CN104561080A - Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof - Google Patents

Abstract

The invention provides a brewing yeast integrated expression vector with a recyclable selective marker as well as a construction method and application thereof. The Brewing yeast integrated expression vector with the recyclable selective marker comprises a loxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1), a yeast primary expression cassette and a homologous arm insertable section, wherein the yeast primary expression cassette is any one of a yeast promoter, a multiple cloning site and a transcription terminator. According to the brewing yeast integrated plasmid, replacement of an expression cassette element, cloning of a foreign gene in escherichia coli, integration and screening of the gene in yeast, rapid, simple and convenient removal of the selective marker and recycling of the tool can be realized. According to the invention, removal of the selective marker is represented and verified; the brewing yeast integrated expression vector can be widely applied to long-way multi-gene integration of brewing yeast.

Description

The integrated expression vector of yeast saccharomyces cerevisiae that a kind of selective marker is capable of circulation and construction process thereof

Technical field

The present invention relates to genetically engineered and metabolic engineering field.Specifically, the present invention relates to a kind of construction process of saccharomyces cerevisiae expression of selective marker reusable edible, the polygenic integration in more long-distance footpath in yeast saccharomyces cerevisiae can be widely applied to.

Background technology

Because yeast saccharomyces cerevisiae is at Physiology and biochemistry, high density fermentation, with the many good characteristics on genetic manipulation, much research all selects yeast saccharomyces cerevisiae as Host Strains, the pathways metabolism of external source is imported to the biosynthesizing carrying out high added value compound in brewing yeast cell.But in yeast saccharomyces cerevisiae, set up the polygene pathways metabolism carrying out genetic stability remain a major challenge in metabolic engineering.

At present, what the process LAN carrying out gene in yeast saccharomyces cerevisiae mainly adopted is traditional nutrition selective marker type carrier.Comprising the self-replicating type carrier of the height copy and the mono-copy of CEN/ARS that contain 2 μ replication origins, and lack replication origin, carry the yeast saccharomyces cerevisiae integrating vector (yeast integrated plasmid, YIP) of yeast saccharomyces cerevisiae nutrition selective marker.

Above-mentioned carrier had once played great role in yeast genes functional verification work, but use it for pathways metabolism, to be there is following problem in the structure of the long pathways metabolism particularly containing multiple gene: on the one hand, aimed strain selected by pathways metabolism must be the bacterial strain having multiple nutrition selective marker point site mutation, when industrial fermentation bacterial strain is transformed as host strain, the method will be not suitable with.On the other hand, above-mentioned carrier generally once transforms and can only be integrated into a gene, and when building long pathways metabolism, operation steps will be comparatively loaded down with trivial details.In addition, the drawback of Genomic instability is there is based on the method for attached type vector construction pathways metabolism.Plasmid going down to posterity in yeast is copied needs corresponding auxotrophy substratum, there is interference and not expected restructuring mutually, and multiple plasmid coexists in cell also can cause burden to the production of cell between plasmid; And the YIP type carrier integrated by nutrition marker site in the process building pathways metabolism owing to being adopt dyeing single cross repeatedly to change, there is the repeated fragment of a large amount of length, can cause detrimentally affect to the stability of constructed bacterial strain, after repeatedly going down to posterity, the fragment in some sites there will be loss.

KanMX expresses and can give its resistance to Geneticin (G418) in yeast saccharomyces cerevisiae, and the use of this mark can avoid the use of nutrition selective marker.By being combined by KanMX and loxp/Cre recombination system, the loxp-kanMX-loxp structure of structure can repeatedly with the gene knockout of yeast saccharomyces cerevisiae.This expression cassette is also used for the integration of foreign gene as selective marker at present.Its primary process is: the fragment containing loxp-kanMX-loxp and target gene are expressed and to close and the upstream and downstream of genomic integration site is entered DNA fragmentation and carried out Overlap extension PCR; The PCR primer transformed saccharomyces cerevisiae obtained after filtering out positive colony, then in yeast saccharomyces cerevisiae, proceed to the plasmid that can be expressed Cre recombinant protein, the restructuring between induction loxp site; The bacterial strain of KanMX loss is screened by panel photocopy method; Cultivated by the continuous passage of yeast saccharomyces cerevisiae again, obtain the bacterial strain of Cre plasmid loss, to carry out the integration of next round.The advantage of the method is by using same selective marker, and to reclaim it, to realize the recycling of selective marker.But the maximum shortcoming of the method is: whole process very complicated, and repeatedly PCR easily introduces sudden change, the protein induced loxp site restructuring of follow-up Cre may cause the dislocation in already present loxp site on karyomit(e) to be recombinated, and causes chromosome rearrangement.Therefore, this strategy also and be not suitable for the integration of the polygene pathways metabolism of yeast saccharomyces cerevisiae.

In yeast saccharomyces cerevisiae, URA3 genes encoding vitamin B13-5-phosphate decarboxylase, can be transformed into 5 FU 5 fluorouracil by 5-fluororotic acid, thus produces toxicity to cell, cell growth inhibiting.Utilize this characteristic of URA3, by URA3 being utilized to carry out auxotroph screening after its gene both sides add direct repetitive sequence and the chemical reaction utilizing it special is removed it, thus realize progressively knocking out of multiple gene in yeast saccharomyces cerevisiae.But it depends on auxotrophy screening, cannot be applied to full genome Yeast engineering bacteria.In addition, similar with loxp-kanMX-loxp, same exist the problems such as the Limited Number of PCR process and each introducing gene needing complicated multi-step.

Summary of the invention

The object of the invention is to the Genomic instability overcoming the existence in the assembling of polygene pathways metabolism of current saccharomyces cerevisiae expression, expression efficiency is not high, approach builds complicated, rely on the shortcomings such as nutrient defect type mark, the construction process of the integrated expression vector of yeast saccharomyces cerevisiae providing a kind of selective marker capable of circulation.Another object of the present invention be in conjunction with KanMX screening advantage and URA3 selective marker reclaim on convenience, there is provided a set of simple to operate, inheritance stability, the pUMRI carrier that expression efficiency is high, and be applied to yeast saccharomyces cerevisiae metabolic engineering and synthetic biology research.

For achieving the above object, the present invention takes following technical proposals to realize:

The integrated expression vector of yeast saccharomyces cerevisiae that selective marker is capable of circulation, comprises

Loxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1),

Yeast primary expression box is any Yeast promoter-multiple clone site-transcription terminator,

Homology arm can insert section.

Further, described homology arm can insert section and has at least one rare restriction enzyme site.

Preferably, described rare restriction enzyme site is sfil.

Further, rare restriction enzyme site can insert the knocked out sequence that has no significant effect thalli growth, metabolism arbitrarily or other do not find sequence.

Further, the pattern plasmid of described expression vector comprises loxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1), TCYC1-MCS2-PGAL1-PGAL10-MCS1-TADH1 (SEQ ID NO:4).

Further, the nucleotides sequence of described pattern plasmid is classified as SEQ ID NO:5.

Further, the construction process of described pattern plasmid comprises the following steps:

Step one, design and synthesis loxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1);

Step 2, the method of PCR is used to amplify double expression boxes section TCYC1-MCS2-PGAL1-PGAL10-MCS1-TADH1 (SEQ ID NO:4), be spliced in loxp-KanMX-URA-Loxp-PBR322 replicon-2 μ replicon gene fragment, form cyclic plasmid, obtain the pattern plasmid that nucleotides sequence is classified as SEQ ID NO:5.

Preferably, step 2 the primer is that sequence is respectively SEQ ID NO:2 and SEQ ID NO:3.

The present invention also provides a kind of construction process of above-mentioned expression vector, comprises the following steps:

Step a: the gene clone integrated by needs is to the expression polyclone section of carrier;

Step b: the gene fragment needing to knock out or integration site fragment are cloned into homology arm and insert section;

Step c: by object vector linearization;

Steps d: linearized vector proceeds to Saccharomyces cerevisiae host bacterium, screening positive clone on the YPD flat board containing G418 resistance;

Step e: picking positive colony inoculation, in YPD test tube, is cultivated after 12-24 hour, gets on SD flat board that part bacterium liquid coats containing 5-Fluorouracil, screens;

Step f: bacterial strain longer on the SD flat board containing Fluracil is for incorporating goal gene, and the bacterial strain by delection of selectable marker, can be directly used in next step integration.

In addition the present invention also provides above-mentioned expression vector as the effect of shuttle plasmid, realizes the clone of goal gene in intestinal bacteria and the quick integration in yeast saccharomyces cerevisiae.

Beneficial effect of the present invention: expression vector tool provided by the invention has the following advantages:

1) can be used as shuttle plasmid, realize the clone of goal gene in intestinal bacteria and the quick integration in yeast saccharomyces cerevisiae.

2) can be used for the disposable integrated of multiple gene in yeast saccharomyces.

3) the repeatedly utilization of G418 resistance screening mark can be realized.

4) non-nutritive defective type screening, can be used for the integration of gene in full genome Yeast engineering bacteria.

5) can be used for the polygenic quick integration in more long-distance footpath, realize the gene integration that the formula that knocks out is knocked in.

The method can be widely used in any full genome yeast saccharomyces cerevisiae or other Wine brewing yeast strains, has good universality and novelty.

Accompanying drawing explanation

Fig. 1 is PUMRI-21 plasmid map.

Fig. 2 is that Maker removes plate screening proof diagram.

Fig. 3 is bacterium colony pcr genotype checking before and after Maker removes.

Embodiment

Below in conjunction with embodiment, the present invention is described in further detail.

The structure of embodiment 1:PUMRI-21 pattern plasmid

1) utilize the method for DNA chemosynthesis, synthesis loxp-KanMX-URA-PBR322 replicon-Loxp section, as shown in SEQ ID NO:1.2 loxp, the G418 resistance expressions containing optimization design in this sequence close, yeast saccharomyces cerevisiae URA3 expression cassette, PBR322 replication origin.

2) primer ADH1tF2 and CYC1tR2 is utilized to amplify double expression boxes section (altogether 1351bp) from commercialization carrier PESC-URA (GenBank:AF063585.2) and carry out gel recovery.Its primer sequence is as follows:

ADH1tF2：

CACTAAAGGGAACAAAAGCTGGAGCTGGCCTTGTAGGCCTCTTCGCTATTACGCC(SEQ ID NO：2)

CYC1tR2：

GACTCACTATAGGGCGAATTGGGATCTTCGAGCGTCCCAA(SEQ ID NO：3)

PCR system is: total system 25ul, wherein water 16.25 μ l, buffer 5 μ l, dNTPs 2 μ l, genome 0.5 μ l, primer each 0.5 μ l, Primer Star archaeal dna polymerase 0.25 μ l.

PCR program is: 98 DEG C of 10s, 55 DEG C of 5s, 72 DEG C of 1.5min, 32 circulations

The expression cassette section TCYC1-MCS2-PGAL1-PGAL10-MCS1-TADH1 obtained is as shown in SEQ ID NO:4.

3) utilize seamless Cloning Kit, the sequence Seq1DNA fragment of PCR primer and synthesis is carried out vitro recombination.

Recombinant chou is: total system 5ul, expression cassette PCR primer 3.25ul, composition sequence 1ul, buffer 0.5ul, recombinase 0.25ul.Restructuring condition is: 37 degree of placements 20 to 30 minutes.Restructuring system is proceeded in the intestinal bacteria Top10 competence of 100ul, place 20 minutes on ice, then 42 degree of thermal shock 90s, ice bath is after 5 minutes again, add 1ml LB substratum to recover, after 40-60 minute by its centrifugal coated plate on the LB agar plate containing 50mg/L kantlex, screen.The positive colony obtained is for the extracting of plasmid, and the corresponding plasmid called after pUMRI-21 (as shown in Figure 1) of structure, sequence is as shown in SEQ ID NO:5.

4) in constructed carrier pUMRI-21, a SfiI site is contained, between expression cassette and composition sequence 1.SfiI is rare restriction endonuclease sites, and its sequence is GGCCNNNNNGGCC, and wherein NNNNN is any five bases.This site for integrating homology arm so that gene knock out the insertion with goal gene.Its basic structure integrated is: up HA-SfiI-down HA.Wherein HA represents homology arm (homologous arm), note during the homology arm of downstream in design adding the homology segment being about 20bp with pUMRI-21SfiI both sides respectively on respective upstream primer primer 5 ' end: GAACAAAAGCTGGAGCTggccttg and GGCGTAATAGCGAAGAGGCCTACA, and additionally add SfiI restriction enzyme site for follow-up linearized vector.Overlap extension PCR when carrying out after upstream homology arm up HA and downstream homology arm down HA is increased respectively by specificity primer, obtains the PCR primer as up HA-SfiI-down HA structure.

The selected marker of embodiment 2:PUMRI-21 pattern plasmid can be recycled sign

1) structure of homology arm HA-DPP1

First conveniently the genome of Wine brewing yeast strain BY4741 is extracted in operation; Then respectively with DPP1-UPF1 and DPP1-UPR1, DPP1-DF1 and DPP1-DR1 as template, carry out PCR using the genome extracted as template.Primer sequence is as follows:

DPP1-UPF1：CCATCAGGCCTTTATGGCCGCATTATGTCCGATAAACACAG(SEQ ID NO：6)

DPP1-UPR1：GAACAAAAGCTGGAGCTGGCCTTGTCAACCGATCGACAAATTATTTC(SEQ ID NO：7)

DPP1-DF1：GGCGTAATAGCGAAGAGGCCTACAGAAGGCTTGCCATTGGACAC(SEQ ID NO：8)

DPP1-DR1：CATAATGCGGCcataaagGCCTGATGGGTGACTGCTTCCTC(SEQ ID NO：9)

PCR system is: total system 25 μ l, wherein water 16.25 μ l, buffer 5 μ l, dNTPs 2 μ l, genome 0.5 μ l, primer each 0.5 μ l, Primer Star archaeal dna polymerase 0.25 μ l.

PCR program is: 98 DEG C of 10s, 55 DEG C of 5s, 72 DEG C of 30s, 35 circulations

PCR primer is run nucleic acid electrophoresis, carries out rubber tapping and reclaim, then the product of recovery is carried out overlap PCR.PCR system is described above, template is become two pcr fragments of recovery.PCR program is consistent with above-mentioned, only 72 DEG C of elongating temperatures need be become 1 minute.

Equally PCR primer is run nucleic acid electrophoresis, carry out rubber tapping and reclaim.The object fragment sequence obtained is as shown in SEQ ID NO:10.

2) PUMRI-21-DPP1 builds and linearizing

DPP1HA is cloned into the SfiI site of PUMRI-21.Building mode is with in example one 3) described in.

3) PUMRI-21-DPP1 is passed through enzymatic cleavage methods linearizing

Enzyme cuts system: total system 30 μ l, plasmid 26 μ l, buffer3 μ l, SfiI enzyme 1 μ l.

Enzyme tangent condition: place 50 DEG C of enzymes and cut 3-4 hour.

4) removal of conversion and selection markers

First the method that linearization plasmid PUMRI-21-Δ DPP1 is turned by electricity is proceeded in Wine brewing yeast strain BY4742, be then coated on screening positive clone on the YPD flat board containing G418 resistance.Picking positive colony inoculation, in YPD test tube, is cultivated after 24 hours, by OD value under ultraviolet spectrophotometer survey 600nm, estimates bacterium dense.Getting 50 μ l, 100 μ l, 200 μ l, 400 μ l volumes etc. does not coat after the washing of bacterium liquid sterilized water on the 5-FOA synthetic medium flat board that contains, screen, the bacterium colony grown after three days is the bacterial strain that URA3 removes, and counts the bacterium colony on every block flat board.

Bacterium sum=screening frequency in number of strains on FOA flat board/coated plate bacterium liquid

Its concrete outcome is as shown in table 2.

Table 2

Maker(loxp-ura-Kmax-loxp)loss frequency of transformants after FOA selection

In order to verify whether the lower KanMX section of the method operation has occurred correct loss further, by obtained strains again photocopy to containing G418 YPD flat board on, the bacterium colony that G418YPD flat board can not grow is the bacterial strain that marker removes, its result as shown in Figure 2, institute bacterial strain of choosing all can not on G418 flat board normal growth.

In order to further verify on a molecular scale, the bacterium colony that random picking marks on the positive colony in non-place to go and 10 5-FOA flat boards carries out bacterium colony PCR.Template, as above-mentioned basically identical, only need be changed to bacterium liquid by its process.

Primer is DPP1-UPF2 and qtHMG1-F1, and sequence is as follows:

DPP1upF2：AAAGGGACAACACGGCTTATA(SEQ ID NO：11)

qtHMG1-F1：CCTAACAATTTGGACGCCAC(SEQ ID NO：12)

When Maker is not removed, the theoretical size of object band is about 4700, is about 1200bp after removing.Result is consistent with notional result, as shown in Figure 3: 10 FOA flat boards select the object stripe size of bacterial strain all at 1200bp.Illustrate that mark is successfully removed.

PCR of the present invention, adopts PrimeSTAR HS DNA Polymerase (Code No.:RO10A) test kit of takara company (Dalian), operates according to its operation instructions.

Seamless clone of the present invention adopts Seamless Cloning and Assembly Kit (Invitrogen) seamless Cloning Kit, and operates by its operation instructions.

Primer used in the present invention, the DNA sequence dna of synthesis provides by Shanghai biotechnology company limited.

Enzyme described in the present invention is cut if no special instructions, and the restriction enzyme operation instructions all bought according to Takara company operates; Described recovery all reclaims test kit according to Axygen company gel if no special instructions or PCR cleaning reagent box operates; Described connection if no special instructions, all adopts the T4DNA ligase enzyme of Fermentas company to connect; Described intestinal bacteria transform if no special instructions, and its Host Strains is all DH5a, and method for transformation all adopts thermal shock method to carry out.

Although the present invention with preferred embodiment openly as above; but it is not for limiting the present invention; any those skilled in the art without departing from the spirit and scope of the present invention; the Method and Technology content of above-mentioned announcement can be utilized to make possible variation and amendment to technical solution of the present invention; therefore; every content not departing from technical solution of the present invention; the any simple modification done above embodiment according to technical spirit of the present invention, equivalent variations and modification, all belong to the protection domain of technical solution of the present invention.

Claims (10)

1. the integrated expression vector of yeast saccharomyces cerevisiae that selective marker is capable of circulation, is characterized in that, comprise

Ioxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1),

Yeast primary expression box is any Yeast promoter-multiple clone site-transcription terminator,

Homology arm can insert section.

2. expression vector according to claim 1, is characterized in that, described homology arm can insert section and have at least one rare restriction enzyme site.

3. expression vector according to claim 2, is characterized in that, described rare restriction enzyme site is sfil.

4. expression vector according to claim 1, is characterized in that: rare restriction enzyme site can insert the knocked out sequence that has no significant effect thalli growth, metabolism arbitrarily or other do not find sequence.

5. expression vector according to claim 1, it is characterized in that, the pattern plasmid PUMRI-21 of described expression vector comprises Ioxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1), TCYC1-MCS2-PGAL1-PGAL10-MCS1-TADH1 (SEQ ID NO:4).

6. expression vector according to claim 5, is characterized in that, the nucleotides sequence of described pattern plasmid is classified as SEQ ID NO:5.

7. expression vector according to claim 6, is characterized in that, the construction process of described pattern plasmid comprises the following steps:

Step one, design and synthesis Ioxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1);

Step 2, the method of PCR is used to amplify double expression boxes section TCYC1-MCS2-PGAL1-PGAL10-MCS1-TADH1 (SEQ ID NO:4), be spliced in Ioxp-KanMX-URA-Loxp-PBR322 replicon-2 μ replicon gene fragment, form cyclic plasmid, obtain the pattern plasmid that nucleotides sequence is classified as SEQ ID NO:5.

8. expression vector according to claim 7, is characterized in that, step 2 the primer is that sequence is respectively SEQ ID NO:2 and SEQ ID NO:3.

9. a construction process for expression vector as claimed in claim 1, is characterized in that, comprises the following steps: step a: the gene clone integrated by needs is to the expression polyclone section of carrier;

Step b: the gene fragment needing to knock out or integration site fragment are cloned into homology arm and insert section;

Step c: by object vector linearization;

Steps d: linearized vector proceeds to Saccharomyces cerevisiae host bacterium, screening positive clone on the YPD flat board containing G418 resistance;

Step e: picking positive colony inoculation, in YPD test tube, is cultivated after 12-24 hour, gets on SD flat board that part bacterium liquid coats containing 5-Fluorouracil, screens;

Step f: bacterial strain longer on the SD flat board containing Fluracil is for incorporating goal gene, and the bacterial strain by delection of selectable marker, can be directly used in next step integration.

10. expression vector as claimed in claim 1 is as the effect of shuttle plasmid.