention
The invention provides new composition, kit and some effective methods, the method is for the preparation of extremely various test protein library, and screening is to target protein from these libraries in vivo, and peptide or DNA have high-affinity and specific protein. In a specific embodiment, the composition of the application of the invention, kit and method, can produce and screen in fact for the multifarious human antibody of the height of any target antigen library.
The invention provides a kind of general method and screen these different libraries of the test protein for single or multiple target protein or peptide.
The method comprises: express the test protein library in yeast cells, each test protein is a kind of fused protein, the first polypeptide subunit that it is made a variation in library by one section its sequence, one section its sequence is independent of the second polypeptide subunit of the first polypeptide subunit variation in library, and one section joint peptide that connects the first and second polypeptide subunits forms; Express one or more target fused proteins in the yeast cells of expressing test protein, each target fused protein comprises a target peptide or protein; With the yeast cells of selecting those expression reporters, warm protein is tested in the expression of described reporter and the warm protein combined together of target activates.
The test protein library can be any polymeric protein, wherein the subunit of the polymer protein that makes a variation in the test protein library for its sequence of the first and second polypeptide subunits.
In a preferred embodiment, the test protein library is an antibody library, and wherein the first and second polypeptide subunits are respectively the variable regions of antibody heavy chain variable region and light chain of antibody. The source of the coded sequence of light chain of antibody and variable region of heavy chain can be from the people, non-human primates or rodent.
From these antibody libraries, by screening,, for the library to single or multiple target antigens and antibody, especially in yeast, high-affinity and specific antibody have been selected to have. The method that produces monoclonal antibody with the XENOMOUSE  technology of the use hybridoma technology of routine and recent development is compared, and the invention provides a more effective and more economical method and screen human antibody completely in shorter time. More importantly, generation and screening antibodies library can be adopted high-throughput screening method in body at an easy rate.
Can use any method known in the art in vivo or produced in vitro test protein library. Invention provides a new method to produce in vivo and the screening expression vector library, these test proteins for single or multiple target molecule of described expression vector codes. These methods are that the homologous recombination by the intrinsic characteristic of utilizing yeast-under high horizontal efficiency is developed.
Figure one is the schema that the preferred embodiment of aforesaid method of the present invention is described in expression, and this method is used for producing and screening at yeast the height diverse libraries of strand human antibody (scFv).Such as figure one description, in yeast cell, made up the scFv library of high complexity.Particularly, by the coding V HAnd V LSequence and comprise between the Yeast expression carrier in homologous recombination site and carry out direct homologous recombination, with heavy chain and variable region of light chain (V HAnd V L) the cDNA library transfer in the Yeast expression carrier.The expression that obtains is carried and is called the scFv expression vector.This primary antibody library can reach preferred 10 6-10 12Diversity, more preferably 10 7-10 12, most preferably 10 8-10 12
The complexity in the primary antibody library that produces in yeast can be via site-specific homologous recombination, and " chain reorganization " and further increase are carried out in for example CRE/LoxP reorganization between light chain in being contained in the scFv expression vector or the sequence of heavy chain.By between two scFv carriers, exchanging V HOr V LSequence, after the mutagenesis scFv sequence, this antibody library can reach 10 in the primary antibody library 18Complexity.Therefore, so the diversity of the antibody library of gained can be preferably 10 9-10 18, more preferably 10 10-10 18, most preferably 10 12-18
The primary antibody library of high complexity can be used in various application widely.Especially, this library can be used for screening at various targets widely, as fixed antigen or with the complete human antibody of the antigen library of disease-related.
The interactional screening of antigen-antibody can utilize the yeast two-hybrid method to be achieved very easily in yeast.For example, scFv expression vector library is incorporated in the yeast cell.The expression of this scFv antibody library in yeast cell produces scFv and merges (test) protein library, and each fused protein comprises the activation structure territory (AD) of scFv and activating transcription factor.Also can modify yeast cell and comprise the DNA-binding domains of activating transcription factor and the recombinant fusion protein of target antigen with expression.Also can modify yeast cell to express reporter gene, it is expressed under the control of special DNA binding site.When the scFv antibody from the library combined with target antigen, AD and BD were very approaching, thereby caused the transcriptional activation of the reporter gene in the BD bonded specific DNA binding site downstream.What be worth one is, scFv expression vector library can comprise the BD structural domain, and adorned yeast cell to express comprises the fused protein of AD structural domain and target antigen.
These scFv expression vectors can be by being introduced in the yeast cell in the cotransformation diploid yeast cell or by carry out direct mating between two bacterial strains of haploid yeast cell.For example, comprise V HAnd V LThe scFv expression vector in library can yeast plasmid with the expression vector that comprises target antigen or the form of bacterium-yeast shuttle plasmid be used for cotransformation diploid yeast cell.Alternatively, two bacterial strain haploid yeast cells (as αWith aThe yeast cell of type bacterial strain), each comprises scFv expression vector and target antigen expression vector respectively, and these two bacterial strains are carried out mating comprises two kinds of expression vectors with generation diploid yeast cell.Preferably, the haploid yeast bacterial strain that comprises the target antigen expression vector also comprises the reporter gene that is positioned at specific DNA binding site downstream.
Based on cell phenotype or other selectable mark, select to comprise the yeast clone that target antigen is had the scFv antibody of binding affinity.These primary antibodies clones' (primary antibodyleads) the plasmid of encoding can be separated and further be characterized.
Coding primary antibody clone's V HAnd V LSequence can be able to mutagenesis to produce the secondary antibodies library external.V HAnd V LSequence is by " poison " PCR (or fallibility PCR), and the at random any or site-directed mutagenesis method (or cassette mutagenesis) of DNA reorganization or other can be by random mutagenesis.At V HAnd V LAfter district's mutagenesis, the complexity in secondary antibodies library can reach 10 4Or it is higher.Generally, the compound diversity or the complexity (comprising the anti-library of primary and secondary) of whole antibody libraries of the method for the application of the invention generation can reach 10 18Or it is higher.By using above-mentioned yeast two-hybrid method or other screening methods, in vivo or in the external further screening secondary antibodies library with the antibody of high-affinity in conjunction with target antigen.
An advantage of the present invention is that the antibody of nature in whole generations, selection and the process simulation mammalian body of optimizing huge and various antibody library changes and ripening process.In the affine sophisticated natural process of antibody, antibody increases after immunity as time goes by and progressively to its antigenic avidity, mainly is the accumulation because of point mutation, the especially accumulation of point mutation in the encoding sequence of heavy chain and variable region of light chain.
According to the present invention, by reorganization and mutagenesis V HAnd V LLarge-scale variation has been realized in the chain library, described V HAnd V LThe chain library comprises natural originating with artificial or synthetic derived from multipath source.V in the body HAnd V LHomologous recombination has been simulated assembling from different encoding antibody V with the elementary library that produces single-chain antibody HAnd V LThe natural process of antibody gene in gene fragment storehouse.Because this method preferably utilizes yeast cell to implement, yeast homologous recombination feature is efficiently assembled V to promoting in this body HAnd V LBe particularly useful.
The quick breeding potential and the easy handling of yeast cell makes the process of " molecular evolution " shorten widely than the affine sophisticated natural process of antibody in Mammals.Therefore, can in yeast cell, produce than the efficient of more much lower cost of existing method and Geng Gao and directly screening have high multifarious antibody library, described existing method is for example required great effort and the humanization of the mouse resource monoclonal antibody that multistep is rapid, and described mouse resource monoclonal antibody is by using the conventional hybridization technology (" protein designs again ") or the XENOMOUSE of exploitation recently TMTechnical point from.
According to the method for " protein designs again ", there is specific mouse resource monoclonal antibody to modify or " humanization " attempts to transform mouse source antibody to specific antigen external, but keep original antigen-binding specificity with human counterpart more near it.Riechmann etc. (1988) Nature332:323-327.This humanization is crossed range request genetic engineering a large amount of, system and is handled murine antibody, and this will spend the several months, and (if not the several years) finishes.In addition, a large amount of modifications of mouse resource monoclonal antibody skeleton can cause the reduction of specificity and avidity.
By contrast, by using the method for this discovery, there is the complete human antibody of high-affinity from yeast cell, directly to screen and to separate to specific antigen or antigen and obtains, and need not to carry out the modification of multidigit point, also can not sacrifice the specificity and the avidity of selected antibody through antagonist.
By setting up transgenic mice strain, XENOMOUSE TMTechnology has been used to produce the complete human antibody with high-affinity, and described transgenic mice is produced human antibody and but suppressed endogenous mouse Ig heavy chain and light chain gene seat.Yet, breed the transgenic mice of these strains and select the antibody of high-affinity to need for a long time.The antigen that is used for producing human antibody library must be taken as exotic antigen can produce immune response by mouse; By using this technology, in mouse, can not select at the antibody that does not have immunogenic target antigen.
On the contrary, the method for the application of the invention, not only can be in yeast cell more efficient and produce the antibody library of high diversity and complexity economically, and do not consider its immunogenicity, can also in fact screen at any target protein and target peptide.According to the present invention, any target protein or peptide can be expressed as the fused protein of the DNA binding domains (or activation structure territory) with activating transcription factor, and can be at antibody library in yeast two-hybrid system and selected.And, a plurality of target protein or antigen library can be in porous flat plate array, and screen with high-throughput and automatization mode antagonist library.
Other method of utilizing transgenic goat and chicken to produce antibody is equally compared, method of the present invention can be used for screening and producing a large amount of human antibodies fully and need not to involve the serious rules and regulations problem of using transgenic animal, and relates to by the safety problem of the containment of the transgenic animal of recombining virus carrier infection.
The method of the application of the invention, the steps necessary in many traditional construction cDNA libraries can be omitted.For example, time-consuming hard again connection and subclone cDNA library can use conventional homologous recombination and/or site-specific being binned in the yeast via direct reorganization or " crack filling " (" gap-filling ") method to be omitted to the step of expression vector.Run through the whole process that antibody library makes up, coding V HAnd V LDna fragmentation can need not to be integrated directly in the linearizing Yeast expression carrier by homologous recombination by means of a large amount of subclone steps.
Compare in the method for in-vitro screening high-affinity antibody with using display technique of bacteriophage, method of the present invention provides the effective ways at the intravital screening high-affinity antibody of eukaryotic cell.By using display technique of bacteriophage, the heavy chain of people Ig and the variable region of light chain are cloned, and sort merge is expressed again, and in human Fab or the scFv pieces of filobactivirus surface display for combining with antigen.Winter etc. (1994) Ann.Rev.Immunol.433-455; With (1997) Current Opinion in Biotechnol.8:503-508 such as Rader.People source Fab to phage display screens it in external ability in conjunction with the fixed target antigen then, promptly is called the method for " the biological elutriation ".When needing the human antibody of high-affinity, the phage display method may have problems, may be because the non-natural conformation of surface display antibody and/or select on a large scale or the elutriation process is carried out under the conditions in vitro that differs greatly with the Human Physiology condition.On the contrary, the method for the application of the invention is selected these antibody to the binding affinity of target antigen in vivo based on antibody.Antibody is at cell inner expression, experience protein folding and combining with its target antigen under natural surroundings.Therefore, the antibody that screens of the method for the application of the invention more has dependency by the selected antibody of external elutriation than those on functional.1. expression vector of the present invention library.
The invention provides an expression vector library.In one embodiment, provide a Yeast expression carrier library.Each Yeast expression carrier in the library comprises the first nucleotide sequence V1 of one section coding first polypeptide subunit; The second nucleotide sequence V2 of one section coding second polypeptide subunit, and the joint sequence L of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.The first polypeptide subunit, the second polypeptide subunit and joint expression of polypeptides become a single fused protein.In addition, each makes a variation independently in the expression vector library for V1 and V2.
According to this embodiment, Yeast expression carrier can be 2 μ plasmid vectors, preferably comprises the yeast-bacterium shuttle vectors of bacterium replication orgin.
In a distortion of this embodiment, V1 is antibody V HThe encoding sequence of variable region of heavy chain.V2 is antibody V LThe encoding sequence of variable region of light chain.
Joint sequence L can have specific sequence, perhaps can make a variation in the Yeast expression carrier library.If L makes a variation in the library, its sequence polymorphism does not preferably change the conformation that obtains of fused protein basically.
When V1 and V2 expressed in yeast cell (for example from the Saccharomycescerevisiae bacterial strain) by Yeast expression carrier, the fused protein that comprises V1 and V2 polypeptide fragment adopted one or more conformations through a protein folding procedure.Peptide sequence by joint sequence L coding is folding by providing flexible hinge to promote between V1 and V2 polypeptide fragment.The suitable binding site that the conformation that is adopted by fused protein can have special target protein.For example, fused protein can be the target antigen bonded single-chain antibody scFv special with it.
In another embodiment, provide an expression vector library.Expression vector comprises the activation structure territory AD of an encoding transcription incitant or the transcription sequence of DNA binding domains BD in the library; The first nucleotide sequence V1 of one section coding first polypeptide subunit; The second nucleotide sequence V2 of one section coding second polypeptide subunit; And the joint sequence L of the joint peptide of a section encode connection first nucleotide sequence and second nucleotide sequence.The activation structure territory of activating transcription factor or DNA binding domains, the first polypeptide subunit, the second polypeptide subunit and joint expression of polypeptides become a single fused protein.In addition, each makes a variation independently in the expression vector library for V1 and V2.
According to this embodiment, expression vector can be any gene transfer vector, as long as it can be incorporated into the expression vector library ideal position in the host cell, transforms such as passing through, and modes such as transfection or transduction are incorporated into expression vector in the host cell.Expression vector can be bacterium, phage, yeast, mammals or virus expression carrier, preferred yeast expression vector, more preferably 2 μ plasmid ferment expression vectors.
According to this embodiment, the activating transcription factor sequence can be positioned at 5 ' end with respect to first nucleotide sequence, joint sequence and second nucleotide sequence equally.Alternatively, the activating transcription factor sequence can be positioned at 3 ' end with respect to first nucleotide sequence, joint sequence and second nucleotide sequence.
In a distortion of this embodiment, V1 is antibody V HThe encoding sequence of variable region of heavy chain.V2 is antibody V LThe encoding sequence of variable region of light chain.Randomly, AD is the activation structure territory of yeast GAL4 activating transcription factor; With BD be the DNA binding domains of yeast GAL4 activating transcription factor.
Connecting header sequence L can have a specific sequence, perhaps makes a variation in the yeast expression library.
When V1 and V2 express in the yeast cell cell of Saccharomycescerevisiae bacterial strain (for example from) by Yeast expression carrier, comprise AD, V1-and the segmental fused protein of V2-encoded polypeptides adopt one or more conformations through a protein folding procedure.By the peptide sequence of joint sequence L coding equally by intersegmental to provide flexible hinge to promote folding at V1-and V2-encoded polypeptides sheet.By AD, the suitable binding site that the conformation that the segmental fused protein of V1 and V2-encoded polypeptides adopts can have special target protein.For example, AD, V1-and the segmental fused protein of V2-encoded polypeptides can be the target antigen bonded single-chain antibody scFvs special with it.In case AD and BD structural domain in vivo or external use double cross method reorganization form active activating transcription factor, what the AD structural domain of fused protein can activated gene transcribes.
According to above-mentioned any library, can preferred 10 by the diversity of the first and/or second polypeptide subunit of the V1 in the expression vector library and V2 coding 3-10 8, more preferably 10 4-10 8, most preferably 10 5-10 8
According to above-mentioned any library, can be preferably at least 10 by the diversity of the first and/or second polypeptide subunit of the V1 in the expression vector library and V2 coding 3, more preferably at least 10 4, most preferably 10 5
Same according to above-mentioned any library, by the fusion rotein qualitative diversity preferred 10 of expression vector library coding 6-10 18, more preferably 10 9-10 18, most preferably 10 10-10 18
Same according to above-mentioned any library, it is one or more known to target peptide or proteinic protein that the diversity of the first and second polypeptide subunits does not need to come from mutagenesis.For example, the first and second polypeptide subunits need one from mutagenesis, known antibody (as Herceptin  antibody) in conjunction with target peptide or protein (Her-2 acceptor).This point has reflected brand-new ability of the present invention, identify from a sequence library at random that promptly new protein-protein bound is right, and be not to know a protein that combines with target in advance, form the library of mutant then from known conjugated protein.
Same according to above-mentioned any library, the preferably long 30-120bp of the joint sequence L in the expression vector library, more preferably long 45-102bp, most preferably long 45-63bp.Expression vector library internal connection sequence preference comprises the nucleotide sequence of 3 or 4 series connection of one section coding multiple aminoacid sequence Gly-Gly-Gly-Gly-Ser.
Same according to above-mentioned any library, the joint peptide of being expressed by the expression vector library preferably passes the fused protein of being expressed by the expression vector library, and basic conservative conformation is provided between the first and second polypeptide subunits.For example, with 4 series connection repetition form (G 4S) 4The joint peptide Gly-Gly-Gly-Gly-Ser that [SEQ ID NO:75] exists provides in the variable region that basic conservative this of scFv antibody protected corresponding complete antibody its antigen binding site.
The key element of expression vector is described in detail as follows in the library.1). the skeleton of expression vector.
Expression vector of the present invention can be based on the carrier of any kind, as long as it can conversion, transfection or the host cell of transduceing.Expression vector comprises V1 sequence library and V2 sequence library, preferably comprises the sequence in the activation structure territory (AD) of one section encoding transcription incitant.Acceptor carrier can be a plasmid, and phage or virus vector as long as it can duplicate, maybe can be relayed to the library of V1 and V2 sequence the desired position of host cell in external or host cell.The example of host cell includes, but are not limited to, bacterium (for example intestinal bacteria, subtilis etc.), yeast, animal, plant and insect cell.
In a preferred embodiment, expression vector is based on yeast plasmid, especially is derived from Saccharomyces cerevisiae.Behind transformed yeast cell, the foreign DNA of coding V1 and V2 sequence can be absorbed by cell and then express in the cell after conversion.
More preferably, expression vector is yeast-bacterium shuttle vectors, and it can breed (1979) Proc.Natl.Acad.Sci.76:1035-1039 such as Struhl in intestinal bacteria or yeast.The inclusion of e. coli plasmid dna sequence such as PBR322 are easy to quantitatively prepare carrier DNA in intestinal bacteria, and therefore auxiliary transformed yeast effectively.
The type that can be used as the yeast plasmid carrier of shuttle vectors can be replicating vector or integrated carrier.Replicating vector can be independent of yeast chromosomal dna and mediate keeping of himself owing to there is the dna replication dna starting point of function.Integrating vector then rely on recombinate auxiliary duplication with chromosomal DNA and therefore assist in host cell recombinant DNA continue keep.Replicating vector can be based on the plasmid vector of 2 μ, and wherein the starting point of dna replication dna is from the endogenous 2 μ plasmids of zymic.Alternatively, replicating vector can be " self-replacation " (ARS) carrier, and the apparent starting point of wherein duplicating is derived from yeast chromosomal dna.Randomly, replicating vector can be kinetochore (CEN) plasmid, and except that above-mentioned wherein a kind of dna replication dna starting point, it also carries the known centric yeast chromosomal dna sequence that contains.
Annular or linear mode that carrier can seal are transformed in the yeast cell.Although have heritable stability, integrating vector is with the efficient of circular pattern transformed yeast of sealing not high (as every micrograms of DNA 1-10 transformant only).Carrier after the linearizing, with yeast chromosomal dna homologous dna sequence dna in have the free end, with higher efficient (100-1000 doubly) transformed yeast, and find the DNA that transforms be incorporated into usually with cleavage site homologous sequence in.Therefore, by with suitable restriction enzyme cut vector, may increase the efficient that conversion and target are decided chromosomal integration site.Integrate to transform the genetic modification that can be applicable to cereuisiae fermentum, as long as transformation efficiency is enough high, and the target DNA sequence of integrating is in the zone of not destroying for the metabolic essential gene of host cell.
The ARS plasmid, its have high copy number (making an appointment with each cell 20-50 copy) (Hyman etc., 1982), tend to least stable, and with per generation greater than 10% frequency and lost.Yet the stability of ARS plasmid can be strengthened by adhering to the kinetochore: there be 1-2 copy in plasmid each cell in kinetochore, but per generation only loses about 1%.
Expression vector of the present invention is preferably based on 2 μ plasmids.2 μ plasmids are arranged in nucleus, but with the heredity of non-mendelian mode.The cell of losing 2 μ plasmids has shown that the speed with the cell of per generation 0.001%-0.01% results from the haploid yeast population, and this population has the 2 μ plasmids that the average copy number of each cell is 50 copies.Futcher?&?Cox(1983)J.Bacteriol.154：612。The analysis of the different strains of S.cerevisiae has shown that plasmid is present in the most of bacterial strains of zymic and has comprised cereuisiae fermentum.2 μ plasmids are ubiquitous, but and have in fact the height genetic stability.
2 μ plasmids have a very special two-way dna replication dna starting point, and this is the essential element of all carriers based on 2 μ plasmids.This plasmid comprises four gene REP1, REP2, and REP3 and FCP, they are essential (1983) Cell 34:95 such as Jaysram to the stable maintenance of the high plasmid copy number of each cell.The protein of REP1 and its Transcription of REP2 genes encoding, these protein are by separating plasmid is stable guaranteeing when the cell fission with the REP3 locus common performance function that rises that interacts.At this on the one hand, the REP3 gene is stablized isolating cis acting locus and is worked as influencing plasmid, and similar on phenotype to the karyomit(e) kinetochore.An important feature of 2 μ plasmids is to exist two reverse dna sequence dnas to repeat (each long 559 base pair), and it is divided into ring molecule in the zone of two uniquenesses.Between inverted repeats intramolecularly reorganization causes the upset of a unique zone with respect to another unique zone, and produces the mixed population of two constitutional isomers of plasmid in vivo, is expressed as A and B.Two reorganization between oppositely repeating are mediated by the protein that is called the FCP gene, and flp protein can be recombinated at reverse iteron mediation high frequency.Think that this site-specific recombination event provides the mechanism that guarantees the plasmid copy number amplification.Murray etc. (1987) EMBO J.6:4205.
Expression vector can comprise intestinal bacteria replication orgin and intestinal bacteria antibiotics resistance gene again, to breed in bacterium and antibiotic-screening.Known have a plurality of intestinal bacteria starting points, comprises ColE1, pMB1 and pBR322.Preferably use the ColE replication orgin in the present invention.Known a lot of intestinal bacteria drug resistance gene comprises the resistant gene of ampicillin resistance gene, chloramphenicol resistance gene, tsiklomitsin.In a specific embodiments, in carrier, use ampicillin resistance gene.
The transformant that has V1 and V2 sequence can screen with different selection schemes.Described selection typically realizes in carrier DNA by having the gene integration that can distinguish phenotype.Be used under the zymic situation of transformation experiment chamber at carrier, prototroph gene such as LEU2, URA3 or TRP1 are generally used for replenishing auxotrophic damage among the host.Yet in order to transform cereuisiae fermentum and other industrial yeast, they usually are polyploids, and do not show auxotrophic demand, and it is essential utilizing and selecting the selective system of gene based on dominance.In this respect, the transformant that duplicates that has 2 μ plasmid vectors can be selected based on the expression of marker gene, and described marker gene mediates the resistance to following substances: microbiotic such as G418, hygromycin B and paraxin, or other toxic substance such as weedicide sulfometuron methyl, closely knit rhzomorph and copper.2) .V1 and V2 variable sequence
The first and second polypeptide subunits of being encoded respectively by V1 and V2 can be the subunits of any polymer protein.The sequence of polymer protein makes a variation in the library of polymer protein or in collecting.The example of polymer protein comprises, but is not limited to antibody, growth factor receptors, TXi Baoshouti, cytokine receptor, Tyrosylprotein kinase associated receptor and MHC protein.
In preferred embodiments, polymer protein is an antibody library, more preferably human antibody.For example, the first and second polypeptide subunits by expression vector library coding can be the variable region V of human antibody heavy chain HWith human antibody variable region of light chain V L
Coding human antibody V HAnd V LSegmental dna sequence dna can be at least 30 successive base pairs, their encode basically genes of immunoglobulin superfamily.A.F.Williams and A.N.Barclay (1989) " The Immunoglobulin Gene Superfamily ", inImmunoglobulin Genes, T.Honjo, F.W.Alt, and T.H.Rabbitts, eds., Academic Press:San Diego, Calif., 361-387 page or leaf.V HAnd V LThe most normal gene order coding of gene by people, non-human primates, birds, pig, ox, sheep, goat or rodents heavy chain and light chain.
Coding people antibody V HAnd V LCan there be many sources in segmental dna sequence dna library.For example, compile people's antibody V HAnd V LThe m RNA in library can be from from extracting immunity or non-immune animal and human's cell or the organ.Preferably, can make organ for example people's tire spleen and lymphoglandula.Peripheral blood cells from non-immune people also can be used.Blood sample can be originated from a plurality of donors or from blended blood from one donor.
Coding people antibody V HAnd V LSequence can utilize somely to Oligonucleolide primers, the cDNA by polymerase chain reaction (PCR) amplification people's heavy chain and light chain variable structural domain obtains and increases.Orlandi etc. (1989) Proc.Natl.Acad.Sci.USA 86:3833-3837. for example, blood sample can be from the healthy volunteer, and can separate the B lymph-node cell in blood sample.Can prepare RNA by following standard program.Cathala etc. (1983) DNA 3:329.By using reversed transcriptive enzyme from the RNA that is separated to, to prepare cDNA.
Alternatively, V HAnd V LEncoding sequence can be derived from the immunoglobulin gene or the gene of artificial rearrangement.For example, immunoglobulin gene can be by being V fragment and J fragment external will the kind, at V HFor connecting, the D fragment resets under the situation.V, D and J be segmental to be connected and can to have at random or the PCR primer in distinguished sequence zone is incorporated into artificial sequence or diversity and comes auxiliary the realization in the product by use.
By connecting V HAnd V LPolypeptide and form fused protein and be expressed as single-chain antibody, scFv.Typical scFv comprises the form with peptide bond, usually the V that is connected by transcribed spacer/joint peptide L HStructural domain and V LStructural domain.The joint peptide that joint peptide sequence L can encode and suitably design is as (Gly-Gly-Gly-Gly-Ser) 4[SEQ ID No:75] or similar joint peptide.This joint links to each other the carboxyl terminal in a V district with the aminoterminal in the 2nd V district, it can be V in proper order H-L-V LOr V L-L-V H
ScFv can comprise additional aminoacid sequence at its aminoterminal and/or carboxyl terminal.For example, single-chain antibody can comprise the junction fragment of the constant region that connects complete or full length antibody.Enough parts that the single-chain antibody of function comprises the immunoglobulin superfamily gene product are usually arranged to keep the characteristic that can combine with specific target molecule especially acceptor or antigen (epi-position).
Randomly, the variable sequence V1 in expression vector library and V2 also can be derived from polymer protein rather than antibody.V1 can be the different subunits of the polymer protein of non-antibody with V2, as membrane protein and cell surface receptor protein matter, as insulin receptor, MHC protein (as MHC I class and MHC II proteinoid), interleukin II (IL-2) acceptor that CD3 acceptor, TXi Baoshouti, cytokine receptor for example are made up of α, β and γ subunit, the Tyrosylprotein kinase associated receptor is Src for example, Yes, Fgr, Lck, Lyn, Hck and Blk.The Tyrosylprotein kinase associated receptor comprises SH2 and SH3 structural domain, and their parts are by interacting with transmembrane receptor protein matter or partly being fixed in this by covalent attachment lipid chain.For example, V1 and V2 can be respectively the mutagenesis sequences of the SH2 and the SH3 structural domain of Tyrosylprotein kinase associated receptor (as Src), and they are integrated in the expression vector of the present invention, and screen at this receptor various parts not.
It is worthy of note that it can be the protein library of single aggressiveness that V1 and V2 sequence also can come from different and various, and link to each other by joint sequence L.
The ability of method of the present invention is reflected at V1 with versatility and the V2 sequence need not by any way based on the known protein sequence that combines with target.On the contrary, V1 and V2 can be from any sources, can have and target or one or more known guiding protein matter in conjunction with target diversity independently fully mutually.3). target protein and target peptide
The target fused protein can comprise any that can be expressed or be present in target protein or target peptide in the host cell in addition.Target protein can be the member of protein or peptide library, for example people ESTs set, the total library of people ESTs, structural domain structure set (for example zinc finger protein structural domain), or the peptide library of completely random.
For example, target protein or target peptide can be the antigen with disease-related, for example TSA such as B cell idiotype, the CD20 on the Malignant B cell, CD33 on the leukemia protoblast and the HER2/neu on the mammary cancer.Antibody at these antigen selection can be widely used in various treatments and diagnosis, for example by direct administration antibody itself or with radio isotope or cytotoxic drug bonded antibodies for treating cancer, be used to relate to combined therapy, or be used for radiotherapy linked together antibody and chemotherapeutics Combined Preparation.
Alternatively, target protein can be a growth factor receptors.The example of somatomedin comprises, but is not limited to Urogastron (EGFs), transferrin, rhIGF-1, transforming growth factor (TGFs), interleukin 1 and interleukin II.For example, in the elementary tumour of various human epidermis, find the EGF acceptor of high expression level.Found in cancer cells alpha mediated self the secretion stimulation channels of TGF-.Confirmed some mouse source clonal antibody can with the EGF receptors bind, block ligand combines with the EGF acceptor, and cultivate and heteroplastic transplantation model (xenograft medels) in the various human carcinoma cell lines' of inhibition breeding.Mendelsohn and Baselga (1995) " Antibodies to growth factors and receptors "; In Biologic Therapyof Cancer, 2nd Ed., JB Lippincott, Philadelphia, 607-623 page or leaf; Leget and Czuczman (1998) " Use of rituximab, the new FDA-approved antibody " .Curr Opin.Oncol.10:548-551; And Goldenberg (1999) " Trastuzumab; arecombinant DNA-derived humanized monoclonal antibody, a novelagent for the treatment of metastatic breast cancer.Clin.Ther.21:309-318).Therefore, the method for the application of the invention can be used for the treatment of various cancers at the selected complete human antibody of these somatomedins.
Target protein also can be cell surface proteins or the acceptor relevant with coronary artery disease, and as platelet glycoprotein lib/IIIa acceptor, autoimmune disease is CD4 for example, the lipid A zone of CAMPATH-1 and gram negative bacterium lipopolysaccharides.The humanized antibody of anti-CD4 in clinical trial, be used for the treatment of suffer from Alibert's disease (mycosis fungoides), the patient of pustular psoriasis,generalized, serious psoriasis (severe psorisis) and rheumatoid arthritis.The rheumatic arthritis that has been used for the treatment of refractory at the antibody of CAMPATH-1 by test clinically.Therefore, the method of the application of the invention can be used for the treatment of various autoimmune diseases (Vaswani etc. (1998) " Humanized antibodies aspotential therapeutic drugs " Annals of Allergy, Asthma andImmunology 81:105-115) at the selected antibody of these somatomedins; Inflammation (Present etc. (1999) " Infliximab for thetreatment of fistulas in patients with Crohn ' s disease " N Engl J Med.340:1398-1405); With immunological rejection (Nashan etc. (1999) " Reduction of acute renal allograft rejection by daclizumab.Daclizumab Double Therapy Study Group ", the Transplantation 67:110-115 in migration process.
Target protein or target peptide also can be protein or the peptides with humans allergic's disease-related, as those inflammatory mediator protein such as interleukin 1 (IL-1), tumour necrosis factor (TNF), leukotriene receptor and 5-lipoxidase and adhesion molecule such as V-CAM/VLA-4).In addition, Ig E also can be used as target antigen, because Ig E is to play important effect in super quick transformation reactions of hair style such as the asthma in the I type.It is relevant with the severity of the especially asthma of disease that the level that research has shown total serum Ig E is tended to.Burrow etc. (1989) " Association of asthma with serum IgElevels and skin-test reactivity to allergens " NewEngl.L.Med.320:271-277.Therefore, the method of the application of the invention is used in the level that reduces IgE in the treatment anaphylactic disease process at the selected complete human antibody of IgE, or blocking-up IgE and mastocyte and combining of basophilic granulocyte and normal immunologic function is not had substantial influence.
Target protein also can be the surface or the core protein of virus, and it can be used as the immune response that antigen causes the host.The example of these virus proteins includes, but are not limited to glycoprotein (or surface antigen such as GP120 and GP41) and capsid protein (or structural protein such as P24 albumen); Surface antigen of first, second, third, fourth or penta type liver viroid or core protein (as the little hepatitis B surface antigen(HBsAg) (SHBsAg) of hepatitis B virus and the core protein NS3 of hepatitis C virus, NS4 and NS5 antigen); Glycoprotein of respiratory syncytial virus (RSV) (G albumen) or fusion rotein (F albumen); The surface of hsv HSV-1 and HSV-2 and core protein are (as from the glycoprotein of HSV-2-D).For example, developed the infection that humanized monoclonal antibody is used to prevent respiratory syncytial virus (RSV).Storch(1998)“Humanized?monoclonal?antibody?for?prevention?ofrespiratory?syncytial?virus?infection”Pediatrics.102：648-651。
Target protein also can be the product of tumor suppressor gene that has lost the sudden change of tumor suppression function, and can make cell more responsive for cancer.Tumor suppressor gene is energy cell growth inhibiting and mitotic cycle, thereby prevents the gene of neoplastic development.The sudden change of tumor suppressor gene (mutions) can cause cell to ignore the element of one or more inhibition signal networks, overcomes cell cycle chechpoint and causes the Be Controlled cell growth-canceration of two-forty.The example of cancer suppressor gene includes, but are not limited to DCP-4, NF-1, NF-2, RB, p53, WT1, BRCA1 and BRCA2.
DPC-4 is relevant with carcinoma of the pancreas, and participates in suppressing fissional tenuigenin path.NF-1 a kind of protein that suppresses Rcos-tenuigenin repressible protein matter of encoding.NF-1 is relevant with myeloid leukemia with neural neurofibroma and pheochromocytoma.A kind of and the neural meningioma of NF-2 coding, schwanoma, the relevant nucleoprotein of ependymoma.RB coding pRB albumen, the nucleoprotein of the main inhibitor of a kind of cell cycle.RB and retinoblastoma and osteocarcinoma, bladder cancer, small cell lung cancer and breast cancer related.In various cancers, find the sudden change of p53 or do not have function.WT1 is relevant with the wilms' tumor of kidney.BRCA1 is relevant with mammary cancer and ovarian cancer, BRCA2 and breast cancer related.Therefore, the method for the application of the invention can be used for blocking this gene product and other protein in tumor invasion and development path or the interaction of biochemical at the selected complete human antibody of tumor suppressor gene product of sudden change.1. the structure in expression vector of the present invention library
Above-mentioned expression vector library can be used various recombinant DNA technologies and be made up.The invention provides the method in new these expression vector libraries of effective structure, described expression vector library in vivo or externally have high V1 and a V2 diversity.
Method provided by the present invention is to utilize yeast cell intrinsic ability to promote homologous recombination with high efficient.In yeast the mechanism of homologous recombination with and use and to be summarized as follows.
Yeast Saccharomyces cerevisiae has a cover intrinsic genetic mechanism and carries out intracellular efficient homologous recombination.Believe that this mechanism helps the karyomit(e) reparation of yeast cell, be called breach reparation or breach traditionally again and fill.Utilize this mechanism of breach filling efficiently, sudden change can be incorporated into the specific site of yeast genes group.For example, the carrier that has a mutator gene comprises two sections sequence fragments with 5 ' and 3 ' open reading-frame (ORF) (ORF) sequence homology of the gene of desiring to interrupt or suddenling change.This plasmid also comprises a positive selectable marker, as trophicity enzyme allelotrope (as ura3), or antibiotic resistance mark such as Geneticin (g418), they are at these two sections homologous sequence flanks.This plasmid is transformed in the yeast cell after linearizing.The homologous recombination between two homologous recombination sites by plasmid and yeast genes group, carry out the mutual exchange of DNA content between the wild type gene of yeast genes group and mutator gene (comprising selectable marker gene), the flank of described wild-type and mutator gene is connected with two homologous sequence fragments.By screening positive nutrition mark, the yeast cell of survival will be lost the primary wild type gene and the gene that obtains to suddenly change.Pearson BM, Hernando Y and Schweizer M, (1998) Yeast 14:391-399.This mechanism has been used to be used for functional genome research at all 6000 yeast genes or ORF generation systematic mutation.Because this exchange is mutual, similarly method also successfully with the fragment cloning of yeast genes group in plasmid vector.Iwasaki.T, Shirahige K, Yoshikawa H and Ogasawara N, Gene 1991109 (1): 81-87.
By using homologous recombination in yeast, gene fragment or synthetic oligonucleotide also can be cloned in the plasmid vector and be need not Connection Step.In this type of is used, obtain target fragment by pcr amplification (or by using traditional restriction digest primary cloning vector) usually.In pcr amplification, two sections weak points with plasmid vector homologous sequence be added in target fragment 5 ' and 3 ' end.This can realize by using a pair of PCR primer that is combined with the sequence of interpolation.Described plasmid vector comprises that typically positive selectable marker such as nutrition selects enzyme allelotrope such as ura3, or antibiotics resistance mark Geneticin (g418) for example.And the target fragment homologous homologous sequence of pcr amplification between by unique restricted cutting with this plasmid vector linearizing, thereby produce artificial " breach " at this place, point of contact.Linearizing plasmid vector and flank are connected with target fragment cotransformation with plasmid vector homologous sequence in the yeast host bacterial strain.Yeast can be discerned two carriers and the intersegmental homologous sequence of target sheet, and by promote the mutual exchange of DNA content in the breach homologous recombination.As a result, the target fragment is inserted into automatically in the carrier and need not external connection.
There is Several Factors can have influence on the efficient of zymic homologous recombination.The efficient of breach reparation and two ends bacterium have the length of homologous sequence of linearized vector and target gene relevant.Preferably, 30 base pairs of the minimum needs of the length of homologous sequence, 80 base pairs then can reach almost optimum.Hua, S.B. etc. (1997) " Minimum length of sequence homology required for invitro cloning by homologous recombinaion in yeast " Plasmid38:91-96.In addition, the mutual exchange between carrier and gene fragment is the sequence-dependent of strictness, does not promptly cause frameshit in such clone.Therefore, the feature of breach reparation clone's this uniqueness guarantees efficient and accurately inserts gene fragment.So high efficient can be cloned into two or three target fragments in the identical carrier in a step of converting synchronously.Raymond K., Pownder T.A. and Sexson S.L., (1999) Biotachmiques 26:134-141.Can keep this characteristic of accuracy of sequence described target gene can be cloned in expression or the fusion vector by homologous recombination and directly study function.So far, existing many reports utilize homologous recombination to carry out application functional or diagnosis.El-Deiry W.W. waits (1992) Nature Genetics1:45-49, PNAS 94:2449-2453 such as 1992 (for p53) and Ishioka C, 1997 (for BRCA1 and APC).
By using homologous recombination also can in yeast, make up the gene fragment library.For example, human brain cDNA is built into a double cross fusion library in carrier pJG4-5.Guidotti E and ZeRvos A.S. (1999) " In vivo construction of cDNA library for use inthe yeast two-hybrid systems " Yeast 15:715-720.Reported that totally 6000 pairs of PCR primers 6000 known yeast ORFs that are used to increase are used for total yeast genes histone matter repercussion study.Hudson, J.Jr waits (1997) Genome Res.7:1169-1173.The comprehensive comprehensive protein-protein interaction analysis that Uetz etc. carry out in Saccharomyces cerevisiae.Netz etc. (2000) Nature 403:623-627.By using the protein-protein interaction collection of illustrative plates of comprehensive systematic study budding yeast, with interaction in detection double cross in all possible combination between the yeast protein.Ito etc. (2000) Proc.Natl.Acad.Sci.USA.97:1143-1147.McCraith S., Holtzman T., Moss B., and Fields, S. (2000) Proc.Natl.Acad.Sci.USA.97:4879-4884 has studied the genome protein linkage map of vaccinia virus.
According to the present invention, V1 and V2 sequence are introduced in the expression vector by directly carry out homologous recombination in yeast cell.1) by in yeast, carrying out two independently homologous recombination, V1 and V2 are cloned in the expression vector with the form of isolated fragment
In an embodiment of the method for setting up vector library,, the form of V1 and V2 sequence isolated fragment is cloned in the expression vector by in yeast, carrying out two independently homologous recombination.
This method comprises:
A) following substances is transformed into yeast cell i) at the linearizing Yeast expression carrier in linearizing first site, it has 5 '-and 3 '-end sequence; Ii) linear, the double-stranded first insertion nucleotide sequence library, each first insertion sequence comprises the first nucleotide sequence V1 of the first polypeptide subunit of encoding, at 5 ' of the end of first insertion sequence-and 3 '-flanking sequence, they respectively with in 5 ' of the linearizing carrier in the first linearizing site-and 3 '-terminal fully homology, thereby guarantee that homologous recombination can take place;
B) in transformed yeast cells, homologous recombination takes place between the carrier and first insertion sequence, make first insertion sequence be included in the carrier;
C) from transformed yeast cells, separate the carrier that contains first insertion sequence library;
D) will contain the carrier linearizing in first insertion sequence library in the second linearizing site, to produce 5 '-and 3 '-end sequence;
E) with the following substances transformed yeast cell:
I) the linearizing Yeast expression carrier that in step d), is produced and
Ii) linear, double-stranded second insertion nucleotide sequence library, each second insertion sequence comprises the second nucleotide sequence V2 of the second polypeptide subunit of encoding, at 5 ' of the end of second insertion sequence-and 3 '-flanking sequence, they respectively with 5 ' of carrier-and 3 '-terminal in the abundant homology in linearizing second site, thereby guarantee that homologous recombination can take place; With
F) in transformed yeast cells, between the linearizing Yeast expression carrier in the second linearizing site and second insertion sequence, carry out homologous recombination, make second insertion sequence be incorporated in the expression vector, and first and second nucleotide sequences are linked to each other by joint sequence L.
In this embodiment, expression vector is the first polypeptide subunit, second polypeptide subunit, and the joint expression of polypeptides is single fused protein.Equally, first and second nucleotides sequences are listed in that each makes a variation independently in the expression vector library.
According to this embodiment, insert 5 ' of nucleotide sequence-or 3 '-flanking sequence preferably be about 30-120bp, more preferably from about 40-90bp, most preferably from about 40-80bp.
Figure two shows an embodiment of the method according to this invention.V1 is (as V H) and V2 (as V L) encoding sequence carry by isolating PCR fragment, in yeast, carry out two independently after the homologous recombination, sequentially be cloned in the expression vector.
Shown in figure two, the V1 fragment has 5 ' flanking sequence and 3 ' flanking sequence, exercise question respectively with 5 ' and 3 ' terminal homology of linearizing expression vector.When being incorporated into V1 fragment and linearizing expression vector in the host cell simultaneously, for example be transformed into yeast cell, " breach " that is produced during by linearized vector (site of linearizing for the first time) passes through to be inserted fragment by V1 and mend flat in the reorganization of the homologous sequence of 5 ' and 3 ' end of these two linear dsdnas.Homologous recombination through such has just produced the circular vectors library that is loaded with variable sequence V1.
Then this circular vectors library is cut in the second linearizing site, such as, in the site, downstream of V1.The V2 fragment has 5 ' and 3 ' flanking sequence, they with in 5 ' and 3 ' terminal homology of the linearizing expression vector in the second linearizing site.V2 fragment and linearizing expression vector are transformed into yeast cell.By secondary homologous recombination incident, the V2 fragment is inserted in the linearizing expression vector in the second linearizing site.As a result, produced the cyclic vector library that is loaded with variable sequence V1 and V2.
Add each flanking sequence that is connected on V1 and V2 encoding sequence and can preferably be about 30-120bp, more preferably be about 40-100bp, most preferably be about 60-80bp.
Zone between V1 and V2 sequence, i.e. joint sequence L, preferably long 30-120bp, more preferably long 45-102bp, most preferably long 45-63bp.Aminoacid sequence Gly-Gly-Gly-Gly-Gly-Ser (the G that this joint sequence optimized encoding exists with a plurality of series connection repetition forms 4S) [SEQ IDNo:76], more preferably coding (G 4S) 3-6, (G most preferably encodes 4S) 3-4Randomly, joint sequence can further comprise site-specific homologous recombination site, as the loxP site.
When V1 and V2 encoding sequence insert when containing the carrier of AD structural domain, preferred V1 and the segmental frame of V2 should can be readed over the AD frame of upstream.
The clonal expression carrier that depends on use, other characteristics for example affinity labelling and unique Restriction Enzyme recognition site can join in the expression vector, to detect for convenience and the V1 and the V2 sequence of purifying insertion.The example of affinity labelling comprises, but be not limited to the polyhistidyl sequence, poly arginine, glutathione S-transferase (GST), maltose binding protein (MBP), part staphylococcal protein A,SPA (SPA) and various immune labeled (as albumin A) and epi-position mark for example can be by the marks of the anti-peptide antibody identification of EE (Glu-Glu).
In a preferred embodiment, V1 and V2 sequence can be respectively variable region of heavy chain V HWith variable region of light chain V LEncoding sequence, these two variable regions are derived from human antibody library.For producing V1 and V2 encoding sequence from human antibody library, can produce compound people scFv cDNA gene pool by using methods known in the art, Sambrook, J. waits (1998) molecular cloning: laboratory manual.Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; And Ausubel, F.M. etc. (1995) Current Protocols in Molecular Biology " JohnWiley﹠amp; Sons, NY.
Total RNA is separable to originate down freely: the white corpuscle (mainly being the B cell) in the peripheral blood that is provided by not immune people for example is provided, or derives from people's tire spleen or lymphoglandula.For example synthesize article one chain of cDNA by using method as known in the art by the method for descriptions such as Marks.Manks etc. (1991) Eur.J.Immunol.21:985-991.
Particularly, design can be used to cDNA synthetic of initiation and heavy chain and light chain (V κ and V λ) antibody gene with the right mixture of constant region annealed heavy chain and light chain cdna primer.Embodiment 1 shows how to produce people V HAnd V LThe example in the cDNA library of gene.
Can be from V HAnd V LThe encoding sequence of cDNA amplified library people's heavy chain and light chain gene, described V HAnd V LThe cDNA library is that the PCR primer that is used in combination by use is to cause variable region of heavy chain V HAnd variable region of light chain V λ and Vk.Each PCR primer can comprise V H, the partial sequence of V λ or Vk and 5 ' or 3 ' flanking sequence are to promote at V HAnd V LFragment is carried out homologous recombination with between the clonal expression carrier.The example of these primers is listed in table 2.2) be cloned in the expression vector by homologous recombination in yeast with the V1 and the V2 of the assembling of individual chip form
In another embodiment of the method that produces the expression vector library, V1 and V2 sequence are formed into single dna fragmentation external by for example using PCR method.To comprise V1 then, the single fragment of V2 and L is cloned in the expression vector by homologous recombination in yeast.
This method comprises: linearizing Yeast expression carrier and linear and double-stranded insertion nucleotide sequence library are transformed into yeast cell, and described linearizing Yeast expression carrier has 5 ' in the linearizing site-and 3 '-end sequence.Each comprises the insertion sequence library: the first nucleotide sequence V1 of the first polypeptide subunit of encoding, and the second nucleotide sequence V2 of the second polypeptide subunit of encoding, and coding connects the joint sequence L of the joint peptide of the first and second polypeptide subunits.Each insertion sequence also is included in 5 ' and 3 ' flanking sequence of the end of insertion sequence.5 ' and 3 ' flanking sequence of insertion sequence respectively with 5 ' of linearizing Yeast expression carrier-and abundant homology of 3 '-end sequence, so that homologous recombination can take place.The homologous recombination that takes place between carrier and insertion sequence will cause that the inclusion of insertion sequence enters carrier in transformed yeast cells.
In this embodiment, the first polypeptide subunit, the second polypeptide subunit, and the joint expression of polypeptides becomes single fused protein.Equally, first and second nucleotides sequences are listed in that each makes a variation independently in the expression vector library.
According to this embodiment, 5 ' of this insertion nucleotide sequence-or 3 '-flanking sequence preferably be about 30-120bp, more preferably be about 40-90bp, most preferably be about 60-80bp.
Fig. 3 shows an embodiment according to method of the present invention.With pcr amplification V1 (as V H) and V2 (as V L) encoding sequence to produce isolating fragment, they are assembled into the single PCR fragment of carrying V1 and V2 sequence by PCR subsequently.Should single PCR fragment be cloned in the expression vector then by one step of homologous recombination.Detailed program description is in embodiment 1.
As shown in Figure 3, the V1 fragment has one section flanking sequence at its 3 ' end, the flanking sequence overlaid that itself and V2 segmental 5 ' are terminal.By the method for using overlapping PCR to cause, V1 and V2 fragment can be assembled into the single PCR fragment that has catenation sequence L to each other, and it is represented as the V1-L-V2 fragment.This single PCR fragment has 5 ' flanking sequence and 3 ' flanking sequence, they respectively with 5 ' of linearizing expression vector cleavage site-and 3 '-end sequence homology.When V1-L-V2 fragment and linearizing expression vector being introduced host cell when being transformed into yeast cell, " breach " that when the carrier linearizing, produces can by V1-L-V2 insert fragment mend flat, this be by these two linear dsdna molecules 5 '-and 3 '-terminal homologous sequence reorganization realize.By homologous recombination, produced the annular carrier library of containing variable sequence V1 and V2.
Add 5 ' of V1 and V2 encoding sequence-and 3 '-terminal flanking sequence to and preferably be about 30-120bp, more preferably be about 45-120bp, most preferably be about 45-63bp.Aminoacid sequence Gly-Gly-Gly-Gly-Ser (the G that the joint sequence optimized encoding exists with a plurality of series connection repetition forms 4S), more preferably the coding (G 4S) 3-6, (G most preferably encodes 4S) 3-4Randomly, joint sequence can further comprise site-specific homologous recombination site, as the loxP site.
By using and the aforesaid method similar methods, variable sequence V1 and V2 can be inserted into the activation structure territory (AD) of containing activating transcription factor or the expression vector of DNA-binding domains.AD or BD structural domain can be positioned at upstream or the downstream of V1 and V2.The frame of preferred V1 and V2 and AD or BD frame can be readed over.
The expression vector that contains AD (or BD) structural domain can be any carrier that is designed to be loaded with the encoding sequence of AD structural domain.This expression vector is preferably for example pGAD10 (Feiloter etc. (1994) " Construction of an improved host strain for twohybird screening " Nucleic Acids Res.22:1502-1503) of yeast vector, pACT2 (Harper etc. (1993) " The p21 Cdk-interacting protein Cipl is a proteininhibitor of Gl cyclin-dependent kinase " Cell 75:805-816), and pGADT7 (" Matchmaker Gal4 two hybrid system 3 and libraries usermanual " (1999), Clontech PT3247-1, provide by Clontech, Palo Alto, CA).
Randomly, the expression vector that comprises AD (or BD) structural domain can comprise that also another expresses the unit, and except by the fused protein of V1 and V2 coding for example the scFv antibody, it can also express one or more protein.These protein can be enzyme such as the kinases of modifying usefulness, glycosylase, and can help to form the enzyme that is present in the disulfide linkage in the ripe antibody.The expression of these enzymes can promote or strengthen post transcriptional modificaiton, and this is needed for the complete function by the coded fusion rotein of V1 and V2.
But writing protein expression, this can place transcribing under the control of constitutive promoter or inducible promoter.An example of this expression vector is the pBridge  (catalog number (Cat.No.) 6184-1) available from Clontech.Expression vector pBridge  contains two expresses the unit, the expression unit that one is expressed for control Gal4 BD structural domain, and another is the expression unit that comprises inducible promoter Pmat25.Tirode, E. etc. (1997) J.Biol.Chem.272:22995-22999.
Linearizing carrier DNA can insert fragment with equivalent or excessive PCR and be mixed together: the V1 (or V2) that exists with the isolated fragment form, or comprise the single fragment of V1 and V2.With linearizing carrier DNA and PCR fragment cotransformation to host cell competence yeast cell for example.Can select recombinant cloning based on the cell of selecting in nutrition to survive in the substratum or based on other phenotypic markers.Linearizing carrier or insertion dna fragmentation can be used for determining the contrast of reorganization and transformation efficiency separately.
Other homologous recombination systems also can be used for producing expression vector of the present invention library.For example, the reorganization between V1 and V2 sequence library and the expression of receptor carrier can be promoted by site-specific reorganization.
Site-specific reorganization utilizes site-specific recombinase, and it is the exchange of catalytic dna fragment at specific recombination site.Site-specific recombinase is present in some virus and the bacterium, and they have the character of endonuclease and ligase enzyme.These recombinases are followed associated protein under some situation, can discern the special base sequence among the DNA, and exchange the dna fragmentation of those fragment flanks.LandyA.(1993)Current?Opinion?in?Biotechnology?3：699-707。
Typical site-specific recombinase is the CRE recombinase.CRE is the 38kDa product of cre (cyclisation reorganization) gene of phage P1, belongs to the site specific dna recombinase of Int family.Sternbery, N. etc. (1986) J.Mol.Biol.187:197-212.The 34-bp site (the X-over locus of P1) that is called loxP in the CRE identification P1 genome, and the effectively mutually conservative DNA reorganization of catalysis between two loxP sites.LoxP site [SEQ ID No.1] by two flanks be 8-bp non-palindrome core area 13bp oppositely repeat form.The reorganization between two direct multiple loxP sites of CRE-mediation causes the excision of the DNA between them to become covalence closed ring.Reorganization between two loxP that exist with reverse form of CRE-mediation will cause interleaving upset rather than the excision of DNA.DNA excision is the discontinuous position that is confined in the core area with reclosing, and carries out on chain simultaneously for the instantaneous phophotyrosineDNA-protein that connects with enzyme.
That the CRE recombinase is also discerned some variations relevant with loxP or sudden change lox site.The example of these Cre recombination sites includes, but are not limited to loxB, loxL and loxR site, and they are found on escherichia coli chromosome.Hoess etc. (1986) Nucleic Acid Res.14:2287-2300.The lox site of other variation includes, but are not limited to loxB, loxL, loxR, loxP3, loxP23, lox Δ 86, lox Δ 117, loxP511[SEQ ID No:2], and loxC2[SEQ IDNo:3].Table 1 has been listed the example that can be used for lox of the present invention site, comprise wild-type lox P site lox P WT[SEQ ID No:1] and lox P2[SEQ ID No:5], and other is in the reverse iteron of 13bp and/or have a varient of sudden change at the non-palindrome core area (underscore indicates) of 8-bp, loxP511[SEQ ID No:2], lox C2[SEQ ID No:3], lox P1[SEQ IDNo:4], lox P3[SEQ ID No:6], lox P4[SEQ ID No:7], lox P5[SEQ IDNo:8], lox P6[SEQ ID No:9], lox P7[SEQ ID No:10], lox P8[SEQ IDNo:11], lox P9[SEQ ID No:12] and lox P10[SEQ ID No:13].
The example of non-CRE recombinase comprises, but being not limited to site-specific recombinase comprises, (as att 1, att 2, and att 3 as the att site by the identification of the Int recombinase of phage, att P, att B, att L and att R), the FRT site that the FLP recombinase of the 2pi plasmid of Saccharomyces cerevisiae is discerned, recombination site of being discerned by resolvase family and the recombination site of being discerned by the transposase of Bacillus thruingieusis.
Analyze subsequently to determine causing V1 and V2 sequence correctly to be inserted into the homologous recombination efficiency of expression vector.For example, can directly insert fragment from selected yeast clone amplification V1 and V2 with PCR method, can find out how many clones thus is reorganization.The library that preferably has minimum 90% recombinant clone.Selected clone's identical pcr amplification can also be found out and be inserted segmental size.Although dual or treble insertion sequence is contained in possible small part library, the great majority clone greater than 90% preferably contains the single insertion fragment that conforms to the expection size.
Insert the fragments sequence diversity for check in the clone of selected choosing, the pcr amplification product with correct insertion clip size can be cut with common digestion restriction enzyme.Can determine on gel electrophoresis spectrum whether analyzed clone has the completely different or different identity of identical identity.The all right PCR product that directly checks order inserts the degree of guaranteeing the quality of the segmental identity and the program of clone with announcement, and checks the independence and the diversity of cloning.
In one embodiment, wherein V1 and V2 sequence are respectively the variable region of heavy chain V of coding source from the human antibody library HWith variable region of light chain V LSequence, by carrying out above-mentioned identical program, can produce mouse source scFv fragment in contrast from hybridoma cell line.The example of hybridoma cell line includes, but are not limited to produce the clone (Clontech) of anti-GFP antibody, produces the clone (NeoMarker) of anti-p-53 antibody, and other hybridoma cell lines that can obtain from ATCC.Hybridoma cell line is carried out above-mentioned identical program, and promptly cNA separates, and CDNA is synthetic, pcr amplification, and homologous recombination is in yeast.Use identical principle, also can produce other scFv antibody library with the tire spleen from MICE FETAL LIVER is dirty.
For the existing indivedual mouse monoclonal antibodies with its related antigen (cognate antigen), the mouse scFv library of generation can provide direct contrast.Many antigen one antibody Study of Interaction are carried out with murine antibody.The scFv library of mouse can be used as a fabulous contrast with yeast two-hybrid method described below at target antigen screening people source scFv antibody library process.3) the chain reorganization of expression vector is carried out in the site-specific reorganization that mediates by CRE/lox P-
In a distortion of the aforesaid method that produces the expression vector library, the diversity in expression vector library can be increased by chain reorganization via site-specific reorganization.Therefore, this method further comprises: between the member in Yeast expression carrier library 5 '-and 3 '-recombination site carry out site-specific reorganization, this reorganization causes the exchange of V1 between the member in Yeast expression carrier library or the 2nd V2 nucleotide sequence.
According to this distortion, be positioned at first or second insert 5 ' of nucleotide sequence end-and 3 '-flanking sequence comprise 5 ' respectively-and 3 '-recombination site, they can be discerned by site-specific recombinase.
Equally according to this distortion, 5 '-with 3 '-site-specific recombination site can be preferably different site-specific recombination site, be more preferably the site that each is independently selected from SEQ ID Nos:1-13, coliphase Pld lox P most preferably, another is a mutant lox P sequence.
Equally according to this distortion, but express on site-specific recombinase composing type or induction type ground in yeast cell.Site differential recombination enzyme can be the CRE recombinase that causes the site-specific reorganization.
Fig. 4 A explanation is according to an embodiment of the inventive method, and mutagenesis in vivo is carried out by the site-specific homologous recombination in the expression vector library of containing V1 and V2.Each expression vector can comprise identical yeast selective marker, as leu 2.By this mutagenesis, the diversity of coding V1 and V2 sequence can be further improved.
Shown in Fig. 4 A, 5 ' and the 3 ' flanking sequence of V2 (or V1) all comprises the recombination site of being discerned by site differential recombination enzyme.Preferably, the lox site of recombination site for being discerned by the CRE recombinase of phage P1.Table 1 has been listed the example that can be used for lox of the present invention site, comprise wild-type lox P site lox P WT[SEQ ID No:1] and lox P2[SEQ ID No:5], and other loxP mutation that has sudden change at reverse iteron and/or the non-palindrome core area of 8-bp (underscore indicates) of 13bp, loxP511[SEQ ID No:2], lox C2[SEQ ID No:3], loxP1[SEQ ID No:4], lox P3[SEQ ID No:6], lox P4[SEQ ID No:7], loxP5[SEQ ID No:8], lox P6[SEQ ID No:9], lox P7[SEQ ID No:10], loxP8[SEQ ID No:11], lox P9[SEQ ID No:12] and lox P10[SEQ ID No:13].
More preferably, 5 ' with 3 ' flanking sequence in recombination site be different lox sites, loxA shown in Fig. 4 A and loxB.
Under the situation that the CRE recombinase exists, the expression vector and another expression vector that have the lox site in 5 ' (loxA) of V2 (or V1) and 3 ' (loxB) flanking sequence carry out " chain reorganization ", described another expression vector respectively V2 ' (or V1 ') 5 ' with 3 ' flanking sequence in have identical lox site.As a result, the V2 chain of expression vector is replaced by the V2 ' chain of another expression vector, thus in theory with the complexity in library from 10 nBe increased to 10 n* 10 n=10 2n
Randomly, the recombination site that also can be discerned by the recombinase except CRE of recombination site.The example of non-CRE recombinase comprises, but be not limited to site-specific recombinase comprise as by the att site of the Int recombinase of phage identification (as att 1, att 2, att 3, attP, att B, att L and att R), the FRT site that the FLP recombinase of the 2pi plasmid of Saccharomyces cerevisiae is discerned, recombination site of being discerned by resolvase family and the recombination site of being discerned by the transposase of Bacillus thruingieusis.
At V1 is V HWith V2 be V LPreferred embodiment in, the site-specific reorganization mutagenesis that the scFv library that is produced by the yeast homologous recombination is mediated by CRE/lox P.For example, the scFv library can contain 10 6Or the V regional gene storehouse of highly diverse and complexity more, described V district gene pool is derived from the heavy chain and the light chain of people's antibody.Gene pool (light chain gene storehouse V for example L) two lox P sites inequality of flank connection, they provide the recombination signal by the light chain of CRE recombinase-mediated " reorganization ".
Complete scFv library is separable from yeast, and is transformed in the bacterial isolates (as KC8) by bacterium-yeast leucine nutrition mark complementation, extensive DNA isolation from bacterium, and hybrid dna storehouse.By using conventional single plasmid to transform scheme the DNA source of set is introduced in the yeast more then.In order to make many plasmids enter each single yeast cell, the condition of conversion can preferably be set to conc forms.
Yeast cell can be by a plasmid pre-inversion.This plasmid stably or more preferably can be expressed the CRE recombinase inductively.The expression of CRE in yeast strain can cause the homologous recombination in lox P site of CRE mediation, and this lox P site flank is connected on the light chain gene fragment VL that is placed in each expression vector.Therefore, when yeast can be grown, the plasmid in the yeast cell produced extra copy, under the situation that has the CRE recombinase, the segmental reorganization of light chain gene took place in yeast cell.Therefore, heavy chain V in yeast cell HWith light chain V LThe sum of combination can exponential form increase.Therefore, in theory, the complexity in library can reach 10 6* 10 6=10 12Or it is higher.
One of advantage of using the site-specific reorganization in yeast is that the reorganization in yeast does not need any label screening.For example, whether CRE/loxP reorganization nothing pipe screens all and can take place.
The expression vector library is multiple to be entered yeast cell and can have distinct colors by the plasmid that green fluorescent protein (GFP) gene is carried in use and detect.If many plasmids are transformed in the single yeast cell, will be shown the spectrum of combined colors by certain part of transformed yeast cells.This detection also can be used for optimizing the condition that many expression vectors transform.
Alternatively, the many carriers from the expression vector library can be transformed in the single yeast cell by the method for using " transforming by force ".In this alternate embodiment, two initial expression vector libraries containing V1 and V2 are produced in having two expression vectors of different selection markers independently.
Fig. 4 B has illustrated an example of this method.As described in Fig. 4 B,, in yeast, produce two expression vector libraries via homologous recombination by using aforesaid method.Two libraries are with regard to their RNA source, and amplification and clone's program is all identical, the different just selective marker in being contained in carrier.
For example, each expression vector in a library comprises leu 2 as the yeast selective marker, and another comprises ade 2 as the yeast selective marker.Similar to the method that in Fig. 4 A, illustrates, in the expression vector in two libraries, V2 5 ' with 3 ' flanking sequence in recombination site be different lox sites, loxA and loxB.
Under the situation that has the CRE recombinase, in 5 ' (loxA) of V2 (or V1) and 3 ' (loxB) flanking sequence, have the lox site, comprise the expression vector of Leu 2 and in 5 ' and the 3 ' flanking sequence of V2 ' (or V1 '), have identical lox site respectively, the expression vector that comprises Ade 2 carries out " chain reorganization ".As a result, the V2 chain of expression vector is replaced by the V2 ' chain of another expression vector, thus in theory with the complexity in library from 10 nBe increased to 10 n* 10 n=10 2n
Two combinatorial library that contain leu 2 and contain the expression vector of Ade 2 are used for transformed yeast cell, for example Y187 cell.By leucine in yeast and VITAMIN B4 complementation, transformant is seeded in the selection substratum for example screens two types library plasmid in the SD/-Leu/-Ade substratum.The inevitable while of any yeast clone of growing on the double selection substratum has been transformed two kinds of library clones.
By the screening of two kinds of marks, can guarantee that each yeast cell has two types library clone (each can have a plurality of copies) simultaneously.The activation of CRE enzyme or expression can allow the reorganization of loxP mediation in yeast.
The present invention also provides the method in a kind of manufacture order chain antibody library.In one embodiment, this method comprises: express the Yeast expression carrier library in yeast cell.Each Yeast expression carrier comprises first nucleotide sequence of one section encoding antibody variable region of heavy chain, second nucleotide sequence of one section encoding antibody variable region of light chain, and the joint sequence of the joint peptide of a section encode connection antibody heavy chain variable region and antibody chain variable region.Antibody heavy chain variable region, antibody chain variable region and joint peptide are expressed as a single fused protein.Equally, in the expression vector library, each makes a variation first and second nucleotide sequences independently and has at least 10 with generation 6Multifarious single-chain antibody library.
According to this embodiment, the diversity in single-chain antibody library preferred 10 6-10 18, more preferably 10 8-10 18And most preferably 10 10-10 183. screening is affine in conjunction with right between fused protein of the present invention library and target protein library
The present invention also provides and has been used for screening protein-protein or protein-peptide in conjunction with right method at yeast two-hybrid system.
Two-hybrid system is one and is designed for screening and the screening scheme that is present in the predetermined polypeptide sequence bonded peptide sequence in the fused protein.Chien etc. (1991) Proc.Natl.Acad.Sci. (USA) 88:9578.This method is by reorganization activating transcription factor (Fields and Song (1989) Nature 340:245)-yeast Gal4 transcription factor, identification of protein-protein interaction in vivo.This method is based on the proteic characteristic of yeast Gal4, and this albumen is made up of the separable structural domain of being responsible for DNA-combination and transcriptional activation.Two proteic polynucleotide of hybridization of structure coding also are incorporated in the yeast host cell, yeast Gal4 DNA-binding domains (BD) by the peptide sequence that is fused to known protein matter of described hybridization albumen is formed, and another is made up of the Gal4 activation structure territory (AD) that is fused to the second proteinic peptide sequence.Intramolecularly between two fused proteins is in conjunction with recombinating Gal4 DNA binding domains and Gal4 activation structure territory, this cause reporter gene (as lacZ, transcriptional activation HIS3), described reporter gene is by being operationally connected on the Gal4 binding site.
Typically, this double cross method is used for identifying and the interactional novel polypeptide sequence of known protein matter.Silver and Hunt (1993) Mol.Biol.Rep.17:155; Durfee etc. (1933) Genes Devel.7:555; Yang etc. (1992) Science257:680; Luban etc. (1993) Cell73:1067; Hardy etc. (1992) GenesDevel.6:801; Bartel etc. (1993) Biotechniques14:920; With (1993) Cell74:205 such as Vojtek.This two-hybrid system also is used to detect the interaction between three special single chain variable fragments (scFv) and the specific antigen.DeJaeger etc. (2000) FEBS Lett.467:316-320.This two-hybrid system also is used at yeast screening cell surface protein or acceptor hematopoiesis superfamily receptors for example.Ozenberger B.A. and Young, K.H. (1995) " Functionalinteraction of ligands and receptors of hematopoieticsuperfamily in yeast " Mol Endocrinol.9:1321-1329.
The distortion of double cross method has been used to identify the sudden change of known protein matter, and this sudden change can have influence on it and the combining of another known protein matter.Li and Fields (1993) FASEBJ.7:957, Lalo etc. (1993) Proc.Natl.Acad.Sci. (USA) 90:5524; (1993) J.Biol.Chem.268:12046 such as Jackson etc. (1993) Mol.Cell Biol.13:2899 and Madura.
The interaction that crossing system also has been used to identify the structural domain of two known proteins or has been responsible for the structural domain of single proteinic oligomerization.Bardwell etc. (1993) Med.Microbiol.8:1177; Chakraborty etc. (1992) J.Boil.Chem.267:17498; (1993) J.Biol.Chem.268:4608 such as Staudinger and Milne GT; Weaver DT (1993) Genes Devel.7:1755; Iwabuchi etc. (1993) Oncogene 8:1693; Bogerd etc. (1993) J.Virol.67:5030.
The distortion of two-hybrid system has been used to study (1992) Proc.Natl.Aacd.Sci. (USA) 89:4159 such as activity in vivo Dasmahapatra of proteolytic enzyme.Alternatively, intestinal bacteria/BCCP interaction screening system once was used for the interaction of identification of protein sequence (that is, forming the protein sequence of heterodimer or more high-grade many bodies of allos).Germino etc. (1993) Proc.Natl.Acad.Sci. (U.S.A.) 90:933; And GuarenteL. (1993) Proc.Natl.Acad.Sci. (U.S.A.) 90:1639.
Typically, select the conjugated protein just combination that depends between two Gal4 fusion roteins with the double cross method, thereby reorganization has the Gal4 activating transcription factor of function, it is induced subsequently by being operationally connected to transcribing of reporter gene on the Gal4 binding site.Transcribing of reporter gene produces the male readout, typically therefore performance can go up the growth of demonstration enhanced cell at defined medium (as HIS3 and Ade2) by enzymic activity (as beta-galactosidase enzymes) or (2) that colorimetric enzymatic assay is identified for (1), this method is applicable to that the positive of identifying peptide sequence interacts, for example antibody-AI.
The false positive clone may appear in the double cross screening, the activation of their expression reporter genes, rather than represent two special interactions between the hybridization protein.Various programs have been developed from final positive colony, to reduce or eliminate these false positives clone.For example, (1) screening in advance contains targeting vector and show the male clone under the situation that lacks the double cross mating partner, (Bartel, P.L. etc. (1993) " Elimination of false positives that arise in using thetwo-hybrid system " BioTechniques 14:920-924); (2) by using for example His3 of a plurality of reporter genes, beta-galactosidase enzymes and Ade2 (James, P etc. (1996) " Genomic libraries and a hosts traindesigned for highly efficient two-hybrid selection inyeast " Genetics 144:1425-1436); (3) by using each gene to be controlled by a plurality of reporter genes of the promotor of different response GAL4, for example those are in yeast strain Y190, wherein each His3 and β-Gal reporter gene are subjected to the control of different promotor Gal1 or Gal10, but the both reacts to the Gal4 signal.((1993) " The retinoblastoma proteinassociates with the protein phosphatase type 1 catalyticsubunit " Genes Devel.7:555-569 such as Durfee T.); (4) by the detection after the screening, for example check only has the isolate of the target of being made up of GAL4-BD.
In addition, the false positive clone can also utilize uncorrelated target to confirm that specificity is rejected.This is a standard sequence of control in the two-hybrid system, and it can be with above-mentioned 1)-4) carry out behind the library isolate identified of program.Typically, by being returned yeast reporter gene bacterial strain, the library clone of initial separation and one or more control target cotransformations obtain identifying that described control target is irrelevant with the target that uses in initial screening process.Screen to eliminate those positives that show reporter gene and activate and therefore demonstration and the non-special interactional library clone of a plurality of related proteins.
The invention provides effective means and be used for, affine polypeptide in conjunction with one or more target protein coding by V1 and V2 in the screening of expression vector library.
According to the present invention, this method comprises: express test protein in yeast cell, each test protein is a kind of fusion rotein, the first polypeptide subunit that it is made a variation in the library by sequence, sequence variations is independent of the second polypeptide subunit of first polypeptide in the library, forms with the joint peptide that is connected the first and second polypeptide subunits; Express one or more target fusion roteins in the yeast cell of expressing test protein, each target fusion rotein comprises a target peptide or protein; With the yeast cell of selecting those reporter genes to obtain expressing, the expression of reporter gene is tested fusion rotein and is combined and activate with the target fusion rotein.
According to present method, the diversity of the first and second polypeptide subunits preferred 10 3-10 8, more preferably 10 4-10 8, most preferably 10 5-10 8
According to present method, by the fusion rotein qualitative diversity preferred 10 of expression vector library coding 6-10 18, more preferably 10 9-10 16And most preferably 10 10-10 18
One of feature of the present invention is that the first and second polypeptide subunits can be totally independent of target peptide or protein and selected, does not need an any way based on known one or more protein in conjunction with target.As a result, each can be derived from the library of precursor sequence independently the diversity of the first and second polypeptide subunits, and described precursor sequence is not for target peptide or the special design of protein.For example, the precursor sequence library need not be derived from and have predetermined sequence and encode known to target peptide or proteinic group (as 2-20) gene.
The diversity of the first and second polypeptide subunits also need not be derived from known to target peptide or proteinic one or more protein.For example, one or more protein need not be derived from have known to target peptide or proteinic group (as 2-20) protein.
The diversity of the first and second polypeptide subunits does not also need mutagenesis, and one or more are known in conjunction with target peptide or proteinic protein and produce.For example, the first and second polypeptide subunits do not need to have predetermined sequence and knownly produce in conjunction with target peptide or proteinic group (as 2-20) protein by mutagenesis.
In a distortion of this embodiment, express single target fused protein and screen at test protein.According to this distortion, the step of expressing test fused protein library can comprise to be expressed vector library with test and is transformed in the yeast cell that comprises the reporter gene construct, described reporter gene construct comprises expression and is subjected to activating transcription factor to transcribe the reporter gene of control, and described activating transcription factor comprises activation structure territory and DNA binding domains.Each test expression vector comprises the activation structure territory AD of encoding transcription incitant or first transcription sequence of DNA binding domains BD, the first nucleotide sequence V1 of the first polypeptide subunit encodes, the encode second nucleotide sequence V2 of the second polypeptide subunit is connected the joint sequence L of the joint peptide of the first nucleotide sequence V1 and the second nucleotide sequence V2 with coding.Randomly, the step of expression target fused protein comprises the target expression vector and tests and express simultaneously or in a sequence transformed yeast cell of vector library.The target expression vector comprises the activation structure territory AD of encoding transcription incitant or second transcription sequence of DNA binding domains BD; With the target sequence of coding target protein or peptide, described activating transcription factor is not expressed by test expression vector library.
Figure five has shown the preferred embodiment schema of aforesaid method.As shown in Figure 5, the sequence library of containing V1 and V2 is by expression vector, and promptly the AD-V1-V2 vector library is entrained, and described V1 and V2 merge in upstream and AD structural domain.The encoding sequence of target protein (be expressed as " target) is contained in another expression vector and merges with the BD structural domain, forms BD-target carrier.
AD-V2-V2 carrier and BD-target carrier can be by using the methods known in the art cotransformation in yeast cell.(1992) " Improvedmethod for high efficiency transformation of intact yeastcells " Nucleic Acids Res.20:1425 such as Gietz D..The construct that carries specific DNA binding site and reporter gene (being expressed as " reporter gene ") can be stabilized in the genome that is incorporated into host cell, or instantaneous conversion is to host cell.When sequence is expressed in expression vector, comprise AD, protein folding is carried out in the fused protein library of V1 and V2 in host cell, and adopts various conformations, and described fused protein is expressed as the AD-V1-V2 fused protein.In host cell, some AD-V1-V2 fusion rotein can be in conjunction with the target protein by BD-target vector expression, thereby AD and BD structural domain are taken near the promoter region (being the specific DNA binding site) of reporter gene construct, and therefore reassemble into the function activating transcription factor of forming by AD and BD structural domain.As a result, AD activates the transcribing of the reporter gene in specific DNA binding site downstream, and causes for example expression of Lac Z reporter gene of reporter gene.Select the clone of the phenotype of demonstration reporter gene expression, and separate the AD-V1-V2 carrier.Identify and characterize the sequence of coding V1 and V2.
Alternatively, the step of expressing test fused protein library and expressing the target fused protein is included between first and second populations of haploid yeast cell of relative mating type and carries out mating.Haploid yeast cell first population comprises the test in test fused protein library and expresses vector library.Each test expression vector comprises the activation structure territory AD of encoding transcription incitant or first transcription sequence of DNA binding domains BD, the first nucleotide sequence V1 of the first polypeptide subunit encodes, the encode second nucleotide sequence V2 of the second polypeptide subunit is connected the joint sequence L of the joint peptide of the first nucleotide sequence V1 and the second nucleotide sequence V2 with coding.Second population of haploid yeast cell comprises a kind of target expression vector.The target expression vector comprises the activation structure territory AD of encoding transcription incitant or second transcription sequence of DNA binding domains BD; With the target sequence of coding target protein or peptide, described activating transcription factor is not expressed by test expression vector library.First or second population of haploid yeast cell comprises a reporter gene construct, and it comprises expresses the reporter gene of transcribing control that is subjected to activating transcription factor.
In this method, the haploid yeast cell of mating type can be preferably relatively αWith aThe type yeast strain. αWith aMating between first and second populations of the haploid yeast cell of type bacterial strain can be carried out being rich on the substratum of nutrition.
Fig. 6 has illustrated the schema of the preferred embodiment of aforesaid method.As shown in Figure 6, the sequence library of containing V1 and V2 is by expression vector, and promptly the AD-V1-V2 vector library is entrained, and described V1 and V2 merge in upstream and AD structural domain.The AD-V1-V2 vector library for example is transformed into haploid yeast cell aIn the type yeast strain.
The encoding sequence of target protein (be expressed as " target) is contained in another expression vector and merges with the BD structural domain, forms BD-target carrier.BD-target carrier is transformed in the haploid cell with the relative mating type of haploid cell that comprises the AD-V1-V2 carrier, αThe type yeast strain.Carrying specific DNA binding site and reporter gene (being labeled as " reporter gene ") can be transformed into aOr αIn the haploid cell of type yeast strain.
aWith αThe haploid cell of type yeast strain concussion liquid culture of low speed for example under suitable easy condition contacts with physical property among the rich medium YPD in solid culture and to carry out mating.(1994) " A yest mating-selectionscheme for detection of protein-protein interactions " Nucleic Acids Res.22:1778-1779 such as Bendixen C..Finley?Jr.，R.L.&?BrentR.(1994)“Interaction?mating?reveals?linear?and?terneryconnections?between?Drosophila?cell?cycle?regulators”Proc.Natl.Aacd.Sci.USA，91：12980-12984。As a result, AD-V1-V2 and BD-target expression vector and the reporter gene construct haploid yeast cell that is ingested aWith αIn parent's double somatocyte of type bacterial strain.
When the sequence in the expression vector in parent's double somatocyte is expressed, comprise AD, protein folding is carried out in the fused protein library of V1 and V2 in host cell, and adopts various conformations, and described fused protein is expressed as the AD-V1-V2 fused protein.In parent's double somatocyte, some AD-V1-V2 fusion rotein can be in conjunction with the target protein by BD-target vector expression, thereby AD and BD structural domain are taken near the promoter region (being the specific DNA binding site) of reporter gene construct, and therefore reassemble into the function activating transcription factor of forming by AD and BD structural domain.As a result, AD activates the transcribing of the reporter gene in specific DNA binding site downstream, and causes for example expression of Lac Z reporter gene of reporter gene.Select the clone of the phenotype of demonstration reporter gene expression, and separate the AD-V1-V2 carrier.Identify and characterize the sequence of coding V1 and V2.
A lot of reporter genes can be used for the present invention.Example by the reporter gene encoded protein comprises, but be not limited to the enzyme such as the beta-galactosidase enzymes of detection easily, alpha-galactosidase, luciferase, β-glucuronidase, paraxin acyltransferase (CAT), secretor type embryo alkaline phosphatase (SEAP), fluorescin be green fluorescent protein (GFP) for example, enhanced blue fluorescent protein (EBFP), enhanced yellow fluorescence protein (EYFP) and enhanced cyan fluorescent protein (ECFP); With some protein, they carry out immunodetection hormone and cytokine easily.The expression of these reporter genes also can be detected by the level from the RNA of these genetic transcriptions.
When screening V1 and V2 library, some reporter gene is the nutritional type reporter gene in yeast cell, they can so that yeast can on specific selective medium, grow.This is a very effective screening method, and the report of much having been published confirms.The example of nutritional type reporter gene includes but not limited to His3, Ade2, Leu2, Ura3, Trp1 and Lys2.The His3 reporter gene is by Bartel, P.L. etc. (1993) report (" Using the two-hybrid system to detect protein-protein interactions " in Cellula Interactions inDevelopment:A practical approach.ed.Hastley, D.A., Oxford Press, the 153-179 page or leaf .).The Ade2 reporter gene is by reports such as Jarves P (1996) (" Genomic libraries and host strain designedfor highly efficient two-hybrid selection in yeast " .Genetics 144:1425-1436).
For example, the V that the AD structural domain as the GAL activating transcription factor can be merged HAnd V LScFv expression vector library (AD-scFv library) be transformed into αIn the haploid cell of the yeast strain of mating type.The BD structural domain of Gal4 activating transcription factor and coding will be in plasmid merge mutually at the sequence of the target protein of scFv library screening.This plasmid is transformed into aIn the haploid cell of the yeast strain of mating type.
With isopyknic yeast strain that contains the AD-scFv library ( The α type) with contain the BD-target yeast strain ( aType) is inoculated in the selected liq substratum, cultivates respectively.These two kinds of substratum of any mixing, and for example cultivate among 1 * YPD and the 2 * YPD at rich medium.Be rich under the culture condition of nutrition, two kinds of haploid yeast bacterial strains carry out mating and form double somatocyte.At the end of mating process, these yeast cell are inoculated on the selection flat board.At this moment can use a plurality of label screening schemes to screen and in the library, show positive interactional yeast clone between the scFv and target.For example, can use the SD/-Leu-Trp-His-Ade screening scheme.Preceding two selective markers (Leu-Trp) are respectively from the mark (Leu and Trp) of AD-scFv library and BD-target vector expression.Select by such double-tagging, every have the double somatocyte of BD and AD carrier can be selected in identical yeast cell.Latter two selective marker, His-Ade is used for screening the clone who expresses reporter gene from parent strain, can think that generally their expression is owing to scFv in the library causes with combining of target.
After by cotransformation as described above or mating screening, can be in vivo or external further detection and the confirming interaction of inferring between gene probe and the library clone isolate.
External in conjunction with testing the test albumen and the interaction of the positive between target protein or the peptide that can be used to verify by the expression of clone and separate thing.For example, external can be " band gets off " method (pull-down) in conjunction with experiment, conjugated protein and with the library clone isolate of the vivoexpression of radioactivity or on-radiation group mark as the gene probe that merges with GST (glutathione S-transferase) as matrix.Because probe is to combine with matrix phase by GST affinity substrate (glutathione agarose), so the library clone isolate also will combine with matrix with the avidity of gene probe by it.External combination test also can be finished by the method for coimmunoprecipitation (Co-IP), and it needs two affinity tag antibody.In this test, target gene probe and library clone isolate and peptide-labeled thing be HA (hemagglutinin A) (haemaglutinin A) or Myc marker for example.Gene probe is at first used the antibody mediated immunity precipitation of the affinity peptide marker (for example HA) that merges at the target gene probe.The antibody of the different affinity tag (for example Myc) that merges with second anti-library clone isolate is surveyed throw out again then.
In vivo test also can be used for detecting by clone and separate the thing expressed tested albumen and the positive between target protein or the peptide and interact.For example, the Mammals two-hybrid system can be used as the reliable Verification System of yeast two-hybrid library screening.In this system, the target gene probe merges with Gal4 DNA-binding domains or Mammals activation structure territory (for example VP-16) respectively mutually with library clone.These two fusion roteins of being regulated and control by potent and mammalian promoter (as the CMV promotor) composing type are by being introduced into mammalian cell with the reporter gene cotransfection that GAL4 is responded.Reporter gene can be CAT gene (paraxin acyltransferase) and other reporter genes commonly used.2-3 after the transfection days, just can carry out CAT and detect or other standard detection, determine the degree that reporter gene is expressed, it has represented interactional power between gene probe and the library clone isolate.
The present invention also provide simultaneously can in order to select can with the test kit of the test protein of target peptide or protein bound.
In one embodiment, test kit comprises: vector library and a yeast cell system are expressed in a test.Each test expression vector comprises the activation structure territory AD of encoding transcription incitant or first transcription sequence of DNA binding domains BD, encode first nucleotide sequence of the first polypeptide subunit, encode second nucleotide sequence of the second polypeptide subunit is connected the joint sequence of the joint peptide of first nucleotide sequence and second nucleotide sequence with coding.First and second nucleotides sequences are listed in that each makes a variation independently in the expression vector library.The reporter gene construct can be contained in the yeast cell system.The reporter gene construct comprises expresses the reporter gene of transcribing control that is subjected to specific DNA binding site.
Randomly, test kit can also include a target expression vector, and it comprises the activation structure territory of encoding transcription incitant or second transcription sequence of DNA binding domains; With the target sequence of coding target protein or peptide, described activating transcription factor is not expressed by test expression vector library.
In another embodiment, this test kit comprises: first and second populations of the haploid yeast cell of relative mating type.First population of haploid yeast cell comprises the test in test fused protein library and expresses vector library.Each test expression vector comprises the activation structure territory AD of encoding transcription incitant or first transcription sequence of DNA binding domains BD, encode first nucleotide sequence of the first polypeptide subunit, encode second nucleotide sequence of the second polypeptide subunit is connected the joint sequence of the joint peptide of first nucleotide sequence and second nucleotide sequence with coding.Second population of haploid yeast cell comprises the target expression vector.The target expression vector comprises the activation structure territory AD of encoding transcription incitant or second transcription sequence of DNA binding domains BD; With the target sequence of coding target protein or peptide, described activating transcription factor is not expressed by test expression vector library.First or second population of haploid yeast cell comprises a reporter gene construct, and it comprises expresses the reporter gene of transcribing control that is subjected to activating transcription factor.
Randomly, second population of haploid yeast cell comprises many target expression vectors.Each target expression vector comprises the activation structure territory AD of encoding transcription incitant or second transcription sequence of DNA binding domains BD; With the target sequence of coding target protein or peptide, described activating transcription factor is not expressed by test expression vector library.First or second population of haploid yeast cell comprises a reporter gene construct, and it comprises expresses the reporter gene of transcribing control that is subjected to activating transcription factor.4. screening is affine in conjunction with right between fused protein of the present invention library and target nucleic acid
As mentioned above, V1 of the present invention and V2 sequence library can be used in the double cross screening system selecting at the protein-protein of a plurality of protein/tears target of single or array or protein-peptide in conjunction with right.As described below, these libraries also can be used for respectively at single crosses system or triple-crossing system screening protein-dna or albumen-RAN in conjunction with right.
Use single crosses screening system protein-dna in conjunction with right common option screening by Li and Herskowitz (1993) described (Science 262:1870-1874).Typically, this method is to be used for identification code can discern the proteic gene of specific dna sequence.Be used to screen with the library of protein fragments at random of transcriptional activation domain (AD) mark and can activate the protein that contains the reporter gene of specific dna sequence at its promoter region.With using this strategy, identified in vivo and the initial interacting proteins of the dna replication dna in yeast source.In the triple-crossing system, target nucleic acid is RNA or rna binding protein.(1996) Proc.Natl.Acad.Sci.USA 93:8496-8501. such as San Gupta
The invention provides and in yeast-one-hybrid system, screen protein-dna in conjunction with right a kind of method.
In one embodiment, this method comprises: express test fused protein library in yeast cell, described test fused protein comprises a reporter gene construct, and it comprises expresses the reporter gene of transcribing control that is subjected to the target DNA sequence; The yeast cell of reporter gene is expressed in screening, the expression of reporter gene tested fused protein combine with the target DNA sequence activate.Each test fused protein comprises: the activation structure territory AD of activating transcription factor, the first peptide subunit that in the library, makes a variation, in the library, be independent of the second polypeptide subunit of first polypeptide subunit variation, with the joint peptide that is connected the first polypeptide subunit and the second polypeptide subunit.
In a distortion of this embodiment, the step of expressing the test fused protein comprises that vector library is expressed in the test in test fused protein library to be transformed in the yeast cell.Each test expression vector comprises the activation structure territory AD of encoding transcription incitant or the transcription sequence of DNA binding domains BD, the first nucleotide sequence V1 of the first polypeptide subunit encodes, the encode second nucleotide sequence V2 of the second polypeptide subunit is connected the joint sequence L of the joint peptide of first nucleotide sequence and second nucleotide sequence with coding.
In another distortion of this embodiment, the step of expressing test fused protein library in yeast cell is included between first and second populations of haploid yeast cell of relative mating type carries out mating.First population of haploid yeast cell comprises the test in test fused protein library and expresses vector library, each test expression vector comprises the transcription sequence of the activation structure territory AD of encoding transcription incitant, the first nucleotide sequence V1 of the first polypeptide subunit encodes, the encode second nucleotide sequence V2 of the second polypeptide subunit is connected the joint sequence L of the joint peptide of first nucleotide sequence and second nucleotide sequence with coding.Second population of haploid yeast cell comprises the reporter gene construct.
According to this distortion, the haploid yeast cell of mating type can be preferably relatively αWith aThe type yeast strain. αWith aMating between first and second populations of the haploid yeast cell of type bacterial strain can be carried out being rich on the substratum of nutrition.
In conjunction with right method, the target DNA sequence in the reporter gene construct can preferably be positioned to hold with respect to 5 ' of reporter gene with 2-6 series connection multiple form according to above-mentioned any screening protein-dna.
Target DNA sequence in the reporter gene construct can preferably be about 15-75bp, more preferably is about 25-55bp.
Fig. 7 has shown the schema of the preferred embodiment of aforesaid method.As shown in Figure 7, the test sequence library of containing V1 and V2 is by expression vector, and promptly the AD-V1-V2 vector library is entrained, and described V1 and V2 merge in upstream and AD structural domain.Target DNA sequence (being expressed as " target DNA ") is positioned the promoter region of reporter gene (being expressed as " reporter gene ").
The AD-V1-V2 carrier can be transformed in the yeast cell with methods known in the art and go.Gietz, D. etc. (1992) " Improved method for highefficiency transformation of intact yeast cells " NucleicAcids Res.20:1425.The construct that carries target DNA sequence and reporter gene can be incorporated in the genome of host cell or instantaneous being transformed in the host cell with being stabilized.
State as shown in Figure 7, when the test sequence is expressed, comprise AD in expression vector, protein folding is carried out in the test protein library of V1 and V2 in host cell, and adopts various conformations, and described fused protein is expressed as the AD-V1-V2 fused protein.In host cell, some AD-V1-V2 fusion rotein can be incorporated on the target DNA sequence of the promoter region of reporter gene, thereby the AD structural domain is taken near the promoter region.As a result, AD activates the transcribing of the reporter gene in target DNA sequence downstream, and causes for example expression of Lac Z reporter gene of reporter gene.Select the clone of the phenotype of demonstration reporter gene expression, and separate the AD-V1-V2 carrier.Identify and characterize the sequence of coding V1 and V2.
Alternatively, AD-V1-V2 carrier and reporter gene construct also can be introduced in the amphiploid yeast cell that is formed by two haploid yeast strain matings.For example, the AD-V1-V2 carrier can for example be transformed into αIn the bacterial strain haploid yeast cell; For example then can be transformed into another kind of haploid yeast bacterial strain with the reporter gene construct aThe type bacterial strain.When these two kinds of haploid strains mating, form double somatocyte to merge the genetic material that carries by two kinds of haploid cells.As a result, AD-V1-V2 and reporter gene construct are just introduced double somatocyte therefrom, and its positive that is used for subsequently screening between cell test protein and the target DNA interacts.
The target DNA sequence can be a controlling element, or the expansion site of the karyomit(e) recombinant protein combination of inferring, and is preferably short dna sequence dna (20-80bp).Can be with the target DNA sequence clone in the reporter gene carrier of yeast-one-hybrid system, as pHis (Clontech, Palo Alto, CA; Luo etc. (1996) " Cloning and analysisof DNA-binding proteins by yeast one-hybrid and one-two-hybrid system " Biotechniques 20:564-568.).In order to increase sensitivity, the series connection that target sequence can minority repeats form (as 4-5 copy) and clones in the reporter gene carrier.The reporter gene carrier of reorganization can be by transforming with linearizing carrier and being integrated in the yeast reporter gene bacterial strain in order to save the screening that the integration mark carries out.This integration can only occur in an independent chromosomal foci usually, and the frequency of conversion generally can be very high.
Comprise the codified scFv library, test sequence library of V1 and V2, it can be used for screening target DNA antigen.This scFv expression library can be by transforming or by with the yeast strain mating of relative mating type and comprise the reporter gene construct and be introduced in the yeast cell.Describe in detail among the embodiment 3 and transform and the mating program.Autoactivation clone's prescreen is essential for eliminating false positive.Program is similar to the double cross library prescreen of description in the part 3.
From the isolating library clone of this single crosses screening system may represent can from these can with the scFv antibody of expressing the clone that the DNA target combines.This antibody-like can have significant application in the diagnosis of DAN vaccine and disease.
Single crosses of the present invention system also can be improved is used to screen the new cofactor that can combine with the known dna binding factor then.The polypeptide libraries that comprises the V1 that merges with the AD structural domain and V2 can be used to screen ground the affine of specificity factor and combines, and described specificity factor can be combined in the DNA sequence of reporter gene promoter region.
In one embodiment, this method comprises: express the test fusion protein libraries in yeast cell, this test fused protein comprises a reporter gene construct, and it comprises expression and is subjected to specific DNA binding site to transcribe the reporter gene of control; Express target protein in the yeast cell of expressing the test fused protein, target protein combines with the DNA binding site in described yeast cell; With the yeast cell of selecting those expression reporter genes, the expression of reporter gene is tested fused protein and is activated with combining of target protein.Each test fused protein comprises: the activation structure territory AD of activating transcription factor, the first peptide subunit, the second polypeptide subunit, with the joint peptide that is connected the first polypeptide subunit and the second polypeptide subunit, wherein each makes a variation the sequence of the first and second polypeptide subunits independently in test fused protein library.
In a distortion of this embodiment, the step of expressing the test fusion rotein comprises that vector library is expressed in the test in test fused protein library to be transformed in the yeast cell.Each test expression vector comprises the transcription sequence of the activation structure territory AD of encoding transcription incitant, the first nucleotide sequence V1 of the first polypeptide subunit encodes, the encode second nucleotide sequence V2 of the second polypeptide subunit is connected the joint sequence L of the joint peptide of the first nucleotide sequence V1 and the second nucleotide sequence V2 with coding.In another distortion of this embodiment, the step of expressing the test fusion rotein and expressing the target fusion rotein is included between first and second populations of haploid yeast cell of relative mating type carries out mating.First population of haploid yeast cell comprises the test in test fused protein library and expresses vector library.Each test expression vector comprises the transcription sequence of the activation structure territory AD of encoding transcription incitant, the first nucleotide sequence V1 of the first polypeptide subunit encodes, the encode second nucleotide sequence V2 of the second polypeptide subunit is connected the joint sequence L of the joint peptide of the first nucleotide sequence V1 and the second nucleotide sequence V2 with coding.Second population of haploid yeast cell comprises the target expression vector, and it comprises the target sequence of the target protein of encoding.First or second population of haploid yeast cell comprises a reporter gene construct.
Fig. 8 has shown the schema of the preferred embodiment of aforesaid method.As shown in Figure 8, being included in the V1 of upstream and AD structural domain fusion and the test sequence library of V2 is that the AD-V1-V2 vector library is carried by expression vector.The AD-V1-V2 carrier is for example introduced host cell by transforming.Known target protein in conjunction with specific dna sequence (be expressed as " target) can or be present in the cell in addition by the expression of the expression vector in the host cell.Specific dna sequence (being labeled as " * DNA ") is present in the promoter region of reporter gene (being labeled as " reporter gene ").The construct that carries specific dna sequence and reporter gene can stably be incorporated in the genome of host cell or instantaneous being transformed in the host cell.
As shown in Figure 8, when the test sequence is expressed, comprise AD in expression vector, protein folding is carried out in the test protein library of V1 and V2 in host cell, and adopts various conformations, and described test protein is expressed as the AD-V1-V2 fused protein.Some AD-V1-V2 fusion rotein can be in conjunction with target protein, and described target protein is in conjunction with the specific dna sequence in the reporter gene promoter region, thereby the AD structural domain is taken near the promoter region.As a result, AD activates the transcribing of the reporter gene in target DNA sequence downstream, and causes for example expression of Lac Z reporter gene of reporter gene.Select the clone of the phenotype of demonstration reporter gene expression, and separate the AD-V1-V2 carrier.Identify and characterize the sequence of coding V1 and V2.
Specific target protein can be that have been characterized as being can be in conjunction with any protein of DNA, use for example external gel displacement of various tests test, or screens by the single crosses of routine and to characterize.Target protein (not merging mutually with the AD structural domain) can be expressed in yeast one-hybrid reporter gene bacterial strain.The target protein expression levels is adjusted to not observe measurable activated degree then.This yeast strain also can comprise the reporter gene construct that is incorporated in the yeast genes group.
The scFv library of can encoding, the test sequence library of containing V1 and V2, it can be used for screening a kind of target protein, and described target protein is a kind of dna binding factor.From the single crosses system that this class is modified sieve library clone can represent can be in conjunction with target protein from the scFv antibody of these clonal expressions.Such antibody may have significant application in treatment of diseases and diagnosis.5. high flux screening is affine in conjunction with right between fused protein of the present invention library and target protein library
The present invention also provides the method in the above-mentioned fused protein library by V1 and V2 coding of high flux screening simultaneously.Expression vector library such as AD-scFv yeast expression library can be used to screen combining of scFv and a plurality of target proteins of being expressed by yeast clone library (BD-target library), and for each target protein, each clone who carries the BD-targeting vector is with screened.Can with BD-target clone library array in porous, for example in 96-and the 384-hole flat board, carry out automatization and high-throughout screening to the scFv library then.
For example, the people, the EST of mouse or other biological clone's aggregate (or all EST library) can be used for screening the scFv library that the method for the application of the invention produces.EST clone's aggregate can be ordered with the form in library by the common source, and this library form has the independently clone of array in 96-hole or 384 hole flat boards.(1996) " The I.M.A.G.E.Consortium:an integratedmolecular analysis of genomes and their expression " Genomics 33:151-152 such as Lennon G..After the similar program of using when producing the scFv library, the EST in these original set zoariums inserts fragment (be generally and be present in bacterial clone and the sequencing vector) and can be increased with PCR, increases the homologous sequence that has extension at two ends.By with the identical homologous recombination procedure that in producing scFv library process, uses, EST inserts fragment and can be inserted in the expression vector of the BD structural domain that comprises activating transcription factor in the yeast cell.
Randomly, some structural domain structure such as zinc refers to or the aggregate of helix-loop-helix domain can be inserted in the expression vector that contains the AD structural domain by homologous recombination in yeast cell.The yeast clone that comprises the carrier that BD and each structural domain structure merge can be by array in porous flat plate, and is used for following the scFv library to screen for scFv with affine combination the between each structural domain structure.The structural domain structure can a long 18-20 amino acid, and its sequence can not be all at random.The aggregate of this structural domain structure can by utilize synthetic have feature conservative and at random/oligonucleotide of the residue of degeneracy produces to cover most rational structure domain structure.
Equally randomly, the encoding sequence of random peptide library can be inserted in the expression vector that contains the BD-structural domain by homologous recombination in yeast cell.Comprise and have AD and each yeast clone of the carrier that merges of peptide can be by array in porous flat plate at random, and for scFv with each at random affine combination the between the target peptide be used for following the scFv library to screen.Peptide can long 16-20 amino acid at random.Part random oligonucleotide that is can be by random oligonucleotide synthetic or the sequence by the specific target of being partial to encode synthesizes and produces this random peptide library.
Alternatively, in yeast cell, the small peptide library also can be inserted in the expression vector that contains BD by homologous recombination.Therefore, the scFv library can be merged with the AD structural domain in expression vector, and screens at this small peptide library.By this selection, the peptide part can be done selection with each scFv.The structure of the peptide of choosing thus and the analysis of function can help antigenic appropriate design and the antigenic texture improvement of particular target.
Fig. 9 letter has been shown in yeast by carry out mating between two bacterial strains of yeast haploid cell, at the general approach in high flux screening scFv library, target protein library.
As shown in Figure 9, each member of target protein or peptide library all be contained in yeast aThe BD structural domain of the expression vector in the type host strain merges mutually.
The yeast clone in target protein library can be a clone library by array.This can be deposited in by each clone that will contain BD target fusions in each hole of 96-or 384-hole flat board and realize.Randomly, before using BD-target clone library, can carry out prescreen to filter out the clone of all autoactivations to BD-target library.This screening can be finished by the yeast clone that comprises BD-target fusions is produced in selecting substratum, and described selection substratum is used for the double cross screening in later stage as the SD/-Trp-His substratum.Check the autoactivation situation of reporter gene under these situations that are cloned in disappearance AD structural domain.
Alternatively, have β-or the selection substratum of the sweet enzyme substrates of α-semi-lactosi in prescreen BD-target library.Every positive colony can produce by expressing from the enzymatic color reaction of the galactoside of LacZ reporter gene, and can with the naked eye or with instrument detect.These clones are the autoactivation clones that express reporter gene under the situation of disappearance AD structural domain.These clones can reject from BD-target clone library.
By shown in Figure 9, with yeast aThe BD-target clone of bacterial strain is inoculated in the flat board this flat board quilt αThe array library in the scFv library of bacterial strain yeast haploid cell is inoculated in advance.Two haploid yeast bacterial strain mating in rich medium form diploid.The expression that parent clone is used to screen reporter gene, the expression indication of the reporter gene interaction that in same hole, is positive between scFv and the target protein by these clonal expressions.Can use β-or the sweet enzyme substrates of α-semi-lactosi carry out the numeration of positive colony easily by the auxiliary automatically screening of machine.Aho, S. etc. (1997) " Anovelreporter gene MEL1 for the yeast two-hybrid system " Anal.Biochem.253:270-272.
Compare with the screening at the single target protein in scFv albumen library, method shown in Figure 9 is based on clone's mating, and promptly single target protein is at single scFv albumen.The advantage of this clone's mating is by when relating to a large amount of target proteins and scFv antibody, can strengthen the efficient of mating and screening by clone's mating.
Described method can be used for the extensive screening at various target molecules or part of biomolecules library such as human antibody library.Screening process can automatization high flux screening biomolecules.For example, at any EST (people, mouse or other biological), or the protein structure domain of any known structure/function (zinc refers to, helix-loop-helixs etc.), or have the completely random peptide of all lengths, this screening method can obtain effectively to separate and the scFv antibody of set.
On the contrary, by using the method for screening antibody in the conventional body, as hybridoma and " Xenomonse " technology since with the relevant technical limitation of host of using animal as antibody and target molecule library, this large-scale and comprehensive antibody set is unpractiaca.
By utilizing method of the present invention, by clone's mating, antibody library can be used for screening individually the antibody in the library and the affine interaction of target antigen, and can not lose independent clone's trace in vivo.This screening is more effective than the program of carrying out in mouse, because the yeast cell proliferative speed is fast and operation easily.
Method of the present invention effectively and economically provides various useful instruments, describes the function of gene, especially the protein group function.Because finishing of human genome order-checking engineering, be huge at the demand to the effectively extensive screening of functional protein of a large amount of target molecules.High-affinity and functional scFv antibody of the screening of the method for the application of the invention, and other polymeric protein will be in the control of disease, diagnosis, treatment and other biological medical science or industrial have very widely use.6. the mutagenesis of cloning at the positive fusion rotein of target protein selection
As mentioned above, protein clone (lead) can obtain by the elementary library screening of carrying V2 and V2 to one or more target proteins as the scFv antibody cloning.The encoding sequence of these protein clones can be in vivo or vitro mutagenesis clone more diversified secondary library to produce than these.After the similar program that is used for screening the elementary library of carrying V1 and V2, can screen once more at the clone after the mutagenesis of target protein in vivo.The natural affine ripening process that is present in the Mammals has been simulated in primary antibody clone's this mutagenesis and screening effectively, and this process can be created in has the antibody that increases progressively avidity to immunizing antigen.
Can make the mutagenesis fusion rotein clone's that ins all sorts of ways encoding sequence.The example of these mutafacient system includes, but are not limited to site-directed mutagenesis, fallibility PCR mutagenesis, cassette mutagenesis, random PCR mutagenesis, DNA reorganization, and chain reorganization.
Site-directed mutagenesis or some mutagenesis are used in the specific region and progressively change V1 and V2 sequence.This normally finishes by the sudden change that oligonucleotide instructs.Such as, one section short sequence of scFv antibody cloning can replace with the oligonucleotide of one section synthetic mutagenesis.This method is invalid for mutagenesis a large amount of V1 and V2 sequence, but can be used for finely tuning a concrete clone to obtain at the proteic higher avidity of particular target.
Cassette mutagenesis also can be used in specific region mutagenesis V1 and V2 sequence.In typical cassette mutagenesis, one section sequence of single template or zone are replaced by stochastic sequence wholly or in part.Yet obtainable maximum information content can be limited by the number of the stochastic sequence of oligonucleotide statistically.Similar to point mutation, this this method can be used for finely tuning a concrete clone to obtain at the proteic higher avidity of particular target.
Fallibility PCR, or " toxicity " PCR can be used for V1 and V2 sequence according to the scheme that is described in Caldwe11 and Joyce (1992) PCR Methods and Applications 2:28-33.Shafikhani, S. etc. (1997) BioTechniques23:304-306; (1994) Proc.Natl.Acad.Sci.USA91:10747-10751 such as Stemmer W.P..
Figure 10 has shown with method of the present invention the antibody cloning of choosing from elementary scFv library has been done an affine sophisticated example.As described in Figure 10, the in addition mutagenesis of the method for the scFv that from the clone who contains elementary scFv library, screens clone's encoding sequence by using " toxicity " PCR.Because the encoding sequence in scFv library is to be present in the expression vector of separation in screened clone, one or more pairs of PCR primers can be used for specifically from carrier amplification V HAnd V LThe district.Under the condition that is easy to introducing sudden change in product, contain V by toxicity PCR mutagenesis HAnd V LThe PCR fragment of sequence.
The condition of this " toxicity " PCR comprises: a) mn ion of high density (as 0.4-0.6mM), and it effectively induces TaqDNA polysaccharase malfunction; B) use a kind of Nucleotide substrate (as dGTP) of high density in PCR reaction, this can cause that this high concentration substrate is attached in the template improperly and produces sudden change asymmetricly.In addition, some other factor, as the PCR cycle number, the kind of the archaeal dna polymerase of use, and the length of template all can impact in the PCR product " mistake " Nucleotide erroneous combination.The mutagenesis in the scFv library that the test kit that commercial sources is buied can be used to select, as " diversity PCR random mutagenesis test kit " (catalog number (Cat.No.) K1830-1, Clontech, Palo Alto, CA).
The PCR primer that in mutagenesis PCR, uses to preferably include with expression vector in the zone that is complementary, homologous recombination site.This design can allow the approach of PCR product by homologous recombination after mutagenesis be introduced into again in the yeast host bacterial strain.So also can make V after modifying HAnd V LDirectly merge mutually with the AD structural domain of expression vector in yeast in the zone.
Equally as shown in figure 10, the scFv fragment through mutagenesis exists αBe inserted in the expression vector that contains the AD structural domain by homologous recombination in the haploid cell of type yeast strain.Be similar to from primary antibody library screening scFv clone, the haploid cell that contains AD-scFv and relative mating type (as aType) another haploid cell mating that contains BD-target carrier and reporter gene construct.The screening criteria of describing in detail based on the expression of reporter gene with in part 3 screens parent's diploid cell.
The mutafacient system of other PCR-based also can use separately, or uses with above-mentioned " toxicity " PCR.Such as, through the V of pcr amplification HAnd V LFragment can be with Dnase digestion to produce otch on double-stranded DNA.With other exonuclease such as Bal3 these otch are extended to breach.Can pass through then to use DNA Klenow polysaccharase, at the immobilized substrate dGTP of lower concentration, dATP, dTTP, and dCTP, and wherein a kind of substrate (as dGTP) is under the condition of asymmetric high density, these breach are put down by mend of stochastic sequence subsequently.This filling-in will produce high-frequency sudden change in the flat gap regions of benefit.Thereby the method for DnaseI digestion can together be used at ideal V with the toxicity PCR method HAnd V LProduce high-frequency sudden change in the fragment.
By using the DNA shuffling technology, can be at the V of vitro mutagenesis pcr amplification HAnd V LFragment or from the scFv fragment of primary antibody clonal expansion, Stemmer (1994) Nature 370:389-391 is seen in the description of this technology; And Stemmer (1994) Proc.Natl.Acad.Sci.USA 91:10747-10751).V from the primary antibody clone H, V LOr the scFv fragment is degraded at random small segment by DNaseI, is assembled into their sizes when initial with PCR in external method by homologous recombination then.As a result, increase in the increase of the diversity of external primary antibody clone library owing to the cycle number of molecular evolution.
Amplification is from primary antibody clone's V H, V LOr the scFv fragment also can be by the inherent sudden change ability in the exploitation pre B cell in vivo by mutagenesis.The sudden change of the two-forty of Ig gene pairs in the pre B cell growth course in pre B cell is especially responsive.In the environment of pre B cell propagation, Ig promotor and enhanser have promoted the sudden change of this two-forty.Therefore, V HAnd V LGene fragment can be cloned into mammalian cell expression vector, and this carrier contains people Ig enhanser and promotor.This construct is introduced pre B cell then, and as 38B9, this cell will cause V HAnd V LThe sudden change of gene fragment spontaneous generation in pre B cell.Liu X. and Van Ness B. (1999) MolImmunol.36:461-469.The V that can from the pre B cell system of cultivating, increase and suddenly change HAnd V LFragment, and be incorporated into again in the yeast strain that contains AD by for example homologous recombination.
By being that an expression vector can be cloned in the secondary antibodies library that mutagenesis produces by the Mammals pre B cell promptly in external (as PCR) or body, and identical target protein screens in the primary antibody library screening at using in the first round.For example, the expression vector that contains the secondary antibodies library can be transformed into αIn the type yeast strain haploid cell.These αCell with contain BD-target expression vector and reporter gene construct aThe mating of type yeast strain haploid cell.Similar program screening by screening primary antibody clone in yeast is from the positive interactional scFv in secondary antibodies library.
Alternatively, since with elementary library (as 10 7-10 14) compare, the secondary antibodies library is (as 10 4-10 5Independent clone) complexity is relatively low, so the secondary antibodies library screening can not undertaken by the mating between the two primary yeast bacterial strains.Replace the expression vector of the linearizing AD of containing structural domain and the V of process mutagenesis HAnd V LThe direct cotransformation of fragment is in the yeast cell that contains BD-target expression vector and reporter gene construct.By carrying out homologous recombination in yeast, the secondary antibodies library can be by the AD-scFv vector expression of reorganization, and screens by the program similar to screening primary antibody clone in yeast at the target protein by BD-target vector expression.7. the functional expression of the antibody that screens and purifying
That produced and selected at the target protein screening process, in expression vector, be connected in V1 and V2 sequence by the library of the fusion rotein of V1 and V2 coding and express the control dna sequence dna, in the host, expressed after comprising natural relevant or allogenic promotor.By V1 and V2 sequence and expression control sequenc are joined, V1 and V2 encoding sequence are positioned to guarantee transcribing and translating of these insertion sequences.Expression vector is reproducible in host living beings, and it is as the episome of host chromosome DNA or as integrated part.Expression vector can also contain selected marker such as antibiotics resistance gene (as Xin Meisu, tetracycline resistance gene) thereby the detection of those cells that allow to be transformed by expression vector.
Preferably, expression vector is an eukaryotic vector, and it can transform or the host cell of transfection eucaryon.After expression vector entered appropriate host cell, host cell should be cultivated under the condition of single chain polypeptide that is suitable for being encoded by V1 and V2 such as scFv expression.Collect and the purifying polypeptide expressed according to selected expression system.
ScFv, Fab or fully the assembling antibody by screening method of the present invention select after can in any host system, be expressed with various scales.Figure 12 has shown the example of host system: bacterium (as intestinal bacteria), yeast (as S.cerevisiae), and mammalian cell (COS).Bacterial expression vector can preferably contain the phage t7 promotor and express single chain variable fragment (scFv).Yeast expression carrier can comprise constitutive promoter (as the ADGI promotor) but or inducible promoter (as GCN4 and Gal 1 promotor).Three types antibody comprises scFv, Fab and completely antibody can in yeast expression system, express.
Expression vector also can be the expression vector of mammalian cell, and they are used in mammalian cell is cultivated instantaneity or stable single chain polypeptide of expressing by V1 and V2 coding.The example that is suitable for the mammalian cell of immunoglobulin,exocrine includes, but are not limited to COS clone, HeLa cell, myeloma cell line, Chinese hamster ovary celI system, the B cell and the hybridoma of conversion.
Typically, mammalian expression vector contains some expression control sequenc, as replication orgin, and promotor, enhanser, and some necessary processing signal ribosome bind site for example, RNA splice site, polyadenylation site, and Transcription Termination subsequence.The example of promotor comprises, but be not limited to insulin promoter, human cytomegalic inclusion disease virus (CMV) promotor and early promoter thereof, simian virus SV40 promotor, Rous sarcoma virus LTR promotor/enhanser, chicken cell matter beta-actin promotor is derived from immunoglobulin (Ig), the promotor of bovine papilloma virus and adenovirus.
One or more enhancer sequence can be contained in the expression vector and transcribe efficient with enhancement.Enhanser is the cis acting sequence of 10-300bp, and they can promote the efficient of transcribing by promotor.Enhanser can be transcribed the 5 ' end or effective enhancing of 3 ' end of transcriptional units.If they are arranged in intron or its encoding sequence also is effective.The example of enhanser includes, but are not limited to the SV40 enhanser, cytomegalovirus enhanser, polyoma enhanser, mouse immuning ball protein heavy chain enhancer, and adenovirus enhanser.Mammalian cell expression vector also can typically contain selectable marker gene.The example of suitable easy mark includes, but are not limited to dihydrofolate reductase gene (DHFR), thymidine kinase gene (TK), or give the prokaryotic gene of antibiotics resistance gene.DHFR and TK gene preferably use the clone of sudden change, and they do not add thymidine and promptly lose energy for growth in growth medium.Can be tested and appraised the ability that they grow then and identify cell transformed on non-supplemental medium.Example with the protokaryon drug resistance gene of marking comprises the gene of giving the G418 resistance, mycophenolic acid and Totomycin.
Then, depend on the type of host cell, the expression vector that contains V1 and V2 sequence can be transformed into host cell with methods known in the art.The example of rotaring dyeing technology includes, but are not limited to calcium phosphate transfection, calcium chloride transfection, liposome, electroporation, and microinjection.
V1 and V2 sequence also can be inserted virus vector, and such as adenovirus carrier, this class carrier can duplicate in its host cell and produce in a large number by V1 and V2 encoded polypeptides.
Particularly, as shown in figure 12, scFv, the antibody of Fab or assembling fully can be expressed in mammalian cell with the method that (1997) Gene 18:187:9-18 such as Persic describe.Preferably use described and contain the mammalian expression vector of EF-α promotor and SV40 replication orgin by Persic.The SV40 replication orgin allows high-caliber transient expression in cell that contains large T antigen (large T antigen) such as COS clone.In order to integrate screening, expression vector can contain secretion signal and different antibiotic markers (as neo and hygro) simultaneously.
In case express, after expression, can be separated and purifying with the V2 encoded polypeptides by V1 with the program of this area standard, comprise ammonium sulfate precipitation, fractionation column chromatography, and gel electrophoresis.In case purifying, partly purifying or the polypeptide that is purified to ideal homogeneous state can be used for the treatment of purpose subsequently, or are used for developing, carry out testing sequence, immunofluorescence dyeing, and the application of other biological medical science and industry.Particularly, can be used for for example cancer of various diseases, autoimmune disorder, and the diagnosis of virus infection and treatment with the antibody that method produced that the present invention introduced.
In a preferred embodiment, produce with method that the present invention introduced and screening have a V HAnd V LSegmental scFv human antibody can directly be expressed in yeast.According to this embodiment, from the V of selected expression vector HAnd V LPcr amplification can be carried out with primer in the zone, and the primer of this PCR can add the sequence of suitable homologous recombination simultaneously to the PCR product.These V HAnd V LThe PCR fragment can together be introduced into yeast strain with linearizing expression vector subsequently, described expression vector comprises the ideal promotor, signal is transcribed or translated to presentation markup and other.
For example, V HAnd V LThe PCR fragment in zone can with the Yeast expression carrier homologous recombination, described Yeast expression carrier has comprised the ideal promotor and has comprised terminator codon and transcription termination signal in the downstream in the upstream.Promotor can be composition type expression promoter such as ADH 1, or derivable expression promotor, and for example Gal 1, or GCN4 (A.Mimran, I.Marbachk, and D.Enge] berg, (2000) Biotechniques 28:552-560).The preferred latter's inducible promoter is because can realize at an easy rate inducing by add 3-AT in substratum.
The Yeast expression carrier that is used to express scFv antibody can be any reference culture with nutrition selective marker, and the nutrition selective marker is His3 for example, Ade2, Leu2, Ura3, Trp1, and Lys2.The mark that is used for screening the expression of the scFv that obtains can preferably be different from the mark that is used for screening the AD carrier of scFv at two-hybrid system.Can help avoid potential carry-over (carryover) problem relevant like this with a plurality of Yeast expression carriers.
In order to express scFv antibody by a secreted form in yeast, the carrier of expressing usefulness can be at V HAnd V LSegmental 5 ' end contains secretion signal, for example alpha factor signal and 5-pho secretion signal.Also can use some commercial source that comprises desirable secretion signal carrier (as pYEX-S1, catalog number (Cat.No.) 6200-1, Clontech, Palo Alto, CA).
The scFv antibody fragment that produces can be used in method as known in the art such as enzyme-linked immunosorbent assay, Western blot, and immunostaining is analyzed and is characterized its avidity and specificity.(dissociation constant is higher than 10 to have suitable good affinity -6M) and specific scFv antibody fragment can perhaps express and further assemble mutually as the structural element of Fab expression vector with constant region for full length antibody.These human antibodies of assembling fully also can be expressed with secreted form in yeast.
Figure 11 has shown scFv, the Fab and the secondary structure of antibody of assembling fully.The proteic VH sequence of the selected scFv that encodes can with the constant region CH1 of complete antibody, CH2 links to each other with CH3.Similarly, V sequence L can join with constant region CL.The assembling of two unit VH-CH1-CH2-CH3 and VL-CL has just formed a Full Featured antibody.The invention provides a method of production global function antibody in yeast.The global function antibody that keeps the constant region remainder can have higher avidity (or avidity) than scFv or Fab.Complete antibody also should have higher stability, thereby allows that extensive antibody protein more effectively obtains purifying.
Here the method that provides is to utilize yeast cell can absorb and keep the ability of the multiple copied plasmid of identical copy origin.According to present method, different carriers can be used for expressing respectively heavy chain and light chain, also allows the antibody of the complete function of assembling in yeast.This method success is used in two-hybrid system, and this system is designed to except the selective marker difference, and BD is identical in skeleton structure with the AD carrier.This method has been used for expressing simultaneously at yeast the two-hybrid system of BD and AD fused protein.Except the selective marker difference, BD is identical in skeleton structure with the AD carrier.Two kinds of carriers can exist with high copy number in yeast.Chien.C.T. etc. (1991) " Thetwo-hybrid system:a method to identify and clone genes forproteins that interact with a protein of interest " Proc.Natl.Acad.Sci.USA 88:9578-9582.
In the present invention, heavy chain gene can place two different carriers with light chain gene.Under suitable condition, VH-CH1-CH2-CH3 and VL-CL sequence can be expressed in yeast and assemble, thereby form the antibody protein of the complete function with two heavy chains and two light chains.The antibody of this complete function can be secreted in the substratum and direct purifying from supernatant liquor.
ScFv with constant region, the antibody of Fab or assembling fully can be with method as known in the art purifying in addition.Routine techniques includes, but are not limited to ammonium sulfate and/or sad precipitation, ion exchange chromatography (as DEAE), and gel permeation chromatography.Delves (1997) " Antibodyproduction:Essential techniques ", New York John Wiley ﹠amp; Sons, the 90-113 page or leaf.Use is based on albumin A, the affinity matrix of Protein G or albumen L may be more effective and cause antibody to have high purity based on the method for avidity.Albumin A and Protein G are the bacterial cell wall-held proteins, and they combine with the Fc structural domain partly of some immunoglobulin (Ig) that different subclass IgG is had different binding affinities specifically and closely.For example, Protein G has higher avidity than albumin A to mouse IgG1 and human IgG 3.Albumin A can strengthen with diverse ways the avidity of IgG1, comprises using having the PH of rising or the binding buffer liquid of salt concn.Albumen L mainly interacts by the κ light chain and does not disturb antigen binding site to come binding antibody.Chateau etc. (1993) " On the interaction between Protein L and immunoglobulinsof various mammalian species " Scandinavian J.Immunol.37:399-405.Albumen L known can with the I of human kappa light chain, III, IV subclass and the combination consumingly of mouse κ chain I subclass.Albumen L can be used for purifying and comprise the people from various species, mouse, and all categories of rat and rabbit (IgG, IgM, IgA, IgD and IgE) has the antibody of κ chain accordingly.Albumen L also can be used for separating the scFv that contains suitable κ light chain and the affinity purification of Fab antibody.Reagent based on albumen L can be buied from Actigen company (Britain Camb).The said firm provides a series of recombinant protein products, comprises the consolidated form of the agarose conjugate that is used for affinity purification and recombinant protein L and comprises the A fusion rotein of four albumin A antibodies structural domains and four albumen L κ binding domainss.
Other affinity matrixs also can use, and comprise that those utilize peptide simulation part (peptidomimetic ligands), anti-immunoglobulin, the affinity matrix of maltose-binding protein and corresponding antigens.Peptide simulation part is similar with peptide but different.A lot of peptide simulation parts contain the amino acid of non-natural or chemically modified.For example, the peptide simulation part that is designed for antibody I gA and IgE class affinity purification can be from commercial available from Tecnogen, Piana di Monte Verna, Italy.Maltose-binding protein (MBP) is the seminose found in mammalian blood serum-and N-acetyl-glucosamine-special lectin.This lectin combines with IgM.The MBP-agarose that is used for purifying IgM can be buied from Pierce.
The immune magnetic method is about to affinity reagent (as albumin A or anti-immunoglobulin) and lumps together with the easy discrete group of being given by paramagnetic beads, and it can be used to the antibody that purifying is produced.Bag by the magnetic bead of albumen or respective secondary antibody can be by Dynal, the NY of company; The Bangs laboratory, Fishers, India and Cortex Biochem Inc., San Leandro, CA buys.
The antibody that direct expression and purifying screen from yeast has considerable superiority.As eukaryote, yeast than bacterium or other more unicellular lower eukaryote be the better system of expressing human source protein matter.More may be because yeast can make scFv, the antibody of Fab or assembling fully presents correct conformation (correct folding), and adds for example correct disulfide linkage and the glycosylation of posttranslational modification.
Yeast once was used to express the various human source protein in the past.A lot of people's source proteins are successfully from yeast production, as human serum albumin (Kang, H.A etc. (2000) Appl.Microbiol.Biotechnol.53:578-582) and the mixture of human telomerase albumen and RNA (Bachand F. waits (2000) RNA6:778-784).
Yeast has the Secretory Pathway that has been characterized fully.Identified much if not heredity and the biochemical character of the gene of whole these approach of adjusting.The understanding of these approach helped to design separate and the expression vector and the program of the antibody that purifying is expressed in yeast.
And yeast has few secreted protein enzyme.This can keep the excretory recombinant protein highly stable.In addition, yeast is not secreted multiple other albumen or toxic protein, so its supernatant liquor is often not contaminated relatively.Therefore, purification of recombinant proteins is simpler from the yeast supernatant liquor, and is efficient and economical.
In addition, developed better way method from the yeast cell isolated protein.((1998) " A mutation in the Rho ﹠amp such as Cid V.J.; GAP-encoding gene BEM2 ofSaccharomyces cerevisiae affects morphogenesis and cell wallfunctionality " Microbiol.144:25-36.Although yeast has thick relatively cell walls, this kind heavy wall is not present in bacterium or the mammalian cell, and yeast cells wall yeast cell after the cell detachment still can keep the yeast strain growth.By the yeast strain that grows in the yeast cell of acellular wall, the secretion of recombination human source antibody and purifying can carry out more easily and effectively.
Come expressing antibodies with yeast as host system, can set up a flow process and come with the form production recombinant antibodies of assembling and purifying fully.This has saved a large amount of time and energy with using any other system for example to compare with the complete human antibody of production in transgenic animal at external humanized antibody.
Concluded, by composition provided by the invention, test kit and method for screening at various targets have high-affinity and specific protein for example human antibody be very useful, described target comprises, but be not limited to soluble proteins (as somatomedin, cytokine and chemokine), embrane-associated protein (as cell surface receptor), and virus antigen.The structure in library, functional screening, and all processes of expressing highly multifarious human antibody library can be fairshaped, and in yeast with the form of high-throughput and automatization effectively and carry out economically.The albumen that is screened can have various application widely.For example, they can be used for treatment of diseases and diagnosis, and described disease includes, but are not limited to autoimmune disease, cancer, transplant rejection, transmissible disease, and inflammation.EXAMPLE Example 1: homologous recombination construction contains the expression vector in human single chain variable fragments antibody scFv library in the utilization body
Below illustrate the example that how to utilize common homologous recombination to make up recombination human source strand scFv library as effective way.Each member's of scFv library encoding sequence comprises the variable region of heavy chain V in the library that is derived from the human antibody all constituents HWith variable region of light chain V LMerge to form the double cross expression vector with two-hybrid system activation structure territory (AD) in yeast in the scFv library.1) separation of people source scFv cDNA gene pool
Utilization Sambrook, J. waits (1989) described method, produce complicated people source scFvcDNA gene pool, Sambrook, J., Deng (1989) Molecular Cloning:a laboratorymanual.Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; And Ausubel, F.M. etc. (1995) Current Protocols in Molecular Biology " John Wiley ﹠amp; Sons, NY.
Tout court, separate total RNA in the white corpuscle from the peripheral blood that provides by non-immune people is provided (mainly being the B cell).Obtain the 500ml blood sample from the healthy donors of Stanford hospital Blood Center, it comprises about 10 8The B-lymphocyte.Phenanthrene can on separate white corpuscle, and with the improvement the method isolation of RNA.Sambrook, J. waits (1989), supra; Zhu, L. waits (1997) " YeastGal4 activation domain fusion expression libraries " in " The YesatTwo-Hybrid System ", S.Fields and P.Bartle, Ed., Oxford UniversityPress, 73-98 page or leaf.
If, then use at first isolation of RNA of standard program from tissue.Ramirez, F. waits (1975) " Changes in globin messenger rNA content during erythroidcell differentiation " J.Biol.Chem.250:6054-6058; And Sambrook, J. waits (1989), supra.The first chain cDNA is synthetic can to carry out with methods such as Marks, wherein designs a cover heavy chain and light chain cdna primer so that constant region is annealed, and the cDNA's of initiation heavy chain and light chain (comprising κ and λ) is synthetic in isolating test tube.Marks waits (1991) Eur.J.Immunol.21:985-991.
Alternatively, people source spleen or lymphocyte cDNA also can directly buy from commercial channels and obtain as Clontech Palo Alto, CA.2) pcr amplification heavy chain and light chain gene
The encoding sequence of people source heavy chain and light chain gene can be with Sblattero and the described method of Bradbury (1998) the cDNA amplified library from above-mentioned generation, Sblattero and Bradbury (1998) Immunotechnology 3:271-278.This method can reach everyone the source V that covers from known Ig gene database near 100% H, V λ and V κ.Particularly, use from people's spleen cDNA library (people's spleen marathon-ready cDNA catalog number (Cat.No.) 7412-1, Clontech, Palo Alto, CA).Alternatively, also can use cDNA library from human lymphocyte (human lymphocyte marathon-ready cDNA catalog number (Cat.No.) 7406-1, Clontech, PaloAlto, CA).
V H, V λ and V kappa gene increase respectively by using for every class one cover blended 5 ' and 3 ' primer.V H, 5 ' and 3 ' primer of V λ and V kappa gene also comprises flanking sequence at two ends, they and clone library carrier, pACT2 homology (catalog number (Cat.No.) K1604-A, Clontech, Palo Alto, CA; Harper etc. (1993) " The p21 Cdk-interacting protein Cipl is aprotein inhibitor of G1 cyclin-dependent kinase " Cell75:805-816) in 5 ' end and the 3 ' primer sequence of holding, added homologous sequence with carrier library respectively.Carrier library can be used pACT 2 (Clontech Cat # K1604-A).Add the long 60bp of each flanking sequence of initial PCR product to.Should make V when designing the flanking sequence of these primers HAnd V LSegmental frame can be readed over upstream Gal4 frame, and described GAL4 frame is encoded by cloning vector.According to the cloning vector that uses in the next step,, also can in this step, add for example unique restriction enzyme recognition site (being used for subclone) of epi-position mark (being used for detecting and purifying) of further feature by design of primers.
With the scheme of Fig. 2 description, with the V of amplification H, V λ and V kappa gene sequentially are cloned in the pACT2 cloning vector in yeast by homologous recombination.Introduce carrier library pACT (seeing accompanying drawing 2).
Table 2 has been listed the primer that uses in the method for order homologous recombination right.Each V H5 ' primer (reverse primer) VH1b-VH7b contains the flanking sequence (underscore indicates) of 60bp, the upstream homology in this sequence and pACT 2 MCS sites.Each V H3 ' primer (forward primer) VH1f-VH6f contains the flanking sequence of 60bp, this sequence encoding joint peptide sequence (G 4S) 4(underscore indicates) [SEQID NO:75].V H5 ' primer and V H3 ' combination of primers is used with the heavy chain district from cDAN amplified library human antibody gene pool.The PCR fragment that obtains sequentially is inserted in the pACT2 carrier by the first step homologous recombination.
Each V λ (or V κ) 5 ' primer (reverse primer) V λ 1b-V λ 9b (or V κ 1b-V κ 4b) contains the flanking sequence of 60bp, this sequence encoding joint peptide sequence (G 4S) 4(underscore indicates).Each V λ (or V κ) 3 ' primer (forward primer) V λ 1f and V λ 2f (or V κ 1f-V κ 4f) contain the flanking sequence (underscore indicates) of 60bp, the downstream homology in this sequence and pACT 2 MCS sites.V λ (or V κ) 5 ' primer and V λ (or V κ) 3 ' combination of primers are used with the light chain district from cDNA amplified library human antibody gene pool.The PCR fragment that obtains sequentially is inserted in pACT 2 carriers by the first step homologous recombination.
PCR is reflected among the cumulative volume 50 μ l and carries out, and wherein contains 5 μ l from step 2 synthetic cDNA, 5 ' and 3 ' primer mixture of 20pmol concentration, 250 μ M dNTPs, 10mM KCl, 10mM (NH 4) 2SO 4, 20mM Tris.HCl (pH8.8), 2.0mM MgCl 2, 100mg/ml BSA, and 1 μ l (1 unit) KlenTaq archaeal dna polymerase (New England BioLabs, MA).Use the Perkin-Elmer thermal cycler that reaction mixture is carried out 30 round-robin amplifications.Cycling condition is: 94 ℃ 1 minute (sex change), 57 ℃ 1 minute (annealing), 72 ℃ 2.5 minutes (extension).V λ and V κ chain PCR product mixed in this stage.By electrophoresis detection PCR product and use the Qiax affinity matrix (Qiagen CA) from 1.0% sepharose purifying, and is resuspended in the 25 μ l water.3) alternative design: PCR assembles V HAnd V LBecome a chain
With overlapping PCR initiating method, with the V of above-mentioned separation and amplification HAnd V L(V λ and V κ) gene fragment is assembled into a single fragment.In this step, used and be added on V H3 ' end and V LFragment 5 ' end connector sequence.Typical connector area is that 4 amino acid whose series connection repeat (G 4S) 3-4, and the joint that uses in the present embodiment is (G 4S) 4[SEQ ID No:75].The V that each is independent HOr V LThe PCR product is about 420-480bp, and the V after the combination HOr V LThe about 800-850bp of fragment.By at V H3 ' the primer and the V of gene LThe homology joint sequence of sharing between the 5 ' primer of gene (V λ and V κ), assembling as above-mentioned amplification and isolating V in the PCR reaction HAnd V L(V λ and V κ) gene fragment.The PCR fragment that obtains is expressed as VH-L-VL, and described PCR fragment comprises by (G 4S) 4The V that joint L connects HAnd V LExcept cycle number is 20, be used for the condition and the V that increases respectively as described above of PCR assembling HAnd V LThe PCR condition of gene is identical.
Comprise V by the agarose gel electrophoresis analysis HAnd V LThe product of the PCR of gene fragment assembling, and with the Qiax method (Qiagen is CA) from the sepharose purifying.4) by homologous recombination in yeast, with heavy chain and light chain Fv fragment cloning in double cross AD carrier
By using the single fragment VH-L-VL of aforesaid combination, in a step, pass through homologous recombination, with the V of above-mentioned generation HAnd V LThe PCR fragment cloning of cDNA gene pool is in the double cross carrier that contains activation structure territory (AD).
The double cross carrier pACT2 that comprises the AD structural domain is available from Clontech, Palo Alto, CA.In the present embodiment, the pACT2 of 10 μ g makes its linearizing with restriction enzyme in multiple clone site (MCS) digestion.This carries out in comprising 20 μ l volumes of following reagent: 10 μ g carrier DNAs, every kind of restriction enzyme Bam H1 and Xho I 1-2 μ l, 10 times of damping fluids of 2 μ l.37 ℃ of digested overnight.Performance by the electrophoresis detection enzymic digestion.Linearizing carrier need not further to modify or purifying.
As described in the part 3, linearizing carrier DNA (10 μ g) with mix with single segmental form with the VH-L-VL fragment (the insertion fragment of about 5-10 molar excess) behind the amount pcr amplification.Linearizing carrier DNA and PCR fragment cotransformation (are belonged to competence yeast strain Y187 αMating type, Clontech).
The following conversion: the yeast competent cell is with Lithium Acetate (LiAC) method preparation (Gietz, Deng (1992) " Improved method forhigh efficiency transformation ofintact yeast cell " Nucleic Acids Res.20:1425, or available from commercial source (LifeTechnology Inc.MD).For the structure of gene library, minimum needs 10 6The yeast conversion rate of transformant/μ g DNA.The yeast competent cell that is derived from 1 liter of OD600=0.2 culture is used for carrying out each conversion at 50ml tapered bottom test tube.Yeast cell thaws at 4 ℃ earlier, use deionized water wash, is resuspended to 8ml 1 * TE/LiAC (1 * TE/LiAC is by 40% Macrogol 4000,10mMTris-HCl, 1mM EDTA, pH7.5 and 0.1M Lithium Acetate prepare) then.Add in the test tube and vortex with comprising linearized vector with the segmental DNA mixture of insertion with pcr amplification of extending end.This test tube is shaken (200rpm) at 30 ℃ hatched 30 minutes.Join DMSO (dimethyl sulfoxide (DMSO), 700 μ l) in the test tube and slowly mixing.Cell in the test tube is followed vortex heat shock once in a while 15 minutes in 42 ℃ of water-baths.After the heat shock,, and wash with water one to twice by 4 ℃ of simple centrifugation cells.Cell is resuspended in 1 * tbe buffer liquid of 1.5ml.
Yeast cell is inoculated into by in the flat board of selecting substratum to make.For yeast Y187 bacterial strain, use the SD/-Leu substratum.Harper waits (1993) supra.The conversion that makes up the library scale needs the massive plate of about 100 150mm diameters.Be inoculated on the identical selection flat board in contrast with not containing the Y187 that transforms linearized vector that inserts dna fragmentation or the insertion sequence that does not contain linearized vector.The Y187 that transforms with non-linearization carrier pACT2 is used for the contrast of transformation efficiency and inoculates with serial dilution.The flat board of inoculation was inverted cultivation 3 days or the longer time for 30 ℃.Check and record colony number.The yeast controls of carrying out with non-linearization pACT 2 transforms and produces at least 1 hundred ten thousand transformant, estimates can obtain from each this conversion 1,000 ten thousand strand library recombinant clone so.Compare with the conversion that carrier/the insertion fragment combination is carried out, any separately with linearized vector or insert contrast that fragment carries out and transform and estimate only to produce 1/10 or the bacterium colony of lesser number.Repeating such single step transforms until acquisition 100,000,000 or more independent cloning.
For in part 2) described in independent V HAnd V LThe PCR product is with the scheme of describing among Fig. 2, with V HAnd V LFragment is inserted into the pACT2 cloning vector of improvement respectively.This is by by two the independently order formed of homologous recombination realizations that are converted in vivo.
The sudden change improvement that initial pACT2 plasmid is instructed by oligonucleotide.Figure 13 shows the method for pACT2 plasmid map and improvement.As shown in figure 13, comprise coding joint peptide G 4S) 4Be inserted into the downstream of AD structural domain terminator codon among the pACT2 with the oligonucleotide of the restriction site (for example BssHI and PacI) of minority uniqueness.Table 3 has been listed the sense strand [SEQ ID NO:46] and the nonsense strand [SEQ ID No:47] of the oligonucleotide that is used to improve pACT2.
The have justice and the nonsense strand of listing in the table 3 are annealed and by T4 DNA kinases (New EnglandBiolabs, MA) phosphorylation.The annealed double chain DNA fragment comprises following feature in this case: the cohesive end of Xho I (having function after the connection), (G 4S) 4Joint sequence, the BssH2 site; Pac I site is with another cohesive end (being connected the no function in back) of Xho I.By shown in Figure 13, the annealed fragment is connected on the pACT2 of Xho I digestion subsequently, and it is by the calf intestinal alkaline phosphatase dephosphorylation.After confirming to insert the direction of fragment in novel vector (called after pACT 2-GS), the two-step approach homologous recombination can be carried out.
Yeast clone carrier pACT 2-GS with BamH I and Xho I digestion improvement.In yeast cell by homologous recombination, as part 2) as described in PCR fragment independently V HAnd V LBe attached in the linearizing pACT2-GS carrier with inserting fragment order.
By homologous recombination, V HThe PCR fragment is inserted into the downstream of BamH I and the linearizing pACT2-GS carrier A of Xho I-D structural domain, but at (G 4S) 4The upstream of joint sequence.This transforms preferred at least 1 hundred ten thousand clone independently that produces.
After first round homologous recombination, the mixed yeast cell, and extraction has V HInsert segmental plasmid DNA, be transformed into bacterial cell then and be used for the plasmid preparation.Competence coli strain KC8, the competence of chemical method or electric shocking method preparation is (respectively available from Clontech, Palo Alto, CA, catalog number (Cat.No.): C2004-1 or #C2023-1) can be used for the pACT 2 of amino acid complementation easily as the leucine mark of selecting to have it.From the plasmid of KC8 cell large scale preparation be used for second take turns pass through the independently yeast conversion of homologous recombination.
With PacI at (G 4S) 4The downstream linearizing of joint sequence has V HInsert segmental pACT 2 carriers.The PacI-linearized vector (10 μ g) that obtains and the PCR fragment of VL are transformed in the Y187 yeast cell, in this cell, the VL fragment by the second time homologous recombination be inserted in the carrier.Transformant is inoculated on the SD/-Leu selectivity flat board once more.This transforms preferred generation 100,000,000 or more independent cloning.These clones have people V HAnd V LChain secondary homologous recombination library clone.
As above the yeast library recombinant clone of Chan Shenging scrapes from final culture plate after growth 5-7 days.Most yeast and 50% (volume) mixes, and is stored in-80 ℃ and is used for further library screening.The sub-fraction yeast clone is used for following mass analysis:
A. the per-cent of recombinant clone: use with the primer of carrier flank sequences match to (as the long PCR primer of the AD carrier that provides by Clontech to) directly insert fragment (relying on 2) or 3 from the yeast pcr amplification) and the program used, VH-L-VL insertion fragment or the V in independent PCR fragment in the single PCR fragment that increases HAnd V L) can disclose how much the clone recombinates.Since our design be used to insert the extension homologous region sufficiently long (about 60bp) of recombinating between fragment and the cloning vector, can expect acquisition a high proportion of recombinant clone (being higher than 95%).Preferred preservation has the library of minimum 90% recombinant clone to be used for screening.
B. insert clip size: selected clone's identical pcr amplification can disclose and insert segmental size.Although the library of small portion may comprise dual insertion fragment or other forms of multiple insertion fragment, great majority (more than 95%) comprise to have estimates big or small single insertion fragment.
C. finger printing detects the diversity of sequence: for example BstN I or any 3-4 discern enzyme (cutters) and make finger printing the pcr amplification product with correct size with common digestion restriction enzyme.From the form of agarose gel electrophoresis, can determine whether that clonal analysis has identical characteristic or has unique or different characteristics.The PCR product also can be used for direct order-checking.This will disclose the fidelity of reproduction that inserts segmental characteristic and clone's program, and will confirm clone's independence and diversity.Clone for 100 if check order, estimate that then the clone of a small part (＜5%) has a plurality of isolates.Embodiment 2: by scFv library, recombination to construct people source in the body of CRE/LoxP mediation
In this embodiment, described use V-district gene fragment and in yeast, made up high complexity and multifarious combinatorial library as member
At first, the scFv library, people source that in yeast, produces particular type by the dated standard homologous recombination procedure of underscore in embodiment 1.This library is by 10 7Or the various and complicated V-district gene pool that is derived from heavy chain and light chain origin of higher height.A storehouse (as VL or light chain gene fragment) contains useful two inconsistent lox P sites at two ends.Lox P site is designed in the primer sequence, and described primer sequence is used for a step of pcr amplification step.The example in lox P site is listed in the table 1.
Particularly, two inconsistent LoxP sites, LoxP 1[SEQ ID No:4] and LoxP 2[SEQ ID No:5] (table 1), can design at the V in cDNA library that is used to increase HAnd V LIn the PCR primer of gene fragment, as the part 2 of embodiment 1) as described in.
Table 4 enumerated be used in combination be used for increasing V from the cDNA library HAnd V LThe primer of gene fragment is right.Each V H5 '-primer (reverse primer), VH1b-VH7b contains the flanking sequence (underscore indicate) of 60bp, the upstream sequence homology in the MCS site of this sequence and pACT 2.These primers are with the V that is used to increase not in conjunction with the loxP site HThe primer of gene fragment is identical
Each V H3 '-primer (forward primer), VH1 ' f-VH6 ' f contain the flanking sequence (underscore indicates) of 63bp.V H5 '-primer and V H3 '-combination of primers is used with the heavy chain district from cDNA amplified library human antibody gene pool.(annotate: the PCR product of acquisition can be used for being inserted in proper order in the pACT2 carrier, as shown in Figure 2) by the first step homologous recombination.
Each V λ (or V κ) 5 '-primer (reverse primer), V λ 1 ' b-V λ 9 ' b (or V κ 1 ' b-V κ 4 ' b) contains the flanking sequence of 63bp, this sequence and V HThe 63bp flanking sequence complementation of 3 '-primer, and each comprises these sequences with 5 '-3 ' order: (G 4S) encoding sequence, LoxP1 site, and G 3S encoding sequence (underscore indicates).
Each light chain V λ (or V κ) 3 '-primer (forward primer), V λ 1 ' f-V λ 2 ' f (or V κ 1 ' f-V κ 4 ' f) contains the flanking sequence (underscore indicate) of 30bp, and this sequence is part loxP2 site.Be used in combination V λ (or V κ) 5 '-primer and V λ (or V κ) 3 '-primer with light chain district from cDNA amplified library human antibody gene pool.Obtain the PCR fragment by use a 3 ' new-primer (in table 4, classifying V λ/V κ f primer as) in secondary PCR, do further pcr amplification with obtain complete LoxP M2 site and with downstream, pACT2 MCS site homologous sequence.This design will allow to use shorter PCR primer amplification VL gene.(annotate: the VL fragment of amplification can be used for being inserted in proper order in the pACT2 carrier, as shown in Figure 2) by the second step homologous recombination.
PCR is reflected in the 50 μ l volumes and carries out, and wherein contains the synthetic cDNA from step 2 of 5 μ l, the mixture of 5 ' and 3 ' primer of 20pmol concentration, 250 μ M dNTPs, 10mM KCl, 10mM (NH 4) 2SO 4, 20mM Tris.HCl (pH8.8), 2.0mM MgCl 2, 100mg/ml BSA, and 1 μ l (1 unit) KlenTaq archaeal dna polymerase (New England BioLabs, MA).Use the Perkin-Elmer thermal cycler to make reaction mixture carry out 30 round-robin amplifications.Cycling condition is: 94 ℃ 1 minute (sex change), 57 ℃ 1 minute (annealing), and 72 ℃ 2.5 minutes (extension).Mixed at this step V λ and V κ chain PCR product.By electrophoresis detection PCR product and use the Qiax affinity matrix (Qiagen CA) from 1.0% sepharose purifying, and is resuspended in the 25 μ l water.
With overlapping PCR initiating method as shown in Figure 3, with the V of above-mentioned separation and amplification HAnd V L(V λ and V κ) gene fragment is assembled into a single fragment.In this step, used and be added on V H3 ' end and V LFragment 5 ' end connector sequence.In this case, joint sequence contains (G 4S) encoding sequence, LoxP1 site, and a G 3The S encoding sequence.
The V that each is independent HOr V LThe PCR product is about 420-480bp, and the V after the combination HOr V LThe about 800-850bp of fragment.By at V H3 ' the primer and the V of gene LThe homology joint sequence of sharing between the 5 ' primer of gene (V λ and V κ), assembling as above-mentioned amplification and isolating V in the PCR reaction HAnd V L(V λ and V κ) gene fragment.The PCR fragment that obtains is expressed as VH-loxP1-VL-loxP2, and it comprises V HAnd V L, wherein VL is by loxP1 and loxP2 side joint.Except cycle number is 20, be used for the condition and the V that increases respectively as described above of PCR assembling HAnd V LThe PCR condition of gene is identical.
Single heavy chain or light chain PCR product length are 420-480bp, and the length that the heavy chain after the assembling adds light chain is 800-850bp.Single fragment after the reorganization contains heavy chain and light chain, and light chain is by LoxP1 and LoxP 2 both sides adjacency: V H-LoxP1-V L-LoxP 2.Increase the separately PCR reaction conditions of heavy chain and light chain segments of assembling heavy chain and the PCR reaction conditions of light chain and before being used for is identical, uses 20 circulations only.
Comprise V by the agarose gel electrophoresis analysis HAnd V LThe product (VH-loxP1-VL-loxP2 fragment) of the PCR of gene fragment assembling, and with the Qiax method (Qiagen is CA) from the sepharose purifying
According to the scheme of describing among Fig. 3, VH-LoxP 1-VL-LoxP 2 fragments are inserted pACT 2 carriers by the mode of homologous recombination in the body.Program and being used for of describing in the part 4 of embodiment 1 are carried out homologous recombination between pACT 2 and VH-L-VL fragment program is identical.
Produce the library and accumulated 10 7Behind the individual independently clone, the complete library that comprises the pACT 2 of VH-loxP1-VL-loxP2 sequence is separated from the blended yeast clone, and is transformed into coli strain KC8 by yeast and the total leucine nutrition mark complementation of intestinal bacteria subsequently.Bacterial isolates KC8 has his B, leu B and trp C sudden change.These sudden change show amino acid disappearances also can be used to come from the corresponding gene of zymic complementary.See Yeast Protocol Handbook, Clontech, PT3024-1,33 pages).
Use lyticase scheme separation quality grain storehouse from yeast.See Guthrie and Fink (1991) " Guide to yeast genetics and molecular biology " in Methods inEnzymology (Academic Press, San Diego) 194:1-932.Briefly, the library clone that grows in the selectivity flat board is scraped and is resuspended in 1 * TE.With 1: 5 (volume: volume) ratio with freshly prepared 5 units/μ l lyticase (MS) solution adds in the sterilised yeast suspension for Sigma, St Luis, then with mixture 37 ℃ of insulations 60 minutes, shake once in a while to increase and mix.The degree of yeast cells wall digestion can be detected with dissecting microscope.If yeast cells wall thoroughly digests, yeast cell will be cracking at water or low salts solution neutrality.When digestion when complete, (volume: volume) ratio added 20% SDS solution, continues insulation several minutes with 1: 5.Make sterilised yeast suspension experience several freeze-thaw circulations by test tube being positioned over dry ice and water-bath (37 ℃).In this stage, supernatant liquor can pass through the DNA fractional column, for example available from Clontech, and Palo Alto, the CHROMA Spin 1000 of Ca.Fractional column is disposed cell debris and other composition, only allows plasmid DNA pass through.Plasmid DNA can be collected by washing with 1 * TE.
The yeast plasmid DNA that collects like this can be in order to transformed into escherichia coli KC8 (chemistry or electricity swash the competence KC8 cell that makes can be available from Clontech, catalog number (Cat.No.) C2004-1 or C2023-1).In this case, when bacterial cell was transformed by the plasmid storehouse from yeast separation, the selection flat board that the M9 minimum medium is made was used for inoculated bacteria.Be present in yeast strain and the bacterial isolates because the nutrition selective marker of sharing is the leucine disappearance, carry dominant marker's plasmid and can from bacterium, be rescued.At last, the KC8 cell is grown, and from KC8 cell large scale DNA isolation, this DNA isolate is used for blended dna library subsequently.
Use conventional simple substance grain to transform scheme then, this blended DNA source is incorporated among the yeast host bacterial strain Y187 again.The condition of conversion is set so that more a plurality of plasmid enters into each single yeast cell.Confirm that as two-hybrid system yeast can absorb a plurality of plasmids, two-hybrid system is designed to AD and coexists as in the identical yeast host cell with the BD plasmid.The standard of carrying out with the DNA of 1 μ g level yeast conversion on a small scale will produce and on average have 30-50 yeast transformant that copies plasmid.
By in step of converting, using higher DNA-yeast ratio many plasmids can be entered the yeast maximization.But but the yeast cell prerotation dissolves the plasmid of abduction delivering CRE recombinase.But the abduction delivering of CRE in yeast strain can cause the site-specific reorganization that produces the CRE mediation in the LoxP site of each light chain gene fragment flank.Therefore, grown and plasmid in yeast cell when producing extra copy, the reorganization of light chain gene fragment VL (V λ and V κ) will be taken place in yeast cell when yeast.The method of the chain reorganization of CRE/loxP-mediation is illustrated in Fig. 4 A.
If this reorganization is completely random, and finish with storehouse completely, heavy chain and the light chain combination sum in yeast cell will increase with index so.Therefore, can produce and have at least 10 9The library of recombinant clone.In theory, if initial library has 10 7Complexity, the complexity in the library of then recombinating can reach 10 14
Reorganization in yeast does not need any mark to select.No matter the CRE/LoxP reorganization has or do not have screening all can take place.The key of this embodiment success is that plasmid repeatedly enters yeast cell, and this is the standard of yeast conversion.Can detect the pattern that this plasmid repeatedly enters by the GFP variation plasmid that uses different colours.For example, being loaded with the plasmid of GFP (encoding green fluorescent protein) or YFP (mutant form of GFP, coding yellow fluorescence protein) can be by 1: 1 mixed as yeast conversion.These two kinds of plasmids are formed their structurally indifferences according to selective marker or plasmid except that expression cassette (GFP or YFP) difference.The coding region length of these two kinds of fluorescins is identical, each other only in few amino acid difference (S65G, V68A, S72A and T203Y) referring to Miller, D.M. (1999) Biotechniques 26:914-918.The expression vector library of this antibody coding variable region, the two kinds of similar carrier of plasmid sources is because all antibody molecule same length are only formed different, most of in low variable region each other at a spot of amino acid.If yeast holds a plurality of fluorescin plasmids, the yeast that some part transforms will show the color spectrum of combination.Some clones will show the mosaic phenotype.This detection also can be used for optimizing the condition that many plasmids transform.Embodiment 3: two of the people source scFv library-design by the very high complexity of recombination to construct in the body that utilizes CRE/LoxP mediation.
Be to use the multiple conversion of " pressure " with respect to a kind of alternative approach of the method in the scFv library of describing among the embodiment 2, recombination to construct source that utilizes the CRE/LoxP mediation.In this design, in two carriers with different choice mark (as Leu 2 and Ade 2), produce respectively and comprise people source heavy chain and scFv library, the segmental two kinds of initial people sources of light chain gene.By the selection of two kinds of marks, can guarantee that each yeast cell has two types library clone (each can have copy multiple but variable number).Shown in Fig. 4 B, activation and the expression of Cre recombinase in yeast allows to take place the reorganization that CRE/LoxP mediates.
By using embodiment 2 described programs, in yeast, produce two kinds of specific scFv libraries, people source by homologous recombination.Increase and clone's program in the RNA in these two kinds of libraries source in addition, identical.The RNA source in these two kinds of libraries, amplification, and clone's all identical unique different cloning vector difference that is to use of program.A kind of library comprises by having the pACT2 people source scFv library of carrying of Leu 2 as the not improvement of selective marker, and another kind of library comprises by having the scFv library, people source that the pACT2 of Ade 2 as the improvement of yeast selective marker carries.Each library comprises 10 7Or higher height is various and the complicated V-district gene pool that is derived from human antibody heavy chain and light chain source.In yeast, by homologous recombination, the VH-loxP1-VL-loxP2PCR fragment that produces in embodiment 2 is inserted into the linearizing pACT2 carrier with Leu 2 respectively and has in the linearizing pACT2 carrier of Ade 2.The result has different selective markers by two scFv libraries that two different pACT2 carriers carry.
When two kinds of libraries all reach 10 7The independent cloning level after, complete library DNA can be separated from blended yeast library clone, is transformed among the bacterial isolates KC8 by bacterium-yeast leucine nutrition mark complementation then.This program is similar to the program described in the embodiment 2.From two libraries, carry out extensive DNA isolation, and two dna libraries are preserved respectively from KC8.By using conventional simple substance grain to transform scheme, with 1: 1 ratio with these two blended DNA source cotransformations in yeast Y187 cell.
Y187 has following genotype: Mat α, ura3-52, his3-200, ade2-101, trp1-901, leu2-3,112, gal 4 Δs, met, gal 80 Δs, URA3::GAL1 UAS-GAL1 TATA-Lac E.Harper etc. (1993) Cell 75:805-816.Its allows two types plasmid selected and kept by leucine and VITAMIN B4.The condition that transforms is similar to the plasmid conversion condition of standard, and can be modified to reach the maximum efficiency of conversion.
Transformant is inoculated on the SD/-Leu/-Ade substratum library plasmid to screen two types.Any yeast clone of selecting to form on the substratum this pair must be transformed by two types library clone.Every type library clone is a multiple copied, usually each cell 30-50 copy.Except the special individual cells of minority, the pairing of two kinds of library clones will be completely at random in most of cell.
Similar to the yeast cell among the embodiment 2, but another plasmid of abduction delivering CRE recombinase is transformed in the yeast cell in advance.But the abduction delivering of CRE recombinase in yeast strain causes at side joint and the segmental LoxP of each light chain gene site the homologous recombination that Cre mediates taking place.
Therefore, grown and plasmid in yeast cell when producing extra copy, the reorganization of light chain gene fragment VL will be taken place in yeast cell when yeast.The process of the site-specific reorganization of CRE/LoxP mediation is illustrated in Fig. 4 B.Suppose this reorganization be completely random and finish with complete storehouse, in yeast cell weight and light chain the combination sum will by with exponentially the increase.Therefore we can produce and have at least 10 9The library of recombinant clone.In theory, the complexity in library can reach 10 14If each has 10 two initial libraries 7Complexity.Embodiment 4: come in yeast with the antibody strand Fv library of two-hybrid system screening at definite proteantigen by the mating between two primary yeast bacterial strains
This embodiment has described the program that is used for screening antibody scFv library of generation in embodiment 1,2 and/or 3. αProduce in the yeast strain of mating type and comprise people V HAnd V LSegmental scFv library.With simple mating program can with the yeast of this mating type with aThe type yeast carries out mating, to produce the diploid yeast cell.Guthrie and Fink, (1991) " Guide to yeast geneticsand molecular biology " in Methods in Enzymology (Academic Press, San Diego) 194:1-932. aYeast comprises target (probe or bait) plasmid.
The target plasmid comprises the syzygy that is formed by GAL 4 DNA-combined function territories (BD) and any target protein, and described target protein is used as probe to filter out the antibody as its affinity ligand.When two types yeast cell mating formed diploid, probe plasmid and library clone plasmid also concentrated in the same cell.Therefore, if specific antibodies scFv clone identification and bonding probes albumen, then each of these albumen or protein fragments will be taken their fusion part (GAL4 AD and GAL4BD) near the promoter region of reporter gene to.In this case, yeast cell (parent aAnd/or αThe type haploid cell) the reporter gene construct that makes up in will be activated by active GAL4 albumen.Therefore, reporter gene is expressed, and detects positive signal in the library screening process.Some reporter gene is the nutritional type reporter gene, and it allows yeast to grow on specific selective medium flat board.
In fact, with the yeast strain that contains bait of equivalent ( aType) and contain the scFv library yeast strain ( αType) be inoculated in the selected liq substratum, 30 ℃ of concuss were cultivated 20 hours.Then these cultures are mixed in single flask, and 30 ℃ slowly under the concussion at rich medium 1 * YPD (20 grams per liter beef extract-peptones (Difco peptone), 10 grams per liter yeast extracts, and 2% glucose) middle continued growth 12-16 hour.Be rich under the culture condition of nutrition, two kinds of haploid yeast bacterial strains meet and mating formation diploid cell.At the end of this mating process, an ideal part---5%-10% be present in the mating pond the yeast population form diploid.Bendixen, C., Gangloff, S. and Rothstein R. (1994), " A yeastmating-selection scheme for detection of protein-protieninteractions " Nucleic Acids Res.22:1778-1779.
After the mating, wash yeast cell with water several times, be inoculated in and select on the flat board, use the SD/-Leu/-Trp/-His/-Ade screening.Preceding two kinds of selections are selective markers (Leu and Trp) of expressing from carrier, are used for keeping in identical yeast cell BD and AD carrier.Selecteed cell is a diploid cell, because haploid cell is only expressed a kind of of these marks.The two kinds of marks in back are expressed by the reporter gene itself from host strain, are used for being chosen in showing positive interactional clone between scFv library member and the target protein.Embodiment 5: screen the single-chain Fv antibody library at antigen library in yeast two-hybrid system.
For the preselected probe of minority, the mating program is enough separately as described above.Yet this program can be carried out improvement, makes it to be applicable to the screening of a large amount of different targets or probe.Below described the potential probe, their numbers are a lot of and may be unsuitable for independent mating screening:
A. the total library of the aggregate of people source EST, or people EST.This EST aggregate can the library form available from public source, described library has array in the 96-hole or the one clone of 384 hole flat boards.EST from initial aggregate (usually in bacterial clone and sequencing vector) inserts fragment by pcr amplification, and has the homologous sequence of extension at two ends.EST inserts fragment can be by pcr amplification, and extra flanking sequence two ends that can add EST to by PCR are with in order to mediate homologous recombination in yeast.Then, by the identical homologous recombination procedure of describing in embodiment 1 and 2, EST inserts fragment can be cloned into the AD carrier.Maximum three homologous recombination just can guarantee that any one EST can form readable logical fused protein with GAL 4 AD.Hua, S.B. etc. (1997) " Minimum length of sequence homology required in vitrocloning by homologous recombinatin in yeast " Plasmid 38:91-96.
B. the aggregate of some structural domain structure, zinc finger protein structural domain for example, each contains 18-20 amino acid.These structural domain structures can not be completely randoms.Can prepare have characteristic conservative and at random/the synthetic oligonucleotide of degeneracy residue to be to cover most Rational structure domain structure.
C. each has the completely random peptide library of 16-20 amino-acid residue.This library also can be synthesized by random oligonucleotide and be prepared.This library has been structured in the AD carrier.Yang, M waits (1995) " Protein-protein interactions analyzed with the yeasttwo-hybird system " Nucleic Acids Res.23:1152-1157.This probe library also can be structured in the BD carrier.Each clone in this library represents a small peptide.Can screen scFv antibody library (being structured in the AD carrier) at this probe library, the peptide part of each scFv antibody can be selected.This class peptide may have potential in antigenic appropriate design and structure aspect improving and use.
In the BD carrier, and each and GAL4 BD structural domain merge with the probe library clone.Each clone by the acquisition that will merge with the BD-probe is inoculated in each hole of 96 or 384 hole flat boards, and this library is referred to into the array clone library.This array format has promoted with the assisted automated extensive library screening of machine.
Before using probe library screening scFv library, the probe library is transformed into aIn the type zymic host strain to filter out the clone of all autoactivations.This prescreen makes yeast only comprise the probe plasmid with growth in selecting substratum (SD/-TrP-His), and checks the activation of no AD mating part, promptly so-called self activation.
Alternatively, have α-or the selection substratum of beta-galactosidase enzymes substrate in carry out prescreen.All positive colonies will produce positive reaction, and can easily detect by naked eyes or by instrument.The clone who sends expression reporter gene activatory positive signal is the clone of autoactivation, and they are not subsequently as the target in scFv library.
By using 96-or 384-hole flat board to carry out the auxiliary automatically screening of machine. aThe target clone of bacterial strain sequentially is inoculated in the flat board this flat board quilt αThe array library in the scFv library of bacterial strain is inoculated in advance.The mating and form diploid in rich medium of two haploid yeast bacterial strains.The hole of the positive signal of reporter gene expression is sent in detection.This screening process in embodiment 3, describe to carry out one target screening at the library in mixed culture similar.Difference is when relate to a large amount of targets and scFv antibody, clones mating (mating between at the single target of single scFv) herein and raises the efficiency embodiment 6: screen in by external random mutagenesis and the body in yeast two-hybrid system again and make scFv primary separation thing maturation
The avidity that can have various degree from the isolating scFv of embodiment 1-3.Although the possibility that the clone of high-affinity also can be low obtains, most clone needs further modification, and (dissociation constant is 10 to reach the avidity consistent with natural antibody -9M or lower).
In this embodiment, the elementary scFv of vitro mutagenesis clone's sequence is with at V HAnd V LDistrict's combination sudden change at random, thus foundation has the secondary scFv library of the complexity of increase.The complexity of estimating secondary library should be 10 4Or it is higher.Therefore, the complexity after the stack of the elementary library of screening and secondary library just can reach 10 14-10 18, be not less than the diversity of the natural antibody that reaches by screening/maturation in animal.
By PCR, the V of the selected scFv of amplification from corresponding scFv clone HAnd V LThe encoding sequence in district.V HAnd V LThe district is arranged in the AD carrier and merges with GAL4 AD structural domain.Use one couple of PCR primers specific amplified V from carrier HAnd V LThe district.Design PCR primer is to be complementary with the zone of side joint at the cloning vector of V-district gene.These zones comprise the sequence that is used for carrying out homologous recombination between the product of cloning vector and amplification.The PCR product is estimated about 0.8kb.
By the length of agarose gel electrophoresis detection of primary PCR product and the output of gained.The elementary PCR product of five equilibrium carries out secondary PCR subsequently.Designing secondary PCR under the following conditions suddenlys change with combination in product: the Mn that comprises high density in the PCR reaction 2+, a kind of Nucleotide substrate of high density disproportionately.0.4-0.6mM the Mn of concentration 2+Can effectively cause the combination sudden change in the PCR product of Taq polysaccharase.This mispairing is that the malfunction by the Taq archaeal dna polymerase causes.A kind of mononucleotide (as dGTP) that exists with the concentration more much higher than the concentration of other three kinds of basic Nucleotide (dATP, dTTP and dCTP) causes that this high concentration substrate erroneous combination also produces sudden change in template.
Except above-mentioned two kinds of conditions listing, other conditions also can influence the speed of " mistake " Nucleotide erroneous combination in the PCR product, comprise PCR round-robin number of times, the kind of the archaeal dna polymerase of use, and the length of template.In this embodiment, used the ready-formed test kit (diversity PCR random mutagenesis test kit (Diversity PCR Random Mutagenesis Kit), catalog number (Cat.No.) K1830-1, Clontech, Palo Alto, CA).This test kit comprises for the necessary reagent of optimizing by the PCR random mutation of condition, dNTP mixture for example, additional dGTP solution, manganous sulfate, and contrast pcr template and primer mixture.
Advise according to this test kit service manual, use following condition to carry out PCR mutagenesis: 640 μ M MnSO 4, 200 μ M dGTP.Under this condition, estimating has average 8 sudden changes in per 1000 bases, and this speed is enough for the scFv diversity.
By homologous recombination secondary scFv library is introduced in the yeast again, and use the program similar directly screening in yeast to the elementary screening of in embodiment 3, describing.This all processes is simulated more, and higher organism comprises affine ripening process people's heredity, natural generation.Embodiment 7: the expression and purification of Zu Zhuan human antibody in yeast fully
By the elementary screening described in embodiment 1-6, affine maturation and secondary screens process have selected the target antigen that provides is had the specific scFv human antibody of high-affinity., selected antibody can directly be expressed in yeast.
Use yeast to have several advantages as expressive host.The first, as a kind of eukaryote, yeast is than bacterium or other system of the better expressing human source protein of unicellular lower eukaryote more.More may be because yeast can make scFv, the antibody of Fab or assembling fully presents correct conformation and configuration (having correct protein folding), and adds for example disulfide linkage and glycosylation of posttranslational modification.The second, yeast has been developed and has been used to express the various human source protein in the past.A lot of people's source proteins are successfully from yeast production.The 3rd, yeast has the Secretory Pathway that has been characterized fully.Identified much if not heredity and the biochemical character of the gene of whole these approach of adjusting.The 4th, yeast has few secreted protein enzyme.This can keep the excretory recombinant protein highly stable.In addition, yeast is not secreted for example PLS of multiple other albumen or toxicant.So supernatant liquor is often not contaminated relatively.Therefore, purification of recombinant proteins is simple and ideal from the yeast supernatant liquor.
By using yeast as the host system of expressing, the process that can set up a cover streamline is to produce the recombinant protein of assembling fully and purified form.Compare with other system that relates to animal of use, this will save time and energy.
With from corresponding clone, the increase V of selected scFv of primer HAnd V LThe district, this primer adds enough homologous recombination sequences in the PCR product to simultaneously.These PCR products together are incorporated in the yeast strain with linearizing expression vector subsequently.By homologous recombination, produced new annular carrier, it is included in the V that the upstream is connected with the ideal promotor, is connected with terminator codon and transcription termination signal in the downstream HAnd V LThe district.Secretion signal also is added to V HAnd V LSegmental 5 ' end makes recombinant protein to express with secreted form.
Some commercially available carrier provides secretion signal.In this embodiment, in order to simplify final purifying, the PCR fragment of scFv sequence can be cloned in such carrier.This expression vector comprises for example ADH1 (Ruohohen of composition type expression promoter, Aalto and Keranen (1995) " Modification of the ADH1 promoter of Saccharomyces cerevisiae forefficient production of heterologous proteins " Journal ofBiotechnology 39:193-203), but or the promotor of induction type for example Gal 1 (Flick and Johnston (1990) " Two systems of glucose repression of the GAL1promoter in Saccharomyces cerevisiae " Mol.Cell.Biol.10:4757-4769) GCN4 (Mimran etc. (2000) Biotechniques, 28:552-560).Preferred GCN4 inducible promoters is because can easily realize inducing by 3-AT being joined in the yeast culture base.Therefore the scFv antibody fragment that produces can be used for detection such as the enzyme linked immunological absorption test in routine, estimates avidity and specificity in Western blot or the immunostaining.If good avidity and the specificity of they performances, they can be used as member in the Fab expression vector, or further assemble (seeing below) in order to express full length antibody and constant region.
The yeast strain that is used to express can be any reference culture with nutrition selective marker.It is different with the mark of AD carrier to be used to the mark of expressing in the present embodiment.This will help avoid potential and carry problem.
And, utilize yeast can accept and keep the plasmid with same replication orgin of multiple copied, Zu Zhuan human antibody also can be expressed in yeast by secreted form fully.This successfully is used for two-hybrid system, and this system is designed to except the selective marker difference, and BD and AD carrier are identical on skeleton structure.Therefore in the present embodiment, with two kinds of different carrier coexpression heavy chain gene and light chain genes.Therefore, the complete function antibody albumen with two heavy chains and two light chains can be deposited in the yeast assembling justacrine in substratum.This step is not only given final product with higher avidity (or avidity) and stability, and makes that the purifying of excretory product is easier.Identical method is used in assembling Fab fragment in the yeast.
Use albumin A, albumen L, or Protein G is as affinity matrix, but purifying has constant region scFv, Fab or the antibody of assembling fully.The protein of these bacterial origins is the part of naturally occurring high-affinity for most of kinds of antibody.They can have been bought on market, and have been widely used in small-scale and large-scale antibody purification.
Below describe the segmental example of the scFv of expression-secretion in yeast in detail.This method also is easy to be used to express Fab or full length antibody (as IgG).
Plasmid pGES 426 (Mimran, Marbach, and Engelberg (2000) BioTechniques 28:552-560) can be used as Yeast expression carrier.This plasmid contains the skeleton of deriving and from pBluescript, 2 μ yeast replication orgin (helping keeping high copy number plasmid) and at upstream total length GCN 4 regulating and controlling sequences (1067bp) in order to high-caliber expression of exogenous gene.Utilize human serum albumin to show that as the experimental result that detects gene the full length sequence that is positioned at the upstream is essential for high level is induced 3-AT.From BamHI insert cloning site with the yeast secretary signal sequence for example the signal sequence of Suc2 (its coding invertase gene Kaizer C.A. and Botstein, D.1986Mol.Cell Biol.6:2382-2391) be cloned into the upstream of this expression vector.Suc 2[SEQ ID NO:74] sequence be ATGCTTTTGC AAGCTTTCCT TTTCCTTTTGGCTGGTTTTG CAGCCAAAAT ATCTGCATCA ATG.
3 ' end at secretory signal sequence has on purpose kept the BamHI site.Merge carrier library pcr amplification scFv fragment from initial double cross AD-scFv, this fragment obtains by yeast two-hybrid screening, and has the ideal specificity at the antigen probe that provides.Design PCR primer is with amplification scFv region sequence, and this primer comprises additional translation initiation codon ATG at 5 ' end, comprises the sub-TAA of translation stop codon at 3 ' end.In addition, in each PCR primer, also combine the BamHI site.Use Hi-Fi archaeal dna polymerase (as KlenTaq, Barnes, W.M.1994 " PCR amplification of up to 35-kb DNA with high fidelity and highyield from λ bacteriophage templates " Proc.Natl.Acad.Sci.USA91:2216-2220) carry out pcr amplification after, with the fragment of BamHI digest amplification.This fragment is further handled to add phosphate group at 5 ' end with kinases.
Meanwhile, vector plasmid also cuts and goes Phosphoric acid esterase to handle by BamH I enzyme.The scFv fragment is connected with linearizing carrier then, and separates the recombinant clone with correct direction.This recombinant clone is introduced yeast host bacterial strain BJ2168 subsequently (from the yeast heredity preservation center that is positioned at the University of California, Berkeley).This bacterial strain has following genotype: MATa, prcl-407, and prb 1-1122, pep 4-3, leu 2, and trp 1, ura 3-52.Because this bacterial strain has a plurality of mutated genes (prc, prb, etc.) of proteolytic enzyme, so be the bacterial strain (referring to Zubenko, Michell, and Jones, 1980 Genetics 96:137-146) that ideal is used for expressing foreign protein.
The yeast BJ 2168 that comprises recombinant plasmid can reach logarithmic phase at selective medium (SD/-URA) at 30 ℃ of in addition violent wave and culture.Inductor 3-AT (3-amino-1,2,4-triazole, Sigma catalog number (Cat.No.) A-8056) adds nutrient solution at this moment and reaches final concentration 40mM, continues to cultivate 6-10 hour.Then, comprise the proteinic substratum of excretory to remove substratum by centrifugal collection.Proteic purifying and concentrated basic secundum legem program are seen Rose and Broach (1990) " Propagation and expression of cloned genes in yeast:2-μ mcircule-based vectors " Math.Enzymol 185:234-279.By with the standard electrophoresis of coomassie brilliant blue staining or detect the expression of scFv by the Western blot of applying marking antibody (flag sequence for example c-Myc can be contained in the PCR primer, and is incorporated in the expression vector) in the pcr amplification step.
In case use the plasmid vector of multiple copied to optimize the expression condition of scFv, use integrative vector pGES306 further to optimize.This carrier is different from pGES 426 and has only a place: it does not contain 2 μ replication orgin.So for stable maintenance, it can only be integrated into the yeast genes group.Experiment shows: the copy number that is not relied on plasmid by the expression of exogenous gene level of GCN 4 promotors manipulation.Mimran, Marbach, and Engelberg (2000) Biotechniques 28:552-560.Therefore, compare with the plasmid (multiple copied with common 30-50 copy in yeast exists) of 2 μ versions, integrated GCN4 carrier (existing with single copy form in yeast) provides the protein expression of par.Integrated carrier has an advantage clearly, allows yeast to grow in nutritional medium, as YPD.Yeast can grow to higher density like this, and the protein expression productive rate obviously increases under this culture condition.Use methods known in the art to separate and the secreted scFv of purifying.Embodiment 8: use method of the present invention to produce the functional human antibody of anti-Ro 24-7472/000-8 (IL-8).
Utilization is the method for description in the present invention, has made up the human antibody of the complete function of anti-interleukin-8 (IL-8).Briefly, in yeast, make up scFv library, people source by homologous recombination.People IL-8 is as antigen in library screening.The scFv clone of several specificitys in conjunction with people IL-8 separated in the people scFV library that use is set up in yeast two-hybrid system.The anti-IL-8 scFv antibody that obtains from Yeast system is expressed in the intestinal bacteria periplasmic space.In neutrophilic chemotaxis assay this scFv can be effectively in and people IL-8 biologic activity.And, heavy chain (V H) and light chain (V L) variable region has been transplanted on the Mammals expression construct, to produce human antibody completely.The complete human antibody of anti-IL-8 is expressed in the COS cell, and detects its function in a series of tests.1) target antigen-IL-8
IL-8 is a member of CXC chemokine family.It is accredited as main neutrophilia chemokine and activation factor (Schroder etc. (1987) " Purification and partialbiochemical characterization of a human monocyte-derived, neutrophil-activating peptide that lacks interleukin 1 activity " J.Immunol.139:3474-3483) at first; Peveri etc. (1988) " A novel neutrophil-activating factor produced by human mononuclear phagocytes " J.Exp.Med.167:1547-1559; Baggiolini etc. (1994) " Interleukin-8 and relatedchemotactic cytokines-CXC and CC chemokines.Adv.Immunol.55:97-179).Have now found that IL-8 has active (Schall and Bacon, (1994) " Chemokines, leukocyte trafficking andinflammation " Curr.Opin.Immunol.6:865-873) widely in a lot of physiology and pathologic process.Particularly, obviously it in the inflammatory reaction process, play an important role (Boggiolini and Clark-lewis, (1992) " Interleukin-8, a chemotactic and inflammatory cytokine.FEBS Lett.307:97-101).In fact, the antibody of anti-IL-8 be used for the treatment of psoriasic clinical trial (Glennie and Johnson (2000) " and Clinical trials of antibody therapy.Immunol.Today, 21:403-410).2) structure in human single chain variable fragments antibody library
In the yeast two-hybrid carrier pACT2 that comprises coding Gal4 activation structure territory (AD) sequence, make up scFv library, people source (Li waits (1994) " Specific association between thehuman DNA repair protiens XPA and ERCC1 " Proc Natl Acad Sci USA91:5012-5016).First from people's spleen, marrow, embryo liver, and the polyA of peripheral blood leucocyte (PBL) +RNA RT-PCR amplification coding heavy chain (V H) and light chain (V L) cDNA of variable region.By coding [(Gly) 4Ser] 4Joint connect V HAnd V LCDNA fragment (Nicholls etc. (1993) " Animproved method for generating single-chain antibodies fromhybridomas " J.Immunol.Methods 165:81-91), and in the sequence of the about 60bp of each terminal side joint, this sequence and pACT2 multiple clone site (MCS) homology (Hua waits (1998) " Construction of a modular yeast two-hybrid cDNA library from humanEST clones for the human genome protein linkage map " Gene215:143-152).Zu Zhuan PCR product (MAT α bacterial strain Y187 or MaV203) in yeast cell passes through homologous recombination (Hua like this, Deng 1997) be cloned into that (Harper waits (1993) " The p21 Cdk-interacting protein Cip is a potent inhibitor of G1cyclin-dependent kinases " Cell.75:805-816 among the pACT 2; Vidal waits (1996) " Reverse two-hybrid and one-hybrid systems to detect dissociatioof protein-protein and DNA-protein ihteractiohs " Proc Natl Acad SciUSA 93:10315-10320).The people source scFv that so obtains merges with Gal4 activation structure territory in reading frame.Altogether 1.5 * 10 7Independently yeast colony is collected and is housed in-80 ℃.
More specifically, the poly A of people's marrow, people's embryo liver, people's spleen and human peripheral leucocytes +(Palo Alto CA) buys RNA by Clontech Laboratory.Article one, chain cDNA makes (Clontech Laboratory with random primer and Power Script ThermoScript II test kit, PaloAlto, CA) overlap the Nucleotide of the V gene of discerning all functions by all variable regions (Marks etc. (1991) " By-passing immunization:human antibodies fromV-gene libraries displayed on phage " J.Mol.Biol.222:581-597) of the heavy chain and the light chain of the human antibody that in PCR, is used to increase by one of Sblattero and Bradbury (Sblattero and Bradbury, (1998) " Adefinitive set of oligonucleotide primers for amplifying human Vregions " Immunotechnology 3:271-278) design.
At variable region of heavy chain (V H) and variable region of light chain (V L) cDNA by one the coding [(Gly) 4Ser] 4Short circuit head sequence connection peptides join, this short circuit head sequence is (5 '-GGC GGT GGT GGA TCA GGCGGC GGA GGA TCT GGC GGA GGT GGC AGC GGT GGT GGA GGC AGT-3 ' [SEQ IDNo:77]) (Nicholls waits (1993) " An improved method for generatingsingle-chain antibodies from hybridomas " J Immunol Methods165:81-91).V H-Linker-V LCartridge clip is in the sequence of its 5 ' terminal side joint 60bp, and in its 3 ' terminal side joint 57bp sequence, these sequences are that (Hua waits (1997), supra to sequence homology with closing on yeast two-hybrid carrier pACT2 multiple clone site; Hua waits (1998), supra).
5 ' (1.3a) and 3 ' (1.3b) homologous sequence are as follows: be 1.3a---5 ' ACC CCA CCA AAC CCA AAA AAA GAG ATC TGT ATG GCT TAC CCATAC GAT GTT CCA GAT TAC[SEQ ID No:78] and 1.3b---5 ' GAG ATG GTG CAC GAT GCA CAG TTG AAG TGA ACT TGC GGG GTTTTT CAG TAT CTA CGA[SEQ ID No:79]
The PCR product that comprises scFv and linearizing pACT 2 (Hua waits (1997) supra) corotation of above-mentioned assembling are dissolved yeast strain Y187 (MAT α, ura3-52, his3-200, ade2-101, lys2-801, trp1-901, leu2-3,112, gal4 Δ, gal80 Δ, URA3 ∷ GAL1 UAs-GAL1 TATA-lacZ) (Harper waits (1993) supra) or MaV203 (MAT α, ura3-52, his3 Δ 200, ade2-101, trp1-901, leu2-3,112 cyh2 RCan1 R, ga14 Δ, ga180 Δ, GAL1 ∷ lacZ HIS3 UASGAL1∷ HIS3@LYS2, SPAL10 ∷ URA3) (Vidal waits (1996) " Reverse two-hybrid and one-hybrid systems todetect dissociation of protein-protein and DNA-proteininteraction " Proc Natl Acad Sci USA 93:10315-10320).Transformant is inoculated on the yeast synthetic medium of disappearance leucine (SD/-L), cultivated 2 days for 30 ℃.Results about altogether 1.2 * 10 7The independent cloning in yeast two-hybrid scFv library is also preserved in-80 ℃.
For the quality in the people scFv library of checking structure like this, from the library, select 18 clones at random, from these clones, extract plasmid DNA, and use the flanking sequence of the MCS of pACT2 to insert segmental size with pcr analysis as primer.Figure 14 shows has 19 to contain the scFv insertion fragment (about 850bp) with expection size among 21 clones.Comprise the per-cent (about 90%) and our result consistent (Hua wait (1997) " Minimum length of sequence homologyrequired in vivo cloning by homologous recombination in yeast " Plasmid 38:91-96) of previous report that insert segmental clone about in yeast, obtaining by the homologous recombination vivo clone.Insert the fragments sequence analysis and point out that they all comprise V H-Linker-V LCartridge clip, it has merged Gal4-AD in the upstream in frame.The scFv sequence of all analyses is distinct.The scFv library tissue-derived from different people made up independently.The scFv library that is derived from people's spleen is used for following research.2) at the people scFv library screening of people IL-8
Ro 24-7472/000-8 is used as the quality that antigen detects the scFv library of above-mentioned structure.(San Diego CA) buys people IL-8 cDNA by InvivoGen.Use 5 ' primer (5 '-AAGA GAA TTCGAA GGT GCA GTT TTG CCA AGG[SEQ ID No:80]) and 3 ' primer (5 '-AAAG CTG CAGTTA TGA GTT CTC AGC CCT CTT[SEQ ID No:81]) cDNA by pcr amplification coding people IL-8 mature sequence.(Clontech Laboratories, Palo Alto CA), produce pGBK-IL8 to the PCR product cloning to the cloning vector pGBKT7 with EcoR I/Pst I digestion.The syzygy that carrier pGBK-IL8 coding Gal4 DNA binding domains and people IL-8 merge at its C-terminal.
After identifying the IL-8 sequence, pGBK-IL8 is transformed into yeast strain AH109 (MATa, ura3-52, his3-200, ade2-101, trp1-901, leu2-3,112, gal4 Δ, gal80 Δ, LYS2 ∷ GAL1 UAS-GAL1 TATA-HIS3, GAL2 UAS-GAL2 TATA-ADE2, URA3 ∷ MEL1 UAs-MEL1 TATA-lac) (Clontech Laboratories, Palo Alto, CA).Construct is transformed among the MATa type yeast strain AH109.Go up the screening transformant at the synthetic medium (SD/-W) of disappearance tryptophane.From yeast cell, recapture the plasmid DNA that contains the segmental pACT2 of scFv.Determine the scFv fragments sequence with 377 type ABI automatic sequencers.The plasmid pGBKT7-Lam (ClontechLaboratories) of sequence that comprises the fusion rotein of coding Gal4-DNA binding domains and human nuclear fabric layer albumen C is used for specificity analyses.
In order to screen the scFv library,, in the library screening process, AH109 transformant and the MAT α type yeast cell (Y187 or MaV203 bacterial strain) that contains the scFv library are carried out mating according to the scheme of Clontech Laboratories.The carrier pACT2 that contains the scFv library has the LEU2 gene, and pGBK-IL8 has the TRP1 gene.Have only contain simultaneously with the cell of two kinds of plasmids can in the yeast synthetic medium (SD/-LW) of leucine and tryptophane disappearance, grow.Comprise the interactional cell of scFv/IL-8 and can activate the reporter gene ADE2 that is inserted in the strain gene group and the expression of HIS3, therefore, allow cell in the disappearance VITAMIN B4, Histidine, the substratum of leucine and tryptophane (SD/-AHLW) is gone up growth.The clone that picking is grown on the SD/-ALHW substratum.Add up to 67 be cloned in and select to grow on the substratum.As describing, in the analysis of beta-galactosidase enzymes colony lift, analyze these bacterium colonies and express the situation of additional reporter gene lacZ at the service manual of Clontech Laboratories.22 clones among 67 initial clones have confirmed betagalactosidase activity.
Further analyze the specificity of these lacZ positive colonies.From yeast cell, recapture and contain the plasmid DNA that scFv inserts segmental pACT2.With they respectively with pGBK-IL8, or control plasmid pGBKT7 and contain the pGBKT7-Lam cotransformation AH109 of incoherent antigen human nuclear fabric layer albumen C.Transformant is gone up growth at the selection substratum (SD/-LW) of disappearance leucine and tryptophane, and further analyzes by the analysis of beta-galactosidase enzymes colony lift.As shown in figure 15, in beta-galactosidase enzymes is analyzed, the specificity of 16 clone's demonstrations to people IL-8 arranged among 22 clones.
Sequencing analysis to these 16 clones shows that these 16 clones show the scFv sequence of three kinds of uniquenesses, are expressed as: clone 123-36,123-157,123-151.This three clones' DNA and the aminoacid sequence of encoding is shown among Figure 16.It should be noted that 123-151, only listed coding V for the clone HThe DNA and the aminoacid sequence in district, this is because whole ORF of scFv comprise a terminator codon at connector area.Yet, independent V HThe district is energy and target antigen just, and people IL-8 interacts.V HAnd V LJoint sequence between the district with under the number of marking mark in addition.We think to arouse attention especially, can do any modification and change to these DNA and proteinic structure, still can obtain the to encode functional molecular of a kind of protein or polypeptide, described merit protein or polypeptide have Ideal Characteristics for example with equate or even higher avidity combine with people IL-8.The mutant that is obtained also belongs within the scope of the present invention.
In order further to confirm the specificity of scFv, we have carried out reverse screening.To insert fragment cloning from the scFv of clone 123-36 to pGBKT7, the plasmid that obtains contains the syzygy of Gal4 DNA-BD and the anti-people IL-8 of scFv.People IL-8 cDNA is cloned among the pACT2 that has Gal4 AD in frame.These two kinds of plasmids then cotransformation to AH109.The transformant that obtains like this can be grown on SD/-AHLW, and shows positive findings (data are for showing) in the beta-galactosidase enzymes analysis, therefore confirms the anti-specifically people IL-8 of scFv clone 123-36.3) scFv is in colibacillary expression and dynamic analysis
Following will resist the cDNA of IL-8scFv clone 123-36 and the leader sequence of pelB in frame be cloned into expression vector pET 27b (+) (Novagen, Madison, WI) in.The anti-IL-8 of construct coding scFV sequentially is HSV mark and 6 * HIS mark at its C-terminal.Two primers crossing over aminoterminal (5 '-CGGGATCCGTCTGAAGAGGTGGTCAGCC-3 ' [SEQ ID No:82]) and carboxyl terminal (5 '-CCCAAGCTTTAGGACGGTGAGCTTGGTC-3 ' [SEQ ID NO:83]) are used to the whole coding regions of pcr amplification.The PCR product is used for then by BamHI and Hind III enzymolysis, and is connected in pET27b (+) carrier in identical site and goes.The plasmid that obtains be used for transformed into escherichia coli BL21 DE3 (Novagen, Madison, WI).
The protein expression of scFv in BL21 DE 3 is (Novagen) that carries out according to supplier's explanation.In coli strain BL21, scFv is anti--and IL8 induces by IPTG in the expression of periplasmic space.(operation instruction CA) is used Ni-NTA purifying scFv albumen for Qiagen Inc., Valencia according to manufacturers.By SDS-PAGE and the proteic quality of immunoblotting assessment purifying and the specificity of the anti-HSV mark of antibody.The results are shown among Figure 17 A and the 17B.
In the coimmunoprecipitation experiment, identify the interaction of scFv and its antigen people IL-8.At 50mM, pH9.6, in 4 ℃ the bicarbonate buffer, the IL-8 of reorganization (50 μ g) bag is by the Reactigel6 (Pierce) to 50 μ l.Remaining avtive spot is by the deactivation with the washing of 1 M Tris-HCl damping fluid (pH8.0).The single-chain antibody that dilutes in containing the PBS of 0.02%BSA joins in the above-mentioned pearl of 10 μ l, pearl is spent the night in 4 ℃ shake then.Wash pearl 3 times with 1ml PBST.Moistening pearl is boiled in the SDS-PAGE damping fluid, cross the gradient gel of 4-20% then, back point sample is to nitrocellulose filter.Spot is surveyed (Figure 17 C) with HSV-labeled monoclonal antibody (Novagen).
Also carry out reverse immunoprecipitation (seeing Figure 17 D).In this reverse coimmunoprecipitation experiment, the scFv prepared product of 50 μ g is coupled on the pearl earlier.Except the minority difference, all the other steps are then identical with last joint.The reorganization IL-8 of 2 μ g is used for each precipitin reaction.Spot is surveyed with IL-8 monoclonal antibody (Sigma).Two kinds of coimmunoprecipitation experiments show that the scFv that is derived from clone 123-36 can combine with people IL-8 specificity.
In addition, confirm the scFv of purifying and the interaction of IL-8 with enzyme linked immunological absorption test.Recombinant human IL-8 (Pierce) bag that is diluted to 1 μ g/ml in 50mM carbonate buffer solution (pH9.6) is by to 96 hole Maxisorp flat boards.Each hole was sealed 30 minutes with SuperBlock (Pierce).Be added in the scFv of the purifying of serial dilution among the PBS that contains 0.02%BSA then, insulation is 2 hours under the room temperature.With HSV labeled monoclonal antibody (200pg/ml), (100pg/ml) detect scFv in conjunction with anti-mouse IgG-HRP (horseradish peroxidase) then in conjunction with situation.At last after the washing, with TMB liquid substrate (Sigma) colour developing.Use the sulfuric acid termination reaction, and go out to read the OD value at 450nm.
Above experimental result shows that effectively the anti-IL-8scFv that is obtained by screening in the environment in the yeast cell can be in external identification specifically with in conjunction with people IL-8.4) affinity maturation of single-chain antibody 123-36
In order to improve the avidity of above-mentioned antibody, the scFc of clone 123-36 inserts segmental DNA by fallibility PCR mutagenesis (Leung etc. (1989) A method for random mutagenesisof a defined DNA segment using a modified polymerase chain reaction.Techniques 1:11-15; Cadwell and Joyce (1992) " Randomization of genesby PCR mutagenesis.PCR Methods Appl.2:28-33).Fallibility PCR is to use the Diversity available from Clontech Laboratories TMThe PCR mutagenesis kit is carried out according to the specification sheets of manufacturers.Used PCR primer is 1.3a[SEQ ID No:77] and 1.3b[SEQID No:78].
Exist under the situation of pGBK-IL8, the PCR product is transformed in the yeast and is cloned in pACT 2 carriers by homologous recombination in vivo.Briefly, mutagenesis close PCR product and linearizing pACT 2 and pGBK-IL8 cotransformation to the MaV203 competent cell (Life Technologies, Gaithersburg, MD).There is the 3-amino-1 of various concentration, 2,4-triazole (3-AT), under the situation of the proteic competitive inhibitor of a kind of HIS3, on SD/-AHLW, screen yeast cell (Dunfee etc. (1993) " The retinoblastoma protein associates with theprotein phosphatase type 1 catalytic subunit " Genes Dev.7:555-569).
In the direct screening of the first round, use the selective medium that contains 10mM 3-AT.Analyze betagalactosidase activity by filter-lift after the clone who generates chooses fast.As above analyze these clones' specificity.According to directory available from the MatchMaker System 3 of Clontech, use o-nitrophenyl beta-D-galactosidase (ONPG) substrate, check by the quantitative liquid of betagalactosidase activity and analyze these clones.In the clone of 45 analyses, 3 clone ONPG check shows obviously higher activity (Figure 18).All not display changes of specificity aspect that are cloned in.Determine these clones' sequence, and their aminoacid sequence and parent cloned 123-36 compare (Figure 19).Figure 20 shows the DNA and the aminoacid sequence of these three mutants.Here should arouse attention, can do any modification and change to these DNA and proteinic structure, still can obtain the to encode functional molecular of a kind of protein or polypeptide, described merit protein or polypeptide have Ideal Characteristics for example with equate or even higher avidity combine with people IL-8.The mutant that is obtained also belongs within the scope of the present invention.5) scFv changes fully human antibodies into
To resist people IL-8scFv to change fully human antibodies into then, and test the binding affinity of itself and people IL-8.From two mammalian expression vectors V of cloning by expression 123-36 respectively HAnd V LThe district.V HThe district is connected on people γ-1 constant region that is positioned in the expression cartridge clip of people γ-1 heavy chain under the EF1-HTLV promotor, and V LQu Ze links on the C gene of CMV promotor servant λ constant region.The following structure of mammalian expression vector.
The expression cartridge clip of assembling people γ-1 heavy chain.It comprises the V of leading peptide and clone 123-36 HThe district is thereafter cDNA (Norderhaug etc. 91997) " Versatile vectorsfor transient and stable expression of recombinant antibodymolecules in mammalian cells " the J.Immunol.Methods 204:77-87 of people γ-1 constant region).This cartridge clip is cloned into pGT60 (Invivogen, San Diego, CA) downstream of middle hEF1-HTLV promotor.
People's lambda light chain of the VL of 123-36 is expressed cartridge clip and is comprised leader sequence, and VL and clone are from the C gene (Clontech) of people's lambda light chain of people's spleen cDNA.This is that cDNA expresses cartridge clip, be by using overlapping PCR, directly connects three fragments structures in frame.Cartridge clip is cloned into pGT60 hCMV-1A promotor downstream the PstI-SmaI seat and replace the HSV-tk gene.
With heavy chain and light chain construct cotransfection in the COS-7 cell.The transient transfection transfection of COS-7 cell is that (MD) transfection reagent carries out according to its specification sheets for Life Technologies, Gaithersburg with LipofectAMINE2000.
By in substratum, the recombinate transient expression of complete antibody of enzyme-linked immunosorbent assay analysis.Flat board with goat anti-human igg γ bag quilt is used for catching the reorganization complete antibody, and uses the goat-anti people λ in conjunction with HRP to detect bonded antibody.
Briefly, detect the enzyme-linked immunosorbent assay of antibody expression by Maxisorp (Nunc, Denmark) flat board with goat anti-human igg γ (Biosource International) antibody sandwich.Use in conjunction with goat-anti people λ (Biosource International) antibody of HRP detect specimen to the flat board of bag quilt in conjunction with situation.Use TMB peroxidase enzyme immunoassay substrate (Bio-Rad, catalog number (Cat.No.) 172-1066) to detect HRP.By adding 1 normal sulfuric acid termination reaction, then at 450nm to dull and stereotyped reading.
Substratum from the clone of expressing the anti-people IL8 of mouse monoclonal antibody is used as negative control.Enzyme linked immunological absorption test result shows that the complete antibody that comprises IgG gamma heavy chain and lambda light chain is successfully expressed.The reorganization fully human antibodies also can be in conjunction with IL8 in enzyme linked immunological absorption test analysis.
The co-immunoprecipitation (Figure 21) that carries out the reorganization complete antibody of anti-people IL-8 and people IL-8 by Western blot as mentioned above, the V of scFv clone 123-36 HAnd V LThe N-end of Ig γ 1 CH and λ constant region is cloned in the district respectively.With fully human antibodies construct rotaring redyeing COS cell.Use the pearl (Figure 21, swimming lane 1) of personnel selection IL-8 bag quilt or not coated pearl (Figure 21, swimming lane 2) to precipitate fully human antibodies from substratum.Similarly, the purport precipitation (Figure 21, swimming lane 3) of the substratum of the COS cell of usefulness analog carrier transfection and IL-8 bag quilt.As shown in figure 21, the V that comprises scFv clone 123-36 HAnd V LThe reorganization fully human antibodies in district can combine with people IL-8 specifically.6) discuss
Because classical yeast-two hybrid technique requires interacting proteins partly to enter nucleus and activates transcribing of nuclear reporter gene then, therefore this technology be it is generally acknowledged the interaction that is applicable to very much between research tenuigenin and the nuclear albumen, yet for the research membranin, the interaction of cytokine and other extracellular ligand is but very limited.Why this also explain in recent years about the report that screens single-chain antibody (scFv) with yeast two-hybrid system and mainly concentrate on intrabody (intrabody) (see (1999) such as Visintin " Selection of antibodies forintracellular function using a two-hybrid in vivo system.Proc NatlAcad Sci USA.96:11723-11728); With the scFv of anti-ATF-2, a kind of single-chain antibody of transcriptional regulation protein (Partner-Taliana etc. (2000) " In vivo selection ofsingle-chain antibodies using a yeast two-hybrid system " J.Immnol.Methods 238:161-172).Also not about detecting the report of the outer proteinic antibody of anti-all cells.
In the present invention, confirming first can be by using the antibody of outer albumen of yeast two-hybrid method screening anti-cell such as IL-8.The outer albumen of ScFv and target cell is all at cell inner expression, and interact with each other with high avidity.Above-mentioned result displayed also confirms can be transformed into functional fully human antibodies from the single-chain antibody of the scF library screening of screening, and it will have various treatments and diagnostic use.For example, the scFv of the anti-people IL-8 of screening and fully human antibodies that scFv based on screening makes up can be used for diagnosing or treating disease and/or with the active relevant illness of IL-8 inflammation (as psoriasis) for example.
Sequence table＜110〉Zhu Li
Huashao Bing <120> in yeast and high productivity of fully human antibody screening of all components <130> 25636-708 <150> US 09/603, 663 <151> 2000-06-23 <150> US 09/602, 373 <151> 2000-06-23 <150> US 09/603, 658 <151> 2000-06-23 <150> US 09/602, 972 <151> 2000-06-23 <160> 95 <170> PatentIn version 3.1 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <400> 1 ataacttcgt ataatgtatg ctatacgaag ttat 34 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence: LoxP 511 <400> 2 ataacttcgt atagtataca ttatacgaag ttat 34 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence: LoxC2 <400> 3 acaacttcgt ataatgtatg ctatacgaag ttat 34 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence: LoxP1 <400> 4 ataacttcgt ataatatatg ctatacgaag ttat 34 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence: LoxP2 <400> 5 ataacttcgt atagcataca ttatacgaag ttat 34 <210> 6 <211> 34 <212> DNA <213> Artificial Sequence: LoxP3 <400> 6 ataacttcgt ataatgtata ctatacgaag ttat 34 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence: LoxP4 <400> 7 ataacttcgt ataatataaa ctatacgaag tta 33 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence: LoxP5 <400> 8 ataacttcgt ataatctaac ctatacgaag ttat 34 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence: LoxP6 <400> 9 ataacttcgt ataacatagc ctatacgaag ttat 34 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence: LoxP7 <400> 10 ataacttcgt ataacatacc ctatacgaag ttat 34 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence: LoxP8 <400> 11 attacctcgt atagcataca ttatacgaag ttat 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence: LoxP9 <400> 12 ataacttcgt atagcataca ttatatgaag ttat 34 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence: LoxP10 <400> 13 attacctcgt atagcataca ttatatgaag ttat 34 <210> 14 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 14 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 caggtgcagc tgcaggagtc sg 82 <210> 15 <211> 81 <212> DNA <213> Artificial Sequence: PCR primer <400> 15 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 caggtacagc tgcagcagtc a 81 <210> 16 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 16 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 caggtgcagc tacagcagtg gg 82 <210> 17 <211> 81 <212> DNA <213> Artificial Sequence: PCR primer <400> 17 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 gaggtgcagc tgktggagwc y 81 <210> 18 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 18 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 caggtccagc tkgtrcagtc tgg 83 <210> 19 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 19 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 cagrtcacct tgaaggagtc tg 82 <210> 20 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 20 accccaccaa acccaaaaaa agagatctgt atggcttacc catacgatgt tccagattac 60 caggtgcagc tggtgsartc tgg 83 <210> 21 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 21 actgcctcca ccaccgctgc cacctccgcc agatcctccg ccgcctgatc caccaccgcc 60 tgaggagacr gtgaccaggg tg 82 <210> 22 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 22 actgcctcca ccaccgctgc cacctccgcc agatcctccg ccgcctgatc caccaccgcc 60 tgaggagacg gtgaccaggg tt 82 <210> 23 <211> 81 <212> DNA <213> Artificial Sequence: PCR primer <400> 23 actgcctcca ccaccgctgc cacctccgcc agatcctccg ccgcctgatc caccaccgcc 60 tgaagagacg gtgaccattg t 81 <210> 24 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 24 actgcctcca ccaccgctgc cacctccgcc agatcctccg ccgcctgatc caccaccgcc 60 tgaggagacg gtgaccgtgg tcc 83 <210> 25 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 25 actgcctcca ccaccgctgc cacctccgcc agatcctccg ccgcctgatc caccaccgcc 60 ggttggggcg gatgcactcc 80 <210> 26 <211> 81 <212> DNA <213> Artificial Sequence: PCR primer <400> 26 actgcctcca ccaccgctgc cacctccgcc agatcctccg ccgcctgatc caccaccgcc 60 sgatgggccc ttggtggarg c 81 <210> 27 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 27 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 cagtctgtsb tgacgcagcc gcc 83 <210> 28 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 28 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 tcctatgwgc tgacwcagcc ac 82 <210> 29 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 29 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 tcctatgagc tgayrcagcy acc 83 <210> 30 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 30 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 cagcctgtgc tgactcaryc 80 <210> 31 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 31 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 cagdctgtgg tgacycagga gcc 83 <210> 32 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 32 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 cagccwgkgc tgactcagcc mcc 83 <210> 33 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 33 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 tcctctgagc tgastcagga scc 83 <210> 34 <211> 81 <212> DNA <213> Artificial Sequence: PCR primer <400> 34 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 cagtctgyyc tgaytcagcc t 81 <210> 35 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 35 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 aattttatgc tgactcagcc cc 82 <210> 36 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 36 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgattc 60 taggacggt sascttggtcc 80 <210> 37 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 37 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgattc 60 gaggacggtc agctgggtgc 80 <210> 38 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 38 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 gacatccrgd tgacccagtc tcc 83 <210> 39 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 39 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 gaaattgtrw tgacrcagtc tcc 83 <210> 40 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 40 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 gatattgtgm tgacbcagwc tcc 83 <210> 41 <211> 82 <212> DNA <213> Artificial Sequence: PCR primer <400> 41 ggcggtggtg gatcaggcgg cggaggatct ggcggaggtg gcagcggtgg tggaggcagt 60 gaaacgacac tcacgcagtc tc 82 <210> 42 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 42 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgattc 60 tttgatttcc accttggtcc 80 <210> 43 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 43 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgattc 60 tttgatctcc ascttggtcc 80 <210> 44 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 44 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgattc 60 tttgatatcc actttggtcc 80 <210> 45 <211> 80 <212> DNA <213> Artificial Sequence: PCR primer <400> 45 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgattc 60 tttaatctcc agtcgtgtcc 80 <210> 46 <211> 78 <212> DNA <213> Artificial Sequence: PCR primer <400> 46 tcgaggcggt ggtggatcag gcggcggagg atctggcgga ggtggcagcg gtggtggagg 60 cagtgcgcgc ttaattaa 78 <210> 47 <211> 78 <212> DNA <213> Artificial Sequence: PCR primer <400> 47 tcgattaatt aagcgcgcac tgcctccacc accgctgcca cctccgccag atcctccgcc 60 gcctgatcca ccaccgcc 78 <210> 48 <211> 85 <212> DNA <213> Artificial Sequence: PCR primer <400> 48 actgcctcca cctgataact tcgtatagca tatattatac gaagttattg atccaccacc 60 gcctgaggag acrgtgacca gggtg 85 <210> 49 <211> 85 <212> DNA <213> Artificial Sequence: PCR primer <400> 49 actgcctcca cctgataact tcgtatagca tatattatac gaagttattg atccaccacc 60 gcctgaggag acggtgacca gggtt 85 <210> 50 <211> 84 <212> DNA <213> Artificial Sequence: PCR primer <400> 50 actgcctcca cctgataact tcgtatagca tatattatac gaagttattg atccaccacc 60 gcctgaagag acggtgacca ttgt 84 <210> 51 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 51 actgcctcca cctgataact tcgtatagca tatattatac gaagttattg atccaccacc 60 gcctgaggag acggtgaccg tggtcc 86 <210> 52 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 52 actgcctcca cctgataact tcgtatagca tatattatac gaagttattg atccaccacc 60 gccggttggg gcggatgcac tcc 83 <210> 53 <211> 84 <212> DNA <213> Artificial Sequence: PCR primer <400> 53 actgcctcca cctgataact tcgtatagca tatattatac gaagttattg atccaccacc 60 gccsgatggg cccttggtgg argc 84 <210> 54 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 54 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtcagtctg tsbtgacgca gccgcc 86 <210> 55 <211> 85 <212> DNA <213> Artificial Sequence: PCR primer <400> 55 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agttcctatg wgctgacwca gccac 85 <210> 56 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 56 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agttcctatg agctgayrca gcyacc 86 <210> 57 <211> 83 <212> DNA <213> Artificial Sequence: PCR primer <400> 57 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtcagcctg tgctgactca ryc 83 <210> 58 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 58 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtcagdctg tggtgacyca ggagcc 86 <210> 59 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 59 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtcagccwg kgctgactca gccmcc 86 <210> 60 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 60 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agttcctctg agctgastca ggascc 86 <210> 61 <211> 84 <212> DNA <213> Artificial Sequence: PCR primer <400> 61 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtcagtctg yyctgaytca gcct 84 <210> 62 <211> 85 <212> DNA <213> Artificial Sequence: PCR primer <400> 62 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtaatttta tgctgactca gcccc 85 <210> 63 <211> 50 <212> DNA <213> Artificial Sequence: PCR primer <400> 63 cttcgtataa tgtatgctat acgaagttat taggacggts ascttggtcc 50 <210> 64 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 64 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtgacatcc rgdtgaccca gtctcc 86 <210> 65 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 65 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtgaaattg trwtgacrca gtctcc 86 <210> 66 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 66 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtgaaat tgtrwtgacrca gtctcc 86 <210> 67 <211> 86 <212> DNA <213> Artificial Sequence: PCR primer <400> 67 ggcggtggtg gatcaat8ac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtgatattg tgmtgacbca gwctcc 86 <210> 68 <211> 85 <212> DNA <213> Artificial Sequence: PCR primer <400> 68 ggcggtggtg gatcaataac ttcgtataat atatgctata cgaagttatc aggtggaggc 60 agtgaaacga cactcacgca gtctc 85 <210> 69 <211> 50 <212> DNA <213> Artificial Sequence: PCR primer <400> 69 cttcgtataa tgtatgctat acgaagttat tttgatttcc accttggtcc 50 <210> 70 <211> 50 <212> DNA <213> Artificial Sequence: PCR primer <400> 70 cttcgtataa tgtatgctat acgaagttat tttgatctcc ascttggtcc 50 <210> 71 <211> 50 <212> DNA <213> Artificial Sequence: PCR primer <400> 71 cttcgtataa tgtatgctat acgaagttat tttgatatcc actttggtcc 50 <210> 72 <211> 50 <212> DNA <213> Artificial Sequence: PCR primer <400> 72 cttcgtataa tgtatgctat acgaagttat tttaatctcc agtcgtgtcc 50 <210> 73 <211> 78 <212> DNA <213> Artificial Sequence: PCR primer <400> 73 gagatggtgc acgatgcaca gttgaagtga acttgcgggg tttttcagta tctacgataa 60 cttcgtataa tgtatgct 78 <210> 74 <211> 63 <212> DNA <213> Artificial Sequence: PCR primer <400> 74 atgcttttgc aagctttcct tttccttttg gctggttttg cagccaaaat atctgcatca 60 atg 63 <210> 75 <211> 20 <212> PRT <213> Artificial Sequence: linker peptide <400> 75 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 151015 Gly Gly Gly Ser ...
20＜210〉76＜211〉5＜212〉PRT＜213〉artificial sequence: G4S joint＜400〉76Gly, Gly, Gly, Gly, Ser1, 5＜210〉77＜211〉60＜212〉DNA＜213〉artificial sequence: G4S joint＜400〉77ggcggtggtg, gatcaggcgg, cggaggatct, ggcggaggtg, gcagcggtgg, tggaggcagt, 60＜210〉78＜211〉60＜212〉DNA＜213〉artificial sequence: homologous sequence 1.3.a＜400〉78accccaccaa, acccaaaaaa, agagatctgt, atggcttacc, catacgatgt, tccagattac, 60＜210〉79＜211〉57＜212〉DNA＜213〉artificial sequence: homologous sequence 1.3.b＜400〉79gagatggtgc, acgatgcaca, gttgaagtga, acttgcgggg, tttttcagta, tctacga, 57＜210〉80＜211〉31＜212〉DNA＜213〉artificial sequence: PCR primer＜400〉80aagagaattc, gaaggtgcag, ttttgccaag, g, 31＜210〉81＜211〉31＜212〉DNA＜213〉artificial sequence: PCR primer＜400〉81aaagctgcag, ttatgagt, tctcagccctct, t, 31＜210〉82＜211〉28＜212〉DNA＜213〉artificial sequence: PCR primer＜400〉82cgggatccgt, ctgaagaggt, ggtcagcc, 28＜210〉83＜211〉28＜212〉DNA＜213〉artificial sequence: PCR primer＜400〉83cccaagcttt, aggacggtga, gcttggtc, 28＜210〉84＜211〉795＜212〉DNA＜213〉artificial sequence: clone 123-36＜400〉84gaggtgcagc, tggtggagtc, cgggggaggc, ttggtccagc, ccggggggtc, cctgagactc, 60tcctgtgcag, cctctggatt, cacctttagt, agctattgga, tgagctgggt, ccgccaggct, 120ccagggaagg, ggctggagtg, ggtggcctac, ataaagcaag, atggaagtga, gaaatactat, 180gtggactctg, tgaagggccg, attcaccatc, tccagagaca, acgccaagaa, ctcattgtat, 240ctgcaaatga, acagcctgag, agccgaggac, acggccgtgt, attactgtgc, gagagtaaag, 300agtagcagta, gctggtctta, ctatgatagt, agtggttatt, actaccctga, ctactggggc, 360cagggaaccc, tggtcaccgt, ctcctcaggg, agtgcatccg, ccccaaccgg, cggtggtgga, 420tcaggcggcg, gaggatctgg, cggaggtggc, agcggtggtg, gaggcagtca, ggctgtggtg, 480acccaggagc, cctcactgac, tgtgtctcca, ggagggacag, tcactctcac, ctgtggctcc, 540agcactggac, ctgtcaccac, tggtcatttt, tcctactggc, tgcagcagaa, gcctggccaa, 600gcccccagga, cactgattta, tgatacaacc, aacaaacact, cctggacacc, tgcccgcttc, 660tcagcctccc, tccttggggg, caaatgtgcc, ctgacccttt, cgggtgcgcg, gcctgaggat, 720gaggctgaat, attactgctt, gctctcctat, ggtgatggtg, ttgtaatcgg, cggagggacc, 780aagctcaccg, tccta, 795＜210〉85＜211〉265＜212〉PRT＜213〉artificial sequence: clone 123-36＜400〉85Glu, Val, Gln, Leu, Val, Glu, Ser, Gly, Gly, Gly, Leu, Val, Gln, Pro, Gly, Gly1, 5, 10, 15Ser, Leu, Arg, Leu, Ser, Cys, Ala, Ala, Ser, Gly, Phe, Thr, Phe, Ser, Ser, Tyr
20??????????????????25??????????????????30Trp?Met?Ser?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val
35??????????????????40??????????????????45Ala?Tyr?Ile?Lys?Gln?Asp?Gly?Ser?Glu?Lys?Tyr?Tyr?Val?Asp?Ser?Val
50??????????????????55??????????????60Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr65??????????????????70??????????????????75??????????????????80Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys
85??????????????????90??????????????????95Ala?Arg?Val?Lys?Ser?Ser?Ser?Ser?Trp?Ser?Tyr?Tyr?Asp?Ser?Ser?Gly
100?????????????????105?????????????????110Tyr?Tyr?Tyr?Pro?Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Leu?Val?Thr?Val?Ser
115?????????????????120?????????????????125Ser?Gly?Ser?Ala?Ser?Ala?Pro?Thr?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly
130?????????????????135?????????????????140Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Ala?Val?Val145?????????????????150?????????????????155?????????????????160Thr?Gln?Glu?Pro?Ser?Leu?Thr?Val?Ser?Pro?Gly?Gly?Thr?Val?Thr?Leu
165?????????????????170?????????????????175Thr?Cys?Gly?Ser?Ser?Thr?Gly?Pro?Val?Thr?Thr?Gly?His?Phe?Ser?Tyr
180?????????????????185?????????????????190Trp?Leu?Gln?Gln?Lys?Pro?Gly?Gln?Ala?Pro?Arg?Thr?Leu?Ile?Tyr?Asp
195?????????????????200?????????????????205Thr?Thr?Asn?Lys?His?Ser?Trp?Thr?Pro?Ala?Arg?Phe?Ser?Ala?Ser?Leu
210?????????????????215?????????????????220Leu?Gly?Gly?Lys?Cys?Ala?Leu?Thr?Leu?Ser?Gly?Ala?Arg?Pro?Glu?Asp225?????????????????230?????????????????235?????????????????240Glu?Ala?Glu?Tyr?Tyr?Cys?Leu?Leu?Ser?Tyr?Gly?Asp?Gly?Val?Val?Ile
245?????????????????250?????????????????255Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu
260, 265＜210〉86＜211〉748＜212〉DNA＜213〉artificial sequence: clone 123-157＜400〉86caggtgcagc, tgcaggagtc, cggcccagga, ctggtgacgc, cttcggagac, cctgtctctc, 60ttctgcaatg, tctctggtgc, ctccatcagt, agttactgtt, ggagttggct, tcggcagccc, 120gccgggaaga, gactggagtg, gattgggcgt, gtttgtacca, gtgggaagac, ctactacaat, 180ccttccctcg, agagtcgaat, caccgtgtca, ctagacgcgt, ccaagaactt, tttctccctg, 240aagttgacgt, ctataaccgc, cgcggacact, gccgtgtact, actgtgcgag, agaggctggg, 300tggttcggcc, cctggggccc, gggaaccctc, gtcgccgtct, cctcagcctc, caccaagggc, 360ccatctggcg, gtggtggatc, aggcggcgga, ggatctggcg, gaggtggcag, cggtggtgga, 420ggcagtgaaa, cgacactcac, gcagtctcca, tcctccctgt, ctgcatctgt, gggagacaga, 480gtcaccatca, cttgccaggc, gagcgaggac, ataggccaat, atttgaattg, gtatcagcag, 540aaaccaggga, aagcccctac, actcctgatc, tacgatgcgt, ccaatttggg, cactggggtc, 600ccatcaagat, tcagtggaac, tggatctgtg, acagatttta, ctttcaccat, caccagccta, 660cagcctgaag, atattgcaac, atattactgt, caacagtaca, ataatctccc, aattaccttc, 720ggccaaggga, cacgactgga, gattaaat, 748＜210〉87＜211〉249＜212〉PRT＜213〉artificial sequence: clone 123-157＜400〉87Gln, Val, Gln, Leu, Gln, Glu, Ser, Gly, Pro, Gly, Leu, Val, Thr, Pro, Ser, Glu1, 5, 10, 15Thr, Leu, Ser, Leu, Phe, Cys, Asn, Val, Ser, Gly, Ala, Ser, Ile, Ser, Ser, Tyr
20??????????????????25??????????????????30Cys?Trp?Ser?Trp?Leu?Arg?Gln?Pro?Ala?Gly?Lys?Arg?Leu?Glu?Trp?Ile
35??????????????????40??????????????????45Gly?Arg?Val?Cys?Thr?Ser?Gly?Lys?Thr?Tyr?Tyr?Asn?Pro?Ser?Leu?Glu
50??????????????????55??????????????????60Ser?Arg?Ile?Thr?Val?Ser?Leu?Asp?Ala?Ser?Lys?Asn?Phe?Phe?Ser?Leu65??????????????????70??????????????????75??????????????????80Lys?Leu?Thr?Ser?Ile?Thr?Ala?Ala?Asp?Thr?Ala?Val?Tyr?Tyr?Cys?Ala
85??????????????????90??????????????????95Arg?Glu?Ala?Gly?Trp?Phe?Gly?Pro?Trp?Gly?Pro?Gly?Thr?Leu?Val?Ala
100?????????????????105?????????????????110Val?Ser?Ser?Ala?Ser?Thr?Lys?Gly?Pro?Ser?Gly?Gly?Gly?Gly?Ser?Gly
115?????????????????120?????????????????????125Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Glu?Thr
130?????????????????135?????????????????140Thr?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ser?Ala?Ser?Val?Gly?Asp?Arg145?????????????????150?????????????????155?????????????????160Val?Thr?IIe?Thr?Cys?Gln?Ala?Ser?Glu?Asp?Ile?Gly?Gln?Tyr?Leu?Asn
165?????????????????170?????????????????175Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Thr?Leu?Leu?Ile?Tyr?Asp
180?????????????????185?????????????????190Ala?Ser?Asn?Leu?Gly?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly?Thr?Gly
195??????????????????200????????????????205Ser?Val?Thr?Asp?Phe?Thr?Phe?Thr?Ile?Thr?Ser?Leu?Gln?Pro?Glu?Asp
210?????????????????215?????????????????220Ile?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Tyr?Asn?Asn?Leu?Pro?Ile?Thr?Phe225?????????????????230?????????????????235?????????????????240Gly?Gln?Gly?Thr?Arg?Leu?Glu?Ile?Lys
245＜210〉88＜211〉363＜212〉DNA＜213〉artificial sequence: clone 123-151VH＜400〉88caggtgcagc, tgcaggagtc, cggcccagga, ctggtgaagc, cttcggagac, cctgtccctc, 60acctgcactg, tctctggtga, ctccatccgc, agtggtcgtt, actactgggg, ctggattcgc, 120cagaccccag, gaaaggcgct, tgagtggatt, gggattatct, attttagtgg, gagcaccctc, 180tacaacccgt, ccttcaagag, tcgagtctcc, atctcccttg, acacgtccaa, gaaccagttc, 240tccctgcaac, tgagttctgt, gtccgccgca, gacacggctg, tgtactcctg, tgcgggagga, 300tttcgacaat, tagaatacgg, tatggacgtc, tgggaccaag, ggaccacggt, caccgtctcc, 360tca, 363＜210〉89＜211〉121＜212〉PRT＜213〉artificial sequence: clone 123-15lVH＜400〉89Gln, Val, Gln, Leu, Gln, Glu, Ser, Gly, Pro, Gly, Leu, Val, Lys, Pro, Ser, Glu1, 5, 10, 15Thr, Leu, Ser, Leu, Thr, Cys, Thr, Val, Ser, Gly, Asp, Ser, Ile, Arg, Ser, Gly
20??????????????????25??????????????????30Arg?Tyr?Tyr?Trp?Gly?Trp?Ile?Arg?Gln?Thr?Pro?Gly?Lys?Ala?Leu?Glu
35??????????????????40??????????????????45Trp?Ile?Gly?Ile?Ile?Tyr?Phe?Ser?Gly?Ser?Thr?Leu?Tyr?Asn?Pro?Ser
50??????????????????55??????????????????60Phe?Lys?Ser?Arg?Val?Ser?Ile?Ser?Leu?Asp?Thr?Ser?Lys?Asn?Gln?Phe65??????????????????70??????????????????75??????????????????80Ser?Leu?Gln?Leu?Ser?Ser?Val?Ser?Ala?Ala?Asp?Thr?Ala?Val?Tyr?Ser
85??????????????????90??????????????????95Cys?Ala?Gly?Gly?Phe?Arg?Gln?Leu?Glu?Tyr?Gly?Met?Asp?Val?Trp?Asp
100?????????????????105?????????????????110Gln?Gly?Thr?Thr?Val?Thr?Val?Ser?Ser
115, 120＜210〉90＜211〉794＜212〉DNA＜213〉artificial sequence: clone M36-8＜400〉90gaggtgcagc, tggtggagtc, cgggggaggc, ttggtccagc, ccggggggtc, cctgagactc, 60tcctgtgcag, cctctggatt, cacctttagt, agctattgga, tgagctgggt, ccgccaggct, 120ccagggaagg, ggctggagtg, ggtggcctac, ataaagcaag, atggaagtga, gaaatactat, 180gtggactctg, tgaagggccg, attcaccatc, tccagagaca, acgccaagaa, ctcattgtat, 240ctgcaaatga, acagcctgag, agccgaggac, acggccgtgt, attactgtgc, gagagtaaag, 300agtagcagta, gctggtctta, ctatgatagt, agtggttatt, actaccctga, ctactggggc, 360cagggaaccc, tggtcaccgt, ctcctcaggg, agtgcatccg, ccccaaccgg, cggtggtgga, 420tcaggcggcg, gaggatctgg, cggaggtggc, agcggtggtg, gaggcagtca, ggctgtggtg, 480acccaggagc, cctcactgac, tgtgtctcca, ggagggacag, tcactctcac, ctgtggctcc, 540agcactggac, ctgtcaccac, tggtcacttt, tcctactggc, tgcagcagaa, gctggccaag, 600cccccaggac, actgatttat, gatacaacca, acaaacactc, ccggacacct, gcccgcttct, 660cagcctccct, ccttgggggc, aaatgtgccc, tgaccccttc, gggtgcgcgg, cctgaggatg, 720aggctgaata, ttactgcttg, ctctcctatg, gtgatggtgt, tgtaatcggc, ggagggacca, 780agctcaccgt, ccta, 794＜210〉91＜211〉264＜212〉PRT＜213〉artificial sequence: clone M36-8＜400〉91Glu, Val, Gln, Leu, Val, Glu, Ser, Gly, Gly, Gly, Leu, Val, Gln, Pro, Gly, Gly1, 5, 10, 15Ser, Leu, Arg, Leu, Ser, Cys, Ala, Ala, Ser, Gly, Phe, Thr, Phe, Ser, Ser, Tyr
20??????????????????25??????????????????30Trp?Met?Ser?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val
35??????????????????40??????????????????45Ala?Tyr?Ile?Lys?Gln?Asp?Gly?Ser?Glu?Lys?Tyr?Tyr?Val?Asp?Ser?Val
50??????????????????55??????????????????60Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr65??????????????????70??????????????????75??????????????????80Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys
85??????????????????90??????????????????95Ala?Arg?Val?Lys?Ser?Ser?Ser?Ser?Trp?Ser?Tyr?Tyr?Asp?Ser?Ser?Gly
100??????????????????105?????????????????110Tyr?Tyr?Tyr?Pro?Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Leu?Val?Thr?Val?Ser
115?????????????????120?????????????????125Ser?Gly?Ser?Ala?Ser?Ala?Pro?Thr?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly
130?????????????????135?????????????????140Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Ala?Val?Val145?????????????????150?????????????????155?????????????????160Thr?Gln?Glu?Pro?Ser?Leu?Thr?Val?Ser?Pro?Gly?Gly?Thr?Val?Thr?Leu
165?????????????????170?????????????????175Thr?Cys?Gly?Ser?Ser?Thr?Gly?Pro?Val?Thr?Thr?Gly?His?Phe?Ser?Tyr
180?????????????????185?????????????????190Trp?Leu?Gln?Gln?Lys?Pro?Gly?Gln?Ala?Pro?Arg?Thr?Leu?Ile?Tyr?Asp
195?????????????????200?????????????????205Thr?Asn?Lys?His?Ser?Arg?Thr?Pro?Ala?Arg?Phe?Ser?Ala?Ser?Leu?Leu
210?????????????????215?????????????????220Gly?Gly?Lys?Cys?Ala?Leu?Thr?Pro?Ser?Gly?Ala?Arg?Pro?Glu?Asp?Glu225?????????????????230?????????????????235?????????????????240Ala?Glu?Tyr?Tyr?Cys?Leu?Leu?Ser?Tyr?Gly?Asp?Gly?Val?Val?Ile?Gly
245?????????????????250?????????????????255Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu
260＜210〉92＜211〉792＜212〉DNA＜213〉artificial sequence: clone M36-11＜400〉92gaggtgcagc, tggtggagtc, cgggggaggc, ttggtccagc, ccggggggtc, cctgagactc, 60tcctgtgcag, cctctggatt, cacctttagt, agctattgga, tgagctgggt, ccgccaggct, 120ccagggaagg, ggctggagtg, ggtggccaca, taaagcaaga, tggaagtgag, aagtactatg, 180tggactctgt, gaagggccga, ttcaccatct, ccagagacaa, cccaagaact, cattgtacct, 240gcaaatggac, agcctgagag, ccgaggacac, ggccgtgtat, tactgtgcga, gagtaaagag, 300tagcagtagc, gggtcttact, atgatagtag, tggttattac, taccctgact, actggggcca, 360gggaaccctg, gtcaccgtct, cctcagggag, tgcatccgcc, ccatccggcg, gcggtggatc, 420aggcggcgga, ggatctggcg, gagtggcagc, ggtggtggag, gcagtcaggc, tgtggtggcc, 480caggagccct, cactgactgt, gtctccagga, gggacagtca, ctctcacctg, tggctccagc, 540actggacctg, tcaccactgg, tcatctttcc, tactggctgc, agcagaagcc, tggccaagcc, 600cccaggacac, tgatttatga, tacaaccaac, aaacactcct, ggacacctgc, ccgcttctca, 660gcctccctcc, ttgggggcaa, atgtgccctg, accctctcgg, gtgcgcggcc, tgaggatgag, 720gctgaatatt, actgcttgct, ctcctatggt, gatggtgttg, taatcggcgg, agggaccaag, 780ctcaccgtcc, ta, 792＜210〉93＜211〉265＜212〉PRT＜213〉artificial sequence: clone M36-11＜400〉93Glu, Val, Gln, Leu, Val, Glu, Ser, Gly, Gly, Gly, Leu, Val, Gln, Pro, Gly, Gly1, 5, 10, 15Ser, Leu, Arg, Leu, Ser, Cys, Ala, Ala, Ser, Gly, Phe, Thr, Phe, Ser, Ser, Tyr
20??????????????????25??????????????????30Trp?Met?Ser?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val
35??????????????????40??????????????????45Ala?Tyr?Ile?Lys?Gln?Asp?Gly?Ser?Glu?Lys?Tyr?Tyr?Val?Asp?Ser?Val
50??????????????????55??????????????????60Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr65??????????????????70??????????????????75??????????????????80Leu?Gln?Met?Asp?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys
85??????????????????90??????????????????95Ala?Arg?Val?Lys?Ser?Ser?Ser?Ser?Gly?Ser?Tyr?Tyr?Asp?Ser?Ser?Gly
100?????????????????105?????????????????110Tyr?Tyr?Tyr?Pro?Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Leu?Val?Thr?Val?Ser
115?????????????????120?????????????????125Ser?Gly?Ser?Ala?Ser?Ala?Pro?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly
130?????????????????135?????????????????140Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Ala?Val?Val145?????????????????150?????????????????155?????????????????160Ala?Gln?Glu?Pro?Ser?Leu?Thr?Val?Ser?Pro?Gly?Gly?Thr?Val?Thr?Leu
165?????????????????170?????????????????175Thr?Cys?Gly?Ser?Ser?Thr?Gly?Pro?Val?Thr?Thr?Gly?His?Leu?Ser?Tyr
180?????????????????185?????????????????190Trp?Leu?Gln?Gln?Lys?Pro?Gly?Gln?Ala?Pro?Arg?Thr?Leu?Ile?Tyr?Asp
195?????????????????200?????????????????205Thr?Thr?Asn?Lys?His?Ser?Trp?Thr?Pro?Ala?Arg?Phe?Ser?Ala?Ser?Leu
210?????????????????215?????????????????220Leu?Gly?Gly?Lys?Cys?Ala?Leu?Thr?Leu?Ser?Gly?Ala?Arg?Pro?Glu?Asp?225????????????????230?????????????????235?????????????????240Glu?Ala?Glu?Tyr?Tyr?Cys?Leu?Leu?Ser?Tyr?Gly?Asp?Gly?Val?Val?Ile
245?????????????????????????????250?????????????????255Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu
260, 265＜210〉94＜211〉792＜212〉DNA＜213〉artificial sequence: clone M36-12＜400〉94gaggtgcagc, tggtggagtc, cgggggaggc, ttggtccagc, ccggggggtc, cctgagactc, 60tcctgtgcag, cctctggatt, cacctttagt, agctattgga, tgagctgggt, ccgccaggct, 120ccagggaagg, ggctggagtg, ggtggcctac, ataaagcaag, atggaagtga, gaaatactat, 180gtggactctg, tgaagggccg, attcaccatc, tccagagaca, acgccaagaa, ctcattgtat, 240ctgcaaatga, acagcctgag, agccgaggac, acggccgtgt, attactgtgc, gagagtaaag, 300agtagcagta, gctggtctta, ctatgatagt, agtggttatt, actaccctga, ctactggggc, 360cagggaaccc, tggtcaccgt, ctcctcaggg, agtgcatccg, ccccaaccgg, cggtggtgga, 420tcaggcggcg, gaggatctgg, cggaggtggc, agcggtggtg, gaggcagtca, ggctgtggtg, 480acccaggagc, cctcactgac, tgtgtctcca, ggagggaagt, cactctcacc, tgcggctcca, 540gcactggacc, tgtcaccact, ggtcattttt, cctactggct, gcagcagaag, ctggccaagc, 600ccccaggaca, ctgatttatg, atacaaccaa, caaacactcc, tggacacctg, cccgcttctc, 660agcctcctcc, ttgggggcaa, atgtgccctg, accctttcgg, gtgcgcggcc, tgaggatgag, 720gctgaatatt, actgcttgct, ctcctatggt, gatggtgttg, taatcggcgg, agggaccaag, 780ctcaccgccc, ta, 792＜210〉95＜211〉265＜212〉PRT＜213〉artificial sequence: clone M36-12＜400〉95Glu, Val, Gln, Leu, Val, Glu, Ser, Gly, Gly, Gly, Leu, Val, Gln, Pro, Gly, Gly1, 5, 10, 15Ser, Leu, Arg, Leu, Ser, Cys, Ala, Ala, Ser, Gly, Phe, Thr, Phe, Ser, Ser, Tyr
20??????????????????25??????????????????30Trp?Met?Ser?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val
35??????????????????40??????????????????45Ala?Tyr?Ile?Lys?Gln?Asp?Gly?Ser?Glu?Lys?Tyr?Tyr?Val?Asp?Ser?Val
50??????????????????55??????????????????60Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr65??????????????????70??????????????????75??????????????????80Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys
85??????????????????90??????????????????95Ala?Arg?Val?Lys?Ser?Ser?Ser?Ser?Trp?Ser?Tyr?Tyr?Asp?Ser?Ser?Gly
100?????????????????105?????????????????110Tyr?Tyr?Tyr?Pro?Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Leu?Val?Thr?Val?Ser
115?????????????????120?????????????????125Ser?Gly?Ser?Ala?Ser?Ala?Pro?Thr?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly
130?????????????????135?????????????????140Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Ala?Val?Val145?????????????????150?????????????????155?????????????????160Thr?Gln?Glu?Pro?Ser?Leu?Thr?Val?Ser?Pro?Gly?Gly?Thr?Val?Thr?Leu
165?????????????????170?????????????????175Thr?Cys?Gly?Ser?Ser?Thr?Gly?Pro?Val?Thr?Thr?Gly?His?Phe?Ser?Tyr
180?????????????????185?????????????????190Trp?Leu?Gln?Gln?Lys?Pro?Gly?Gln?Ala?Pro?Arg?Thr?Leu?Ile?Tyr?Asp
195?????????????????200?????????????????205Thr?Thr?Asn?Lys?His?Ser?Trp?Thr?Pro?Ala?Arg?Phe?Ser?Ala?Ser?Leu
210?????????????????215?????????????????220Leu?Gly?Gly?Lys?Cys?Ala?Leu?Thr?Leu?Ser?Gly?Ala?Arg?Pro?Glu?Asp225?????????????????230?????????????????235?????????????????240Glu?Ala?Glu?Tyr?Tyr?Cys?Leu?Leu?Ser?Tyr?Gly?Asp?Gly?Val?Val?Ile
245?????????????????250?????????????????255Gly?Gly?Gly?Thr?Lys??Leu?Thr?Ala?Leu
260??????????????????265

Claims (143)

  1. One kind be used for screening can with the method for the test protein of a kind of target peptide or protein bound, this method comprises:
    Express a kind of library of testing fused protein in yeast cell, every kind of test fused protein comprises a kind of activation structure territory of activating transcription factor or DNA binding domains and a kind ofly has at least 1 * 10 in described library 7Multifarious test protein, described test protein comprises: the first polypeptide subunit of a sequence variations in the library, a second polypeptide subunit that is independent of the first polypeptide series of variation in the library is with a kind of joint peptide that is connected the described first and second polypeptide subunits;
    In the yeast cell of expressing described test fused protein, express a kind of target fused protein, described target fused protein comprises DNA binding domains or activation structure territory and a kind of target peptide or the protein of activating transcription factor, and described activating transcription factor is not contained in the described test fused protein; With
    Screen the yeast cell that those express reporter gene, the expression of described reporter gene is activated by a kind of activating transcription factor of reorganization, and the activating transcription factor of described reorganization is attached on the described target fused protein by described test fused protein and forms.
  2. 2. the method for claim 1, the expression in the library of wherein said test fused protein comprises that the library with the test expression vector is transformed in the yeast cell that comprises a kind of reporter gene construct, described reporter gene construct comprises reporter gene, its expression be subjected to described reorganization activating transcription factor transcribe control, every kind of test expression vector comprises
    Encode the activation structure territory of described activating transcription factor or DNA binding domains first transcription sequence and
    The encode sequence of one of described test protein.
  3. 3. the method for claim 2 is wherein expressed a kind of target fused protein and is comprised
    Simultaneously or in a sequence be transformed into the library of a kind of target expression vector and described test expression vector in the yeast cell, described target expression vector comprises the activation structure territory of encoding transcription incitant or second transcription sequence of DNA binding domains, and described activating transcription factor is not expressed by test expression vector library; Target sequence with one section described target protein of coding or peptide;
    With express described target fused protein from described target expression vector.
  4. 4. the process of claim 1 wherein that the step of expressing the library of described test fused protein and expressing described target fused protein is included between first and second populations of haploid yeast cell of relative mating type carries out mating,
    Wherein
    First population of haploid yeast cell comprises the library of the test expression vector in a kind of described test fused protein library, every kind of test expression vector comprises activation structure territory or first transcription sequence of DNA binding domains and the sequence of one section one of described test protein of encoding of the described activating transcription factor of encoding;
    Second population of haploid yeast cell comprises a kind of target expression vector, it comprises the activation structure territory of encoding transcription incitant or second transcription sequence of DNA binding domains, described activating transcription factor is not by the target sequence of the expression of the library of described test expression vector and a section encode described target protein or peptide;
    First or second population of described haploid yeast cell comprises a kind of reporter gene construct, and it comprises expresses the described reporter gene of transcribing control that is subjected to described activating transcription factor.
  5. 5. the method for claim 4, the haploid yeast cell of wherein said relative mating type is α and a type yeast strain.
  6. 6. the method for claim 5, the mating between first and second populations of the haploid yeast cell of wherein said α and a type bacterial strain is to carry out in being rich in the substratum of nutrition.
  7. 7. the process of claim 1 wherein that the diversity of test protein in described test fused protein library is at least 1 * 10 8
  8. 8. the process of claim 1 wherein that the diversity of test protein in described test fused protein library is at least 1 * 10 10
  9. 9. the process of claim 1 wherein that the diversity of test protein in described test fused protein library is at least 1 * 10 12
  10. 10. the process of claim 1 wherein that the first polypeptide subunit in described test protein library comprises an antibody heavy chain variable region and the described second polypeptide subunit comprises an antibody chain variable region.
  11. 11. the process of claim 1 wherein that described target fused protein comprises the relevant antigen of a kind of and a kind of symptom.
  12. 12. the process of claim 1 wherein that described target fused protein comprises a kind of tumour-surface antigen.
  13. 13. the method for claim 1, wherein be selected from beta-galactosidase enzymes by described reporter gene encoded protein matter, alpha-galactosidase, luciferase, β-glucuronidase, E.C. 2.3.1.28, secretor type embryo alkaline phosphatase, green fluorescent protein, enhanced blue fluorescent protein, strengthen yellow fluorescence protein and strengthen cyan fluorescent protein.
  14. 14. the process of claim 1 wherein that the described first polypeptide subunit and the second polypeptide subunit are by the variable region of the immunoglobulin gene of people, non--people primates or rodent coding.
  15. 15. the process of claim 1 wherein that the described first polypeptide subunit and the second polypeptide subunit are respectively by weight-chain variable region of human immunoglobulin gene and light-chain variable region coding.
  16. 16. the method for claim 1, the wherein said first polypeptide subunit is encoded by light-chain variable region of second human immunoglobulin gene who is different from the first immunoglobulin gene by the weight-chain variable region coding and the described second polypeptide subunit of the first immunoglobulin gene.
  17. 17. a screening can be incorporated into the method for the test protein on a kind of target peptide or the protein, it comprises:
    (a) will test the expression vector library and be transformed into the yeast cell that comprises a kind of reporter gene construct
    In, described reporter gene construct comprises the control of transcribing that a kind of expression is subjected to activating transcription factor
    The reporter gene of system, described activating transcription factor comprises a kind of activation structure territory and a kind of
    The DNA binding domains, every kind of test expression vector comprises
    Encode the activation structure territory of described activating transcription factor or DNA binding domains
    First transcription sequence and
    One section test protein sequence, it comprises first nuclear of the coding first polypeptide subunit
    Nucleotide sequence, second nucleotide sequence of the second polypeptide subunit of encoding is connected described with coding
    The joint sequence of the joint peptide of the first and second polypeptide subunits;
    (b) target expression vector and described test expression vector library simultaneously or in a sequence are transformed into yeast
    In the cell, described target expression vector comprises:
    Second of the activation structure territory of encoding transcription incitant or DNA binding domains
    Transcription sequence, described activating transcription factor are not expressed vector library by described test and are expressed; With
    The target sequence of one section encode described target protein or peptide;
    (c) express that vector library is expressed described test fused protein and from described target table from described test
    Reach the described target fused protein of vector expression;
    (d) screen the yeast clone that those express described reporter gene, the expression quilt of described reporter gene
    Described test fused protein is attached on the described target fused protein and activates;
    (e) from the yeast clone of described screening, separate described test expression vector; With
    (f) first and second nucleotide sequences in the described isolating test expression vector of mutagenesis are with shape
    Become the library of the expression vector of a mutagenesis.
  18. 18. the method for claim 17, wherein said mutagenesis are selected from fallibility PCR mutagenesis, site-directed mutagenesis, DNA reorganization and their combination.
  19. 19. the method for claim 17, it further comprises:
    (g) the expression vector library with described mutagenesis is transformed in the yeast cell of step (a),
    (h) simultaneously or sequentially with the expression vector library of the target expression vector of step (b) and described mutagenesis
    Be transformed in the yeast cell;
    (i) express described target fused protein from described target expression vector;
    (j) screen the yeast clone that those express described reporter gene, the expression of described reporter gene
    Be attached on the described target fused protein by described test fused protein and activate.
  20. An antibody heavy chain variable region and an antibody chain variable region 20. the method for claim 17, wherein said first and second polynucleotide are encoded respectively.
  21. 21. a screening can be incorporated into the test protein on a kind of target peptide or the protein and improves the method for their binding affinity, it comprises
    (a) between first and second populations of the relative haploid yeast cell of mating type, hand over
    Join, wherein
    First population of haploid yeast cell comprises a kind of test fused protein library
    Test express vector library, every kind of test expression vector comprise one section coding described transcribe sharp
    The activation structure territory of the factor of living or first transcription sequence and one section examination of DNA binding domains
    Candling white matter sequence, it comprises first nucleotide sequence of the first polypeptide subunit of encoding, coding
    Second nucleotide sequence of the second polypeptide subunit is connected described first and second polypeptide with coding
    The joint sequence of the joint peptide of subunit;
    Second population of haploid yeast cell comprises a kind of target expression vector, it comprises the activation structure territory of one section encoding transcription incitant or second transcription sequence of DNA binding domains, described activating transcription factor is not by the target sequence of the expression of the library of described test expression vector and a section encode described target protein or peptide;
    Comprise a kind of reporter gene structure with first or second population of described haploid yeast cell
    Build body, it comprises expression and is subjected to described activating transcription factor to transcribe the reporter gene of control;
    (b) express that vector library is expressed described test fused protein and from described target from described test
    Expression vector is expressed described target fused protein;
    (c) screen the yeast clone that those express described reporter gene, the expression of described reporter gene
    Be attached on the described target fused protein by described test fused protein and activate;
    (d) from the yeast clone of described screening, separate described test expression vector; With
    (f) first and second nucleotide sequences in the described isolating test expression vector of mutagenesis, with
    Form the library of the expression vector of a mutagenesis.
  22. 22. the method for claim 21, wherein said mutagenesis are selected from fallibility PCR mutagenesis, site-directed mutagenesis, DNA reorganization and their combination.
  23. 23. the method for claim 21, the haploid yeast cell of wherein said relative mating type are α and a type yeast strain.
  24. 24. a screening can be incorporated into the method for the single-chain antibody on the human growth factor acceptor, it comprises:
    (a) will test the expression vector library and be transformed into the yeast cell that comprises a kind of reporter gene construct
    In, described reporter gene construct comprises expresses the control of transcribing that is subjected to a kind of activating transcription factor
    The reporter gene of system, described activating transcription factor comprise an activation structure territory and one
    The DNA binding domains, every kind of test expression vector comprises the described activating transcription factor of coding
    Activation structure territory or first transcription sequence of DNA binding domains and one section test egg
    The white matter sequence, it comprises first nucleotide sequence of encoding antibody variable region of heavy chain, coding
    Second nucleotide sequence of antibody chain variable region is connected described antibody with one section coding and weighs
    The joint sequence of the joint peptide of chain and variable region of light chain;
    (b) target expression vector and described test expression vector library simultaneously or in a sequence are transformed into yeast
    In the cell, described target expression vector comprises
    Second of the activation structure territory of encoding transcription incitant or DNA binding domains
    Transcription sequence, described activating transcription factor do not expressed by described test that vector library is expressed and
    The target sequence of one section coding human growth factor acceptor;
    (c) express that vector library is expressed described test fused protein and from described target table from described test
    Reach the described target fused protein of vector expression; With
    (d) screen the yeast clone that those express described reporter gene, the expression of described reporter gene is attached on the described target fused protein by described test fused protein and activates.
  25. 25. a screening can be incorporated into the method for the single-chain antibody on the human growth factor acceptor, it comprises:
    (a) between first and second populations of the relative haploid yeast cell of mating type, carry out
    Mating,
    First population of haploid yeast cell comprises a kind of fused protein library of testing
    Vector library is expressed in test, and every kind of test expression vector comprises one section described transcriptional activation of coding
    The activation structure territory of the factor or first transcription sequence of DNA binding domains and one section test
    Protein sequence, it comprises first nucleotide sequence of a kind of antibody heavy chain variable region of encoding,
    Encode a kind of second nucleotide sequence of antibody chain variable region is connected described with one section coding
    The joint sequence of the joint peptide of heavy chain of antibody and variable region of light chain,
    Second population of haploid yeast cell comprises a kind of target expression vector, and it comprises one
    Second of the activation structure territory of section encoding transcription incitant or DNA binding domains transcribed preface
    Row, described activating transcription factor are not expressed and one section by the library of described test expression vector
    The target sequence of coding human growth factor acceptor; With
    First or second population of described haploid yeast cell comprises a kind of reporter gene and makes up
    Body, it comprises expression and is subjected to described activating transcription factor to transcribe the reporter gene of control;
    (b) express that vector library is expressed described test fused protein and from described from described test
    The target expression vector is expressed described target fused protein;
    (c) screen the yeast clone that those express described reporter gene, the table of described reporter gene
    Reach to be attached on the described target fused protein and activate by described test fused protein;
  26. 26. the described method of claim 25, wherein said relative mating type haploid yeast cell is αWith aThe type yeast strain.
  27. 27. the method for claim 25, wherein said human growth factor is selected from Urogastron, transferrin, rhIGF-1, transforming growth factor, interleukin 1 and interleukin II.
  28. 28. a screening can be incorporated into the method for the test protein on target peptide or the protein, described method comprises:
    In yeast cell, express test fused protein library, every kind of test protein is included in the first polypeptide subunit of series of variation in the library, in the library, be independent of the second polypeptide subunit of the described first polypeptide series of variation, with the joint peptide that is connected the described first and second polypeptide subunits;
    Express a plurality of target fused proteins in the yeast cell of expressing described test protein, every kind of target fused protein comprises a kind of target peptide or protein; With
    Screen the yeast cell that those express reporter gene, the expression of described reporter gene is attached on the described target fused protein by described test fused protein and activates.
  29. 29. being included between first and second populations of haploid yeast cell of relative mating type, the method for claim 28, wherein said expression test fused protein library and the step of expressing a plurality of target fused proteins carry out mating, wherein
    First population of described haploid yeast cell comprises the test in test fused protein library and expresses vector library, every kind of test expression vector comprises the activation structure territory of one section described activating transcription factor of coding or first transcription sequence of DNA binding domains, first nucleotide sequence of one section described first polypeptide subunit of coding, second nucleotide sequence of one section described second polypeptide subunit of coding and, one section coding connects the joint sequence of the joint peptide of described first nucleotide sequence and described second nucleotide sequence;
    Second population of described haploid yeast cell comprises a plurality of target expression vectors, every kind of target expression vector comprises the activation structure territory of one section encoding transcription incitant or second transcription sequence of DNA binding domains, described activating transcription factor is not expressed the target sequence of vector library expression and a section encode described target protein or peptide by described test;
    Comprise a kind of reporter gene construct with first or second population of described haploid yeast cell, it comprises expresses the reporter gene of transcribing control that is subjected to described activating transcription factor.
  30. 30. the member that the method for claim 28, wherein said test are expressed vector library one or more many-be independent yeast clone in the flat board of hole by array.
  31. 31. the method for claim 28, the member in wherein said target expression vector library one or more many-be independent yeast clone in the flat board of hole by array.
  32. 32. the method for claim 28, wherein said mating is based on clone's mating, and each yeast clone that contains described test expression vector member carries out mating with each of described target expression vector library member individually in clone's mating.
  33. 33. the method for claim 28, wherein said a plurality of target expression vector is an expression vector library, and it comprises people EST clone's the aggregate or the aggregate of structural domain structure.
  34. 34. a test kit, it comprises:
    First and second populations of the haploid yeast cell of relative mating type,
    First population of described haploid yeast cell comprises the test in described test fused protein library and expresses vector library, every kind of test expression vector comprises the activation structure territory of one section encoding transcription incitant or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit is connected the joint sequence of joint peptide of described first nucleotide sequence and described second nucleotide sequence with one section coding;
    Second population of described haploid yeast cell comprises a kind of target expression vector, the activation structure territory of described target expression vector codes activating transcription factor or DNA binding domains, described activating transcription factor is not expressed the target sequence of vector library expression and a section encode described target protein or peptide by described test;
    First or second population of wherein said haploid yeast cell comprises a kind of reporter gene construct, and it comprises expresses the reporter gene of transcribing control that is subjected to described activating transcription factor.
  35. 35. the test kit of claim 34, second population of wherein said haploid yeast cell comprises a plurality of target expression vectors, the activation structure territory of every kind of target expression vector codes activating transcription factor or DNA binding domains, described activating transcription factor are not expressed vector library by described test and are expressed; Target sequence with one section described target protein of coding or peptide.
  36. 36. the test kit of claim 34, the haploid yeast cell of wherein said relative mating type is αWith aThe type yeast strain.
  37. 37. the test kit of claim 34, the wherein said first polypeptide subunit comprise an antibody weight-chain variable region and the described second polypeptide subunit comprise an antibody light-chain variable region.
  38. 38. the method for claim 34, wherein be selected from beta-galactosidase enzymes by described reporter gene encoded protein matter, alpha-galactosidase, luciferase, β-glucuronidase, E.C. 2.3.1.28, secretor type embryo alkaline phosphatase, green fluorescent protein, enhanced blue fluorescent protein, enhanced yellow fluorescence protein and enhanced cyan fluorescent protein.
  39. 39. a method that produces the Yeast expression carrier library, it comprises:
    To have the linearizing Yeast expression carrier of 5 ' and 3 '-end sequence and the library transformed yeast cell of linear and double-stranded insertion nucleotide sequence in the linearizing site, every section insertion sequence comprises first nucleotide sequence of an antibody heavy chain variable region of one section coding, second nucleotide sequence of one section coding [the second polypeptide subunit] antibody chain variable region, one section coding connects the joint sequence of the joint peptide of described antibody heavy chain variable region and described antibody chain variable region, with be positioned at 5 ' of described insertion sequence end-and 3 '-flanking sequence, they respectively with 5 ' of linearizing Yeast expression carrier-and abundant homology of 3 '-end sequence so that homologous recombination can take place; With
    Make and between described linearizing Yeast expression carrier and described insertion sequence library, carry out homologous recombination, in by transformed yeast cells, to form the Yeast expression carrier library that comprises described insertion sequence;
    Wherein
    In by transformed yeast cells, antibody heavy chain variable region, antibody chain variable region and joint polypeptide are expressed as single fused protein by described Yeast expression carrier library;
    First and second nucleotides sequences of described insertion sequence are listed in that each makes a variation independently in the described Yeast expression carrier library; With
    The diversity of the insertion sequence that is comprised in described Yeast expression carrier library is at least 1 * 10 7
  40. 40. the method for claim 39,5 ' of wherein said insertion nucleotide sequence-or the long 30-120bp of 3 '-flanking sequence.
  41. 41. the method for claim 39,5 ' of wherein said insertion nucleotide sequence-or the long 40-90bp of 3 '-flanking sequence.
  42. 42. the method for claim 39,5 ' of wherein said insertion nucleotide sequence-or the long 60-80bp of 3 '-flanking sequence.
  43. 43. the method for claim 39, the long 30-120bp of the joint sequence of wherein said insertion nucleotide sequence.
  44. 44. the method for claim 39, the long 45-102bp of the joint sequence of wherein said insertion nucleotide sequence.
  45. 45. the method for claim 39, the long 45-63bp of the joint sequence of wherein said insertion nucleotide sequence.
  46. 46. the method for claim 39, the joint sequence of wherein said insertion nucleotide sequence comprise one section coding Gly-Gly-Gly-Gly-Ser[SEQ ID NO:76] nucleotide sequence of the aminoacid sequence that exists with 3 or 4 series connection repetition forms.
  47. 47. the method for claim 39, wherein said Yeast expression carrier are a kind of 2 μ plasmid vectors.
  48. 48. the method for claim 39 wherein is contained in the antibody heavy chain variable region of the insertion sequence in the described Yeast expression carrier library or the diversity of antibody chain variable region and is at least 10 3
  49. 49. the method for claim 39 wherein is contained in the antibody heavy chain variable region of the insertion sequence in the described Yeast expression carrier library or the diversity of antibody chain variable region and is at least 10 4
  50. 50. the method for claim 39 wherein is contained in the antibody heavy chain variable region of the insertion sequence in the described Yeast expression carrier library or the diversity of antibody chain variable region and is at least 10 5
  51. 51. the method for claim 39, the diversity that wherein is contained in the insertion sequence in the described Yeast expression carrier library is at least 1 * 10 8
  52. 52. the method for claim 39, the diversity that wherein is contained in the insertion sequence in the described Yeast expression carrier library is at least 1 * 10 10
  53. 53. the method for claim 39, the diversity of the wherein said insertion sequence that comprises
  54. 54. the method for claim 39, wherein with respect to described second nucleotide sequence, described first nucleotide sequence is positioned at 5 ' end.
  55. 55. the method for claim 39, wherein every kind of described expression vector further comprises the sequence of one section a kind of affinity tag of coding.
  56. 56. the method for claim 55, wherein said affinity tag is selected from the polyhistidine tag thing, poly arginine marker, glutathione-S-transferase, maltose binding protein, staphylococcal protein A,SPA marker and EE-epi-position marker.
  57. 57. the method for claim 39, every kind in the wherein said insertion nucleotide sequence library is inserted nucleotide sequence and is produced by overlapping PCR, described overlapping PCR is assembled into a single fragment by an overlapping PCR fragment and the segmental joint sequence of the 2nd PCR with a PCR fragment and the 2nd PCR fragment, a described PCR fragment comprises described 5 '-flanking sequence with 5 '-3 ' order, described first nucleotide sequence and described joint sequence; Comprise described 3 '-flanking sequence, described second nucleotide sequence and described joint sequence with described the 2nd PCR fragment with 3 '-5 ' order.
  58. The variable region of heavy chain and the variable region of light chain of people, non--people primates or rodent immunoglobulin gene 58. the method for claim 39, wherein said first nucleotide sequence and described second nucleotide sequence are encoded respectively.
  59. Human immunoglobulin gene's variable region of heavy chain and variable region of light chain 59. the method for claim 39, wherein said first nucleotide sequence and described second nucleotide sequence are encoded respectively.
  60. 60. the method for claim 39, described linearizing Yeast expression carrier further comprises: the activation structure territory of one section encoding transcription incitant or the transcription sequence of DNA binding domains.
  61. 61. the method for claim 60, wherein said transcription sequence can be expressed as a kind of fused protein, and described single fused protein comprises described antibody heavy chain variable region, described antibody chain variable region and described joint polypeptide.
  62. 62. the method for claim 61, wherein said activating transcription factor are a kind of activating transcription factors with separable DNA combination and transcriptional activation domain.
  63. 63. the library of claim 62, wherein said activating transcription factor is selected from GAL4, GCN4 and ADR1 activating transcription factor.
  64. 64. a method that produces the Yeast expression carrier library, it comprises:
    (a) be transformed into following substances in the yeast cell
    I) have 5 ' in the first linearizing site-and the linearizing yeast of 3 '-end sequence
    Expression vector; With
    First ii) linear, the double-stranded library of inserting nucleotide sequence, every kind described first
    Insertion sequence comprises first nucleotide sequence of one section coding first polypeptide subunit, is positioned at
    5 ' of the described first insertion sequence end-and 3 '-flanking sequence, they respectively be positioned at
    5 ' of the carrier in the first linearizing site-and the abundant homology of 3 '-end sequence, so that
    Homologous recombination can take place;
    (b) at described described carrier and described first insertion sequence of carrying out in by transformed yeast cells
    Homologous recombination is contained in the carrier insertion sequence of winning;
    (c) comprised carrying of the described first insertion sequence library from described the separation the transformed yeast cells
    Body;
    (d) the described carrier that comprises the first insertion sequence library of linearizing is with in the second linearizing site
    Generation 5 '-and 3 '-end sequence;
    (e) be transformed into following substances in the yeast cell
    I) the linearizing Yeast expression carrier in the step d) and
    Second ii) linear, the double-stranded insertion nucleotide sequence library, every kind second insertion sequence
    Second nucleotide sequence that comprises the second polypeptide subunit of encoding is positioned at described second and inserts
    Go into 5 ' of sequence end-and 3 '-flanking sequence, they respectively be positioned at second linearity
    5 ' of the carrier in change site-and the abundant homology of 3 '-end sequence, so that can take place
    Homologous recombination; With
    (f) in by transformed yeast cells, be positioned at the linearizing of the described second linearizing site
    Carry out homologous recombination between Yeast expression carrier and described second insertion sequence, make described
    Second insertion sequence is contained in the described carrier, and described first and second nucleotides sequences
    Row are connected by one section joint sequence;
    Wherein
    Described expression vector is with the described first polypeptide subunit, and the described second polypeptide subunit becomes a kind of single fused protein with described joint expression of polypeptides; With
    Described first and second nucleotides sequences are listed in that each makes a variation independently in the described expression vector library.
  65. 65. the method for claim 64, wherein said first or described second insert 5 ' of nucleotide sequence-or 3 '-flanking sequence be about 30-120bp.
  66. 66. the method for claim 64, wherein said first or described second insert 5 ' of nucleotide sequence-or 3 '-flanking sequence be about 40-90bp.
  67. 67. the method for claim 64, wherein said first or described second insert 5 ' of nucleotide sequence-or 3 '-flanking sequence be about 60-80bp.
  68. 68. the method for claim 64, the long 30-120bp of wherein said joint sequence.
  69. 69. the method for claim 64, the long 45-102bp of wherein said joint sequence.
  70. 70. the method for claim 64, the long 45-63bp of wherein said joint sequence.
  71. 71. the method for claim 64, wherein said joint sequence comprise one section nucleotide sequence, the aminoacid sequence that its coding Gly-Gly-Gly-Gly-Ser exists with 3 or 4 series connection multiple forms.
  72. 72. the method for claim 64, wherein be positioned at described first or second insert 5 ' of nucleotide sequence end-and 3 '-flanking sequence comprise 5 ' respectively-and 3 '-site-specific recombination site, they are discerned by a kind of site-specific recombinase.
  73. 73. the method for claim 72, wherein said 5 '-and one of 3 '-site-specific recombination site be coliphase P1 loxP, another is a mutant loxP sequence.
  74. 74. the method for claim 72, wherein said 5 '-and 3 '-site-specific recombination site each be independently selected from SEQ ID Nos 1-13.
  75. 75. the method for claim 72, wherein said site-specific recombinase is the CRE recombinase.
  76. 76. the method for claim 72, it further comprises:
    Between the member in described Yeast expression carrier library, 5 '-and 3 '-recombination site carry out the site-specific reorganization, described reorganization causes between the member in Yeast expression carrier library described first or the exchange of second nucleotide sequence.
  77. 77. being the expression by a kind of recombinase, the method for claim 76, wherein said reorganization cause that being expressed in the described yeast cell of described recombinase can be induced control.
  78. 78. the method for claim 77 is wherein said 5 '-be different loxP sequences with 3 '-recombination site, but and described reorganization be that abduction delivering by the CRE recombinase in the yeast cell causes.
  79. 79. the library of a Yeast expression carrier, the library of its a kind of fused protein of encoding, every kind of carrier comprises:
    First nucleotide sequence of one section coding first polypeptide subunit;
    Second nucleotide sequence of one section coding second polypeptide subunit; With
    One section coding connects the joint sequence of the joint peptide of described first nucleotide sequence and described second nucleotide sequence;
    Wherein
    The described first polypeptide subunit, described second polypeptide subunit and described joint polypeptide are expressed as a kind of single fused protein in described fused protein library;
    Described first and second nucleotides sequences are listed in that each makes a variation independently in the described expression vector library; With
    The diversity in described fused protein library is at least 1 * 10 7
  80. 80. the library of claim 79, wherein said Yeast expression carrier are 2 μ plasmid vectors.
  81. 81. the library of claim 79, wherein said Yeast expression carrier are one primary yeast-bacterium shuttle vectorss, it comprises a bacterium replication orgin.
  82. 82. the library of claim 79, wherein the diversity of the first or second polypeptide subunit in described fused protein library is at least 10 3
  83. 83. the library of claim 79, wherein the diversity of the first or second polypeptide subunit in described fused protein library is at least 10 4
  84. 84. the library of claim 79, wherein the diversity of the first or second polypeptide subunit in described fused protein library is at least 10 5
  85. 85. the library of claim 79, wherein the fusion rotein qualitative diversity by described Yeast expression carrier library coding is at least 1 * 10 8
  86. 86. the library of claim 79, wherein the fusion rotein qualitative diversity by described Yeast expression carrier library coding is at least 1 * 10 10
  87. 87. the library of claim 79, wherein the fusion rotein qualitative diversity by described Yeast expression carrier library coding is at least 1 * 10 12
  88. The class polymer protein 88. encode in the library of claim 79, wherein said fused protein library, and the described first and second polypeptide subunits are subunits of this class polymer protein.
  89. 89. the library of claim 88, wherein said polymer protein library is selected from antibody, growth factor receptors, TXi Baoshouti, cytokine receptor, Tyrosylprotein kinase associated receptor and MHC protein library.
  90. 90. the library of claim 79, wherein with respect to described second nucleotide sequence, described first nucleotide sequence is positioned at 5 ' end.
  91. 91. the library of claim 90, first nucleotide sequence in the wherein said expression vector library comprises the encoding sequence of one section antibody weight-chain variable region, and described second nucleotide sequence comprise one section antibody light-encoding sequence of chain variable region.
  92. 92. the library of claim 91, wherein said antibody is light-and the source of the encoding sequence of chain and weight-chain variable region is from the people, non--people primates or rodent DNA.
  93. 93. the library of claim 91, wherein said antibody is light-and the source of the encoding sequence of chain and weight-chain variable region is from one or more non--immune animals.
  94. 94. the library of claim 91, wherein said antibody is light-and the source of the encoding sequence of chain and weight-chain variable region is selected from people's tire spleen, lymphoglandula or peripheral blood cells.
  95. 95. the library of claim 79, the wherein long 30-120bp of joint sequence in described expression vector library.
  96. 96. the library of claim 79, the wherein long 45-102bp of joint sequence in described expression vector library.
  97. 97. the library of claim 79, the wherein long 45-63bp of joint sequence in described expression vector library.
  98. 98. the library of claim 79, the joint sequence in the wherein said expression vector library comprises one section nucleotide sequence, its coding Gly-Gly-Gly-Gly-Ser[SEQ ID NO:76] aminoacid sequence that exists with 3 or 4 series connection repetition forms.
  99. 99. the library of claim 79, every kind of carrier further comprises: the transcription sequence in the activation structure territory of one section a kind of activating transcription factor of coding.
  100. 100. the library of claim 99, wherein said activating transcription factor is selected from GAL4, GCN4 and ADR1 activating transcription factor.
  101. 101. the library of claim 79, every kind of carrier further comprises the transcription sequence of the DNA binding domains of one section a kind of activating transcription factor of coding.
  102. 102. the library of claim 101, wherein said activating transcription factor is selected from GAL4, GCN4 and ADR1 activating transcription factor.
  103. Human immunoglobulin gene's variable region of heavy chain and variable region of light chain 103. encode respectively in the library of claim 79, wherein said first nucleotide sequence and described second nucleotide sequence.
  104. 104. the method for claim 79, the variable region of heavy chain of the wherein said first nucleotide sequence coded the first immunoglobulin gene and the described second nucleotide sequence coded variable region of light chain that is different from second human immunoglobulin gene of described the first immunoglobulin gene.
  105. 105. the library of claim 79, wherein every kind of described expression vector further comprises the sequence of one section a kind of affinity tag of coding.
  106. 106. the library of claim 105, wherein said affinity tag is selected from the polyhistidine tag thing, poly arginine marker, glutathione-S-transferase, maltose binding protein, staphylococcal protein A,SPA marker and EE-epi-position marker.
  107. 107. one kind by the library of transformed yeast cells, it comprises: with a kind of Yeast expression carrier library transformed yeast cells, every kind of carrier comprises:
    First nucleotide sequence of one section coding first polypeptide subunit;
    Second nucleotide sequence of one section coding second polypeptide subunit; With
    One section coding connects the joint sequence of the joint peptide of described first nucleotide sequence and described second nucleotide sequence;
    Wherein
    The described first polypeptide subunit, described second polypeptide subunit and described joint peptide are expressed as a kind of single fused protein;
    Each variation independently in described Yeast expression carrier library of described first and second nucleotide sequences; With
    The fusion rotein qualitative diversity of being expressed by described Yeast expression carrier library is at least 1 * 10 7
  108. 108. the library of claim 107, wherein said yeast cell are the diploid yeast cells.
  109. 109. the library of claim 107, wherein said yeast cell is a haploid yeast cell;
  110. 110. the library of claim 109, wherein said haploid yeast cell are a or α yeast strain.
  111. 111. protein-DNA that a screening forms between test protein and target DNA sequence is in conjunction with right method, it comprises:
    Express test fused protein library in the yeast cell that comprises a kind of reporter gene construct, described reporter gene construct comprises a kind of reporter gene, and its expression is subjected to the control of transcribing of target DNA sequence, and every kind of test fused protein comprises:
    A kind of activation structure territory of activating transcription factor,
    The first polypeptide subunit, its sequence makes a variation in described library,
    The second polypeptide subunit, in described library its sequence be independent of the variation of the described first polypeptide subunit and
    A kind of the described first polypeptide subunit is connected to joint peptide on the described second polypeptide subunit: and
    The yeast cell of described reporter gene is expressed in screening, and the expression of described reporter gene is attached to described target DNA sequence by described test fused protein and activates.
  112. 112. the method for claim 111, wherein
    The expression in described test fused protein library comprises that vector library is expressed in the test in described test fused protein library to be transformed in the yeast cell, and every kind of test expression vector comprises
    The transcription sequence in the activation structure territory of one section described activating transcription factor of coding,
    First nucleotide sequence of one section described first polypeptide subunit of coding,
    One section the coding the described second polypeptide subunit second nucleotide sequence and
    One section coding connects the joint sequence of the joint peptide of described first nucleotide sequence and described second nucleotide sequence.
  113. 113. the method for claim 111, wherein expressing test fused protein library in yeast cell is included between first and second populations of haploid yeast cell of relative mating type and carries out mating, described yeast cell comprises a kind of reporter gene construct, it comprises a kind of expression and is subjected to the target DNA sequence to transcribe the reporter gene of control
    First population of described haploid yeast cell comprises the test in described test fused protein library and expresses vector library, every kind of test expression vector comprises the transcription sequence in the activation structure territory of one section described activating transcription factor of coding, first nucleotide sequence of one section described first polypeptide subunit of coding, second nucleotide sequence of one section described second polypeptide subunit of coding is connected the joint sequence of joint peptide of described first nucleotide sequence and described second nucleotide sequence with one section coding; With
    Second population of described haploid yeast cell comprises described reporter gene construct.
  114. 114. the method for claim 113, the haploid yeast cell of wherein said relative mating type is αWith aThe type yeast strain.
  115. 115. the method for claim 114 is wherein said αWith aMating between first and second populations of type bacterial strain haploid yeast cell is to carry out in being rich in the substratum of nutrition.
  116. 116. the method for claim 111, wherein the fusion rotein qualitative diversity by described Yeast expression carrier library coding is at least 1 * 10 6
  117. 117. the method for claim 111, wherein the fusion rotein qualitative diversity by described Yeast expression carrier library coding is at least 1 * 10 10
  118. 118. the method for claim 111, wherein the fusion rotein qualitative diversity by described Yeast expression carrier library coding is at least 1 * 10 12
  119. 119. the method for claim 111, the diversity of the wherein said first and second polypeptide subunits each independently derived from the precursor sequence library, described precursor sequence library be not for described target peptide or protein specially designed.
  120. 120. the method for claim 111, the diversity of the wherein said first and second polypeptide subunits are not to derive from one or more protein, described protein is known described target peptide or the proteinic protein of being attached to.
  121. 121. the method for claim 111, the diversity of the wherein said first and second polypeptide subunits do not produce by one or more protein of mutagenesis, described protein is known described target peptide or the proteinic protein of being attached to.
  122. 122. the method for claim 111, wherein with respect to described second nucleotide sequence, described first nucleotide sequence is to be positioned at 5 ' end.
  123. 123. the method for claim 122, first nucleotide sequence in the wherein said expression vector library comprise the encoding sequence of one section antibody weight-chain variable region and described second nucleotide sequence comprise one section antibody light-encoding sequence of chain variable region.
  124. 124. the method for claim 111, wherein the joint peptide of being expressed by described expression vector library passes described fused protein library a kind of fully conservative conformation is provided between the described first and second polypeptide subunits, and described fused protein library is expressed by described expression vector library.
  125. 125. the method for claim 111, the conformation of a kind of single-chain antibody of conformation simulation of wherein said fused protein, described fused protein has the described first and second polypeptide subunits that connected by described joint peptide.
  126. 126. the method for claim 111, wherein the first and second polypeptide subunits of the fused protein in described test protein library comprise respectively antibody weight-chain variable region and antibody light-chain variable region.
  127. 127. the method for claim 111, wherein the target DNA sequence in described reporter gene construct is positioned 5 ' end of described reporter gene with 2-6 series connection multiple form.
  128. 128. the method for claim 111, wherein the target DNA sequence in described reporter gene construct is about 15-75bp.
  129. 129. the method for claim 111, wherein the target DNA sequence in described reporter gene construct is about 25-55bp.
  130. 130. the method for claim 111, wherein be selected from beta-galactosidase enzymes by described reporter gene encoded protein matter, alpha-galactosidase, luciferase, β-glucuronidase, E.C. 2.3.1.28, secretor type embryo alkaline phosphatase, green fluorescent protein, enhanced blue fluorescent protein, enhanced yellow fluorescence protein and enhanced cyan fluorescent protein.
  131. 131. the method for claim 111, it further comprises:
    From screened clone, separate described test expression vector; With
    Described first and second nucleotide sequences in the separated test expression vector of mutagenesis are to form the expression vector library of a mutagenesis.
  132. 132. the method for claim 131, wherein said mutagenesis are selected from fallibility PCR mutagenesis, site-directed mutagenesis, DNA reorganization and their combination.
  133. 133. a screening can be incorporated into the method for the test protein on the target protein, it comprises:
    Express a kind of test fused protein library in yeast cell, described yeast cell comprises a kind of reporter gene construct, and it comprises a kind of expression and is subjected to the specific DNA binding site to transcribe the reporter gene of control, and every kind of described test fused protein comprises
    A kind of activation structure territory of activating transcription factor,
    The first polypeptide subunit,
    The second polypeptide subunit and
    The described first polypeptide subunit is connected to joint peptide on the described second polypeptide subunit, and each makes a variation the sequence of the wherein said first and second polypeptide subunits independently in described test fused protein library;
    In the yeast cell of expressing described test fused protein, express a kind of target protein, be attached on the specific DNA binding site in target protein described in the described yeast cell; With
    The yeast cell of described reporter gene is expressed in screening, and the expression of described reporter gene is attached on the described target protein by described test fused protein and activates.
  134. 134. the method for claim 133, wherein
    The expression in described test fused protein library comprises that the test expression vector with described test fused protein library is transformed in the yeast cell, and every kind of test expression vector comprises
    The transcription sequence in the activation structure territory of one section described activating transcription factor of coding,
    First nucleotide sequence of one section described first polypeptide subunit of coding,
    Second nucleotide sequence of one section described second polypeptide subunit of coding,
    One section coding connects the joint sequence of the joint peptide of described first nucleotide sequence and described second nucleotide sequence.
  135. 135. being included between first and second populations of haploid yeast cell of relative mating type, the method for claim 133, the step of wherein expressing described test fused protein library and expressing described target fused protein carry out mating,
    First population of described haploid yeast cell comprises the test in described test fused protein library and expresses vector library, and every kind of test expression vector comprises
    The transcription sequence in the activation structure territory of one section described activating transcription factor of coding,
    First nucleotide sequence of one section described first polypeptide subunit of coding,
    Second nucleotide sequence of one section described second polypeptide subunit of coding,
    One section coding connects the joint sequence of the joint peptide of described first nucleotide sequence and described second nucleotide sequence;
    Second population of described haploid yeast cell comprises a kind of target expression vector, and it comprises the target sequence of one section described target protein of coding; With
    First or second population of described haploid yeast cell comprises described reporter gene construct.
  136. 136. the method for claim 135, the haploid yeast cell of wherein said relative mating type is αWith aThe type yeast strain.
  137. 137. the method for claim 136 is wherein said αWith aMating between first and second populations of the haploid yeast cell of type bacterial strain is to carry out in being rich in the substratum of nutrition.
  138. 138. the method for claim 133, wherein the first polypeptide subunit in described test fused protein library comprise an antibody weight-chain variable region and the second polypeptide subunit in described test fused protein library comprise an antibody light-chain variable region.
  139. 139. a test kit, it comprises:
    Vector library and a kind of yeast cell system are expressed in a kind of test, every kind of test expression vector comprises the activation structure territory of one section a kind of activating transcription factor of coding or first transcription sequence of DNA binding domains, first nucleotide sequence of one section coding first polypeptide subunit, second nucleotide sequence of one section coding second polypeptide subunit, the joint sequence that is connected the joint peptide of described first nucleotide sequence and described second nucleotide sequence with one section coding
    Wherein said first and second nucleotides sequences are listed in that each makes a variation independently in the described expression vector library.
  140. 140. the test kit of claim 139, it further comprises a kind of target expression vector, described target expression vector comprises the target sequence of one section second transcription sequence and a section encode described target protein or peptide, described second transcription sequence encode the activation structure territory or the DNA binding domains of described activating transcription factor, described activating transcription factor is not expressed vector library by described test and is expressed.
  141. 141. the test kit of claim 139, wherein said yeast cell are to comprise a kind of reporter gene construct, described reporter gene construct comprises a kind of expression and is subjected to the specific DNA binding site to transcribe the reporter gene of control.
  142. 142. the test kit of claim 139, wherein said yeast cell is is diploid yeast clone.
  143. 143. the test kit of claim 139, the wherein said first polypeptide subunit comprise an antibody weight-chain variable region and the described second polypeptide subunit comprise an antibody light-chain variable region.
CN 01813639 2000-06-23 2001-06-25 Generation of libraries of antibodies in yeast and uses thereof Pending CN1444651A (en)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US60297200A 2000-06-23 2000-06-23
US09/602,972 2000-06-23
US09/603,663 US6406863B1 (en) 2000-06-23 2000-06-23 High throughput generation and screening of fully human antibody repertoire in yeast
US09/602,373 2000-06-23
US09/603,658 US6410246B1 (en) 2000-06-23 2000-06-23 Highly diverse library of yeast expression vectors
US09/603,663 2000-06-23
US09/603,658 2000-06-23
US09/602,373 US6410271B1 (en) 2000-06-23 2000-06-23 Generation of highly diverse library of expression vectors via homologous recombination in yeast

Publications (1)

Publication Number Publication Date
CN1444651A true CN1444651A (en) 2003-09-24

Family

ID=27505059

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 01813639 Pending CN1444651A (en) 2000-06-23 2001-06-25 Generation of libraries of antibodies in yeast and uses thereof

Country Status (4)

Country Link
EP (1) EP1297124A2 (en)
CN (1) CN1444651A (en)
AU (1) AU2001271553A1 (en)
CA (1) CA2411515A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101348526B (en) * 2008-08-29 2011-08-17 浙江大学 Anti-interleukin-8 antibody
CN103910799A (en) * 2014-03-06 2014-07-09 中国人民解放军第四军医大学 Fusion protein based on anti-EGFR single-chain antibody and arginine nonamer, and applications of fusion protein
CN104342449A (en) * 2013-08-07 2015-02-11 太仓美诺恒康生物技术有限公司 Construction method of antibody expression vector
CN104725501A (en) * 2013-12-20 2015-06-24 深圳先进技术研究院 Method for establishing HIV (human immunodeficiency virus) virus antibody yeast display library, method for screening virus broad-spectrum neutral antibody and application thereof
CN108728476A (en) * 2017-04-14 2018-11-02 复旦大学 A method of generating diversity antibody library using CRISPR systems
CN112175984A (en) * 2020-09-18 2021-01-05 中国科学院深圳先进技术研究院 Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism
CN112512544A (en) * 2018-07-19 2021-03-16 华盛顿大学 Novel design of protein switch
CN112867801A (en) * 2018-11-30 2021-05-28 Illumina公司 Analysis of multiple analytes using a single assay
CN113711046A (en) * 2019-03-18 2021-11-26 瑞泽恩制药公司 CRISPR/Cas shedding screening platform for revealing gene fragility related to Tau aggregation

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111724858B (en) * 2020-05-14 2024-06-07 东北林业大学 Method for repairing GAP by software operation genome sequence alignment

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101348526B (en) * 2008-08-29 2011-08-17 浙江大学 Anti-interleukin-8 antibody
CN104342449A (en) * 2013-08-07 2015-02-11 太仓美诺恒康生物技术有限公司 Construction method of antibody expression vector
CN104725501A (en) * 2013-12-20 2015-06-24 深圳先进技术研究院 Method for establishing HIV (human immunodeficiency virus) virus antibody yeast display library, method for screening virus broad-spectrum neutral antibody and application thereof
CN103910799A (en) * 2014-03-06 2014-07-09 中国人民解放军第四军医大学 Fusion protein based on anti-EGFR single-chain antibody and arginine nonamer, and applications of fusion protein
CN103910799B (en) * 2014-03-06 2016-03-23 中国人民解放军第四军医大学 A kind of fusion rotein based on anti-EGFR single-chain antibody and arginine nine aggressiveness and application
CN108728476A (en) * 2017-04-14 2018-11-02 复旦大学 A method of generating diversity antibody library using CRISPR systems
CN112512544A (en) * 2018-07-19 2021-03-16 华盛顿大学 Novel design of protein switch
CN112867801A (en) * 2018-11-30 2021-05-28 Illumina公司 Analysis of multiple analytes using a single assay
CN113711046A (en) * 2019-03-18 2021-11-26 瑞泽恩制药公司 CRISPR/Cas shedding screening platform for revealing gene fragility related to Tau aggregation
CN113711046B (en) * 2019-03-18 2023-08-29 瑞泽恩制药公司 CRISPR/Cas shedding screening platform for revealing gene vulnerability related to Tau aggregation
CN112175984A (en) * 2020-09-18 2021-01-05 中国科学院深圳先进技术研究院 Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism

Also Published As

Publication number Publication date
AU2001271553A1 (en) 2002-01-08
CA2411515A1 (en) 2002-01-03
EP1297124A2 (en) 2003-04-02

Similar Documents

Publication Publication Date Title
US10329555B2 (en) High throughput generation and affinity maturation of humanized antibody
US6410271B1 (en) Generation of highly diverse library of expression vectors via homologous recombination in yeast
US6406863B1 (en) High throughput generation and screening of fully human antibody repertoire in yeast
US6410246B1 (en) Highly diverse library of yeast expression vectors
US6610472B1 (en) Assembly and screening of highly complex and fully human antibody repertoire in yeast
RU2569187C2 (en) Collection and methods of its application
CN1306272C (en) In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells
US20050202512A1 (en) Method to screen phage display libraries with different ligands
CN1662556A (en) Immunoglobulin frameworks which demonstrate enhanced stability in the intracellular environment and methods of identifying same
CN1777621A (en) Antibodies against human il-21 receptor and applications therefor
CN1950399A (en) Less immunogenic binding molecules
CN1836041A (en) Look-through mutagenesis
CN1829806A (en) Method for generating high affinity antibodies
CN1956996A (en) Generation of artificial binding proteins based on ubiquitin proteins
US20200316128A1 (en) Universal reporter cell assay for specificity test of novel antigen binding moieties
CN1444651A (en) Generation of libraries of antibodies in yeast and uses thereof
JP2021508246A (en) CAR-T cell assay for specificity testing of novel antigen binding moiety
US20100261177A1 (en) INCREASING SPECIFICITY IN A scFV SCREEN USING DUAL BAIT REPORTERS
CN1152960C (en) ICAM-4 materials and methods
CN1310758A (en) Novel method for isolating gene
JP2022537202A (en) Methods for generating multivalent bispecific antibody-expressing cells by targeted integration of multiple expression cassettes of defined configuration
US20190040118A1 (en) Surface, anchored fc-bait antibody display system
CN114790239B (en) Antibody for resisting coronavirus N protein and application thereof
US20240151720A1 (en) Process for selecting cell clones expressing a heterologous polypeptide
US20210139561A1 (en) Method for the generation of a multivalent, multispecific antibody expressing cells by targeted integration of multiple expression cassettes in a defined organization

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
ASS Succession or assignment of patent right

Owner name: ADIMABOL CO., LTD.

Free format text: FORMER OWNER: GENETASTIX CORP.

Effective date: 20080711

C41 Transfer of patent application or patent right or utility model
TA01 Transfer of patent application right

Effective date of registration: 20080711

Address after: England Hampshire

Applicant after: Adidas mAb company

Address before: American California

Applicant before: Genetastix Corp.

C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication