CN105087632B - saccharomyces cerevisiae chromosome and construction method and application thereof - Google Patents

Abstract

The invention discloses a saccharomyces cerevisiae chromosome and a construction method and application thereof. The saccharomyces cerevisiae chromosome comprises 2 telomere repetitive sequences, 2 insulator sequences, a centromere-autonomous replication sequence, a pol30 gene and n repetitive recombination boxes. The test proves that: the saccharomyces cerevisiae chromosome auxotroph has few marker genes, can perform normal and stable growth under the condition of not screening, not only improves the expression quantity, stability and copy number of exogenous genes in the yeast, but also can increase, screen, even expand new polygene clusters for the genes which are integrated into a genome, successfully realizes the rapid exogenous expression of beta carotene and violacein in the yeast, provides a rapid and feasible method for the heterologous production of yeast in various exogenous ways, and can meet the application requirements in the fields of genetic engineering, metabolic engineering and synthetic biology.

Description

saccharomyces cerevisiae chromosome and construction method and application thereof

Technical Field

The invention belongs to the fields of genetic engineering, metabolic engineering and synthetic biology, and particularly relates to a saccharomyces cerevisiae chromosome and a construction method and application thereof; in particular to a saccharomyces cerevisiae chromosome which can realize multiple genes and multiple metabolic pathways, can be expanded without screening and stably exists, a construction method and application thereof.

background

With the development of modern biotechnology and biomedicine, the application of expressing and obtaining high value-added products by using an exogenous system is more and more common. Notable successful cases include the fermentative production of artemisinin, and the like. Conventional expression systems utilize microorganisms such as E.coli, Bacillus subtilis, and Saccharomyces cerevisiae, which are substrate organisms, by introducing enzyme genes that are not originally present in these systems, and thus using metabolites that are already present in these systems, the desired target product is obtained. Through further optimization, the product with higher yield and quality is finally obtained. In order to achieve the expression of foreign genes in these systems, it is usually necessary to PCR amplify a plurality of genes from other organisms and then put them into host cells for expression. Common methods for introducing multiple foreign genes into a host system are: 1) cloning a plurality of genes on separate vectors respectively, and then transforming the vectors with foreign genes into the same cell; 2) cloning a plurality of genes to the same vector step by step, and then transforming the genes into cells; 3) multiple genes are transformed separately and integrated into the host genome.

early methods of metabolic engineering were to amplify the gene to be expressed from the source species of the gene by molecular biological methods and to clone it on a vector. If a plurality of genes need to be expressed simultaneously, the same strategy can be adopted to clone each gene onto a vector with different resistance markers, and each gene is regulated and controlled by biological elements such as the same or different promoters and the like. The constructed plasmids are then transformed into host cells (usually Escherichia coli) step by step or together, and strains with the foreign genes are obtained by screening for resistance markers.

expression of foreign genes using the above method is limited because of the limited number of resistance genes available for selection. Therefore, a new method has been developed, in which multiple genes are cloned to the same vector step by step. Thus, only one resistance vector is required to simultaneously transfer multiple genes. Using this method, one can express a large number of foreign genes simultaneously.

cloning multiple genes on the same vector solves some of the gene-driven limitations, but as with expression from a single vector, the selection must remain resistant to the strain that is ultimately obtained. Once the screening pressure is removed, the foreign gene carried by the strain is quickly lost. And the use of antibiotics and the like also greatly increases the industrial production cost. One solution to achieve a stable expression system and to eliminate the need for selection pressure for antibiotics and the like is to integrate these foreign genes into the host genome. However, the integration of the gene into the chromosome has a limitation that the copy number of the gene to be integrated is low and the number of the gene to be integrated is small, so that the expression level of the product is small and it is difficult to satisfy the purpose of mass production in industry.

since bacteria such as Escherichia coli have a high growth rate, a relatively simple genome, and a mature molecular manipulation technique, they have been used for a variety of metabolic engineering hosts for a long time. Meanwhile, saccharomyces cerevisiae is a simple eukaryotic microorganism, and is widely used as a eukaryotic expression system because of its clear genetic background and convenient genetic manipulation. In addition, yeast is considered to be a safe microorganism, and is more advantageous for production of products related to food and the like than Escherichia coli and the like. In addition, the yeast has a strong homologous recombination system, and can utilize a homologous sequence of only dozens of base pairs to carry out accurate and efficient homologous recombination, thereby more quickly carrying out the assembly of multiple genes and large fragments of DNA.

Therefore, in order to increase the expression level and stability of foreign genes in yeast, it is necessary to integrate these genes into the genome, increase the copy number of the genes if necessary, and increase, screen, or expand new polygene clusters for the genes integrated into the genome. At the same time, minimal use of auxotrophic markers must be ensured, and normal and stable growth can be performed without screening.

Disclosure of Invention

an object of the present invention is to provide an artificial chromosome of Saccharomyces cerevisiae.

The saccharomyces cerevisiae artificial chromosome provided by the invention comprises n repeated recombination boxes, 2 telomere repeated sequences, 2 insulator sequences, a centromere-autonomous replication sequence and a pol30 gene;

Each repeating recombination box consists of an upstream recombination target sequence, a reporter gene, a screening marker gene and a downstream recombination target sequence; the reporter gene and the screening marker gene are both positioned between the upstream recombination target sequence and the downstream recombination target sequence; and n is a natural number greater than or equal to 1.

the upstream recombination target sequence and the downstream recombination target sequence are sequences which do not undergo homologous recombination with the rest part on the saccharomyces cerevisiae artificial chromosome.

In the above-mentioned artificial chromosome of the Saccharomyces cerevisiae,

N is 1 or 2;

The saccharomyces cerevisiae artificial chromosome sequentially comprises a telomere repetitive sequence, an insulator sequence, a first repetitive recombination box, a centromere-autonomous replication sequence, a pol30 gene, a second repetitive recombination box, another insulator sequence and another telomere repetitive sequence from upstream to downstream;

or the saccharomyces cerevisiae artificial chromosome sequentially comprises a telomere repetitive sequence, an insulator sequence, a first repetitive recombination box, a centromere-autonomous replication sequence, a pol30 gene, another insulator sequence and another telomere repetitive sequence from upstream to downstream.

In the above-mentioned artificial chromosome of the Saccharomyces cerevisiae,

the telomere repetitive sequences are all a sequence 1 in a sequence table;

the insulator sequences are all the sequences 2 in the sequence table;

the centromere-autonomous replication sequence is a sequence 4 in a sequence table;

the sequence of the pol30 gene is a sequence 6 in a sequence table;

The reporter gene is an RFP gene;

the screening marker gene is TRP1 gene;

The upstream recombination target sequence of the first repeated recombination box is a sequence 9 in a sequence table;

The downstream recombination target sequence of the first repeated recombination box is a sequence 10 in a sequence table;

The upstream recombination target sequence of the second repeated recombination box is a sequence 11 in a sequence table;

The downstream recombination target sequence of the second repeated recombination box is a sequence 12 in a sequence table;

The sequence of the first repeated recombination box is a sequence 15 in a sequence table;

the sequence of the second repeated recombination box is sequence 16 in the sequence table.

The invention also aims to provide a preparation method of the saccharomyces cerevisiae artificial chromosome.

The preparation method of the saccharomyces cerevisiae artificial chromosome provided by the invention is characterized in that n repeated recombination cassettes are integrated into a pNEOC14 vector to obtain the saccharomyces cerevisiae artificial chromosome.

in the above-mentioned method, the first step of the method,

Each repeating recombination box consists of an upstream recombination target sequence, a reporter gene, a screening marker gene and a downstream recombination target sequence; the reporter gene and the screening marker gene are both positioned between the upstream recombination target sequence and the downstream recombination target sequence; and n is a natural number greater than or equal to 1.

In the above method, the method comprises the steps of: transferring the n repeated recombination boxes into saccharomyces cerevisiae containing a linearized pNEOC14 vector to obtain recombinant bacteria, and extracting plasmids of the recombinant bacteria to obtain saccharomyces cerevisiae artificial chromosomes;

the saccharomyces cerevisiae containing the linearized pNEOC14 vector is an intermediate bacterium obtained by transferring the linearized pNEOC14 vector into a host saccharomyces cerevisiae;

The linearized pNEOC14 vector is a linear DNA molecule obtained by using a restriction enzyme PmeI to cut the pNEOC14 vector;

the nucleotide sequence of the pNEOC14 vector is a circular DNA molecule shown as a sequence 7 in a sequence table.

in the above-mentioned method, the first step of the method,

N is 1 or 2;

The telomere repetitive sequences are all a sequence 1 in a sequence table;

The insulator sequences are all the sequences 2 in the sequence table;

the centromere-autonomous replication sequence is a sequence 4 in a sequence table;

the sequence of the pol30 gene is a sequence 6 in a sequence table;

The reporter gene is an RFP gene;

The screening marker gene is TRP1 gene;

The upstream recombination target sequence of the first repeated recombination box is a sequence 9 in a sequence table;

the downstream recombination target sequence of the first repeated recombination box is a sequence 10 in a sequence table;

The upstream recombination target sequence of the second repeated recombination box is a sequence 11 in a sequence table;

the downstream recombination target sequence of the second repeated recombination box is a sequence 12 in a sequence table;

The sequence of the first repeated recombination box is shown as a sequence 15 in a sequence table;

the sequence of the second repeated recombination box is shown as a sequence 16 in a sequence table.

in the method, the saccharomyces cerevisiae is saccharomyces cerevisiae JDY52 with pol30 gene knocked out on the genome and containing URA-pol30 plasmid; the nucleotide sequence of the URA-pol30 plasmid is shown as a sequence 8 in a sequence table.

It is still another object of the present invention to provide a DNA fragment.

The DNA fragment provided by the invention is the above repeated recombination box.

It is still another object of the present invention to provide a yeast strain containing an artificial chromosome of Saccharomyces cerevisiae.

The saccharomyces cerevisiae artificial chromosome-containing saccharomyces cerevisiae is obtained by introducing the saccharomyces cerevisiae artificial chromosome into saccharomyces cerevisiae.

The application of the saccharomyces cerevisiae artificial chromosome or the DNA fragment or the saccharomyces cerevisiae artificial chromosome-containing yeast in the expression of the exogenous gene also belongs to the protection scope of the invention.

The application of the saccharomyces cerevisiae artificial chromosome or the DNA fragment or the saccharomyces cerevisiae artificial chromosome-containing yeast in the preparation of products for expressing exogenous genes also belongs to the protection scope of the invention.

it is a final object of the present invention to provide a method for expressing a foreign gene.

the method for expressing the exogenous gene provided by the invention comprises the following steps: introducing a DNA fragment containing an exogenous gene into the saccharomyces cerevisiae containing the saccharomyces cerevisiae artificial chromosome to obtain a recombinant bacterium A, and culturing the recombinant bacterium A to realize the expression of the exogenous gene;

The DNA fragment of the exogenous gene comprises an upstream homology arm, an exogenous gene expression cassette, a screening marker gene and a downstream homology arm;

The upstream homologous arm is an upstream recombination target sequence of the repeated recombination box of the saccharomyces cerevisiae artificial chromosome;

and the downstream homologous arm is a downstream recombination target sequence of the repeated recombination box of the saccharomyces cerevisiae artificial chromosome.

In the above-mentioned method, the first step of the method,

the foreign gene may be plural;

the exogenous gene is a gene for synthesizing beta carotene or a gene for synthesizing violacein;

The nucleotide sequence of the DNA fragment containing the synthetic beta carotene gene is a sequence 17;

The nucleotide sequence of the DNA fragment containing the synthesized violacein gene is sequence 18.

The invention discloses a saccharomyces cerevisiae chromosome and a construction method and application thereof. The test proves that: the saccharomyces cerevisiae chromosome auxotroph has few marker genes, can perform normal and stable growth under the condition of not screening, not only improves the expression quantity, stability and copy number of exogenous genes in the yeast, but also can increase, screen, even expand new polygene clusters for the genes which are integrated into a genome, successfully realizes the rapid exogenous expression of beta carotene and violacein in the yeast, provides a rapid and feasible method for the heterologous production of yeast in various exogenous ways, and can meet the application requirements in the fields of genetic engineering, metabolic engineering and synthetic biology.

drawings

FIG. 1 is a HPLC peak plot of sample and beta carotene standard.

FIG. 2 is an HPLC peak of violacein sample.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

pRS403 vector, pRS404 vector and pRS414 vector in the following examples are disclosed in the literature "Robert S.Sikorski, Philip Hieter, A System of Shuttle Vectors and Yeast Host derived for Efficient management of DNA in Saccharomyces cerevisiae, genetics,1989,122: 19-27", publicly available from the university of Qinghua.

saccharomyces cerevisiae JDY52 in the examples below, which is a haploid strain sporulated from a diploid strain formed after the mating of Saccharomyces cerevisiae BY4727 and Saccharomyces cerevisiae BY4733, was of the genotype MATa, his 3. delta. 200 leu 2. delta. 0 lys 2. delta. 0 trp 1. delta. 63 ura 3. delta. 0 met 15. delta. 0, and was publicly available from the university of Qinghua.

Saccharomyces cerevisiae BY4727(Saccharomyces cerevisiae BY4727) and Saccharomyces cerevisiae BY4733(Saccharomyces cerevisiae BY4733) in the following examples are disclosed in the documents "Brachmann CB, Davies A, CostGJ, Caputo E, Li J, Hieter P, Boeke JD. designer deletion strand derivative from Saccharomyces cerevisiae S288C: a useful set of strands and plasmids for PCR-mediated gene delivery and other applications. Yeast,1998,14(2): 115-32", publicly available from the university of Qinghua.

example 1 preparation of Yeast chromosome

first, obtaining of Yeast Strain containing pNEOC14 vector

1. obtaining of pNEOC1 vector

(1) According to the structure of the natural telomere of the saccharomyces cerevisiae, a DNA fragment with a telomere repetitive sequence and Xcore is designed, and a pUC19-F126 vector is synthesized by a commercial gene synthesis method. And carrying out double enzyme digestion on the pUC19-F126 vector by using restriction endonucleases BsaI and AgeI, and recovering to obtain a fragment with the size of 770bp, namely a DNA fragment of a telomere repetitive sequence and an Xcore, wherein the nucleotide sequence of the fragment is shown as a sequence 1 in a sequence table.

(2) The pRS414 with the BsaI and AgeI cleavage sites introduced by the primers is subjected to double enzyme digestion by restriction enzymes BsaI and AgeI by using a pRS414 with the BsaI and BsmBI cleavage sites removed as a template and pfu enzyme amplification by using a primer 1(GCACCGGTTTCCCCGAAAAGTGCCACCT) and a primer 2(TAGGTCTCTTGTGTTTAAACATGTGCGCGGAACCCCTATTT) to obtain a 4816bp PCR amplification product, namely a pRS414 vector with the BsaI and AgeI cleavage sites introduced by the primers, and a vector fragment is recovered.

(3) And (3) connecting the telomere repetitive sequence obtained in the step (1), the Xcore DNA fragment and the vector fragment obtained in the step (2) to obtain a pNEOC1 vector.

2. Obtaining of pNEOC10 vector

(1) synthesis of spacers

Artificially synthesizing a primer 3(catgTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGcctgcagggcatgc) and a primer 4(ccgggcatgccctgcaggCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA), mixing equimolar amounts of the primer 3 and the primer 4, heating for denaturation, and cooling at room temperature to obtain a DNA fragment with the size of 82bp, namely an isolator which is 10 repeated TTAGGG units, wherein the nucleotide sequence of the TTAGGG unit is shown as a sequence 2 in a sequence table.

(2) the pNEOC1 vector obtained in step 1 is subjected to double enzyme digestion by restriction enzymes AgeI and NcoI, and a vector large fragment with the size of 5561bp is recovered.

(3) And (3) connecting the DNA fragment with the size of 82bp obtained in the step (1) with the vector large fragment with the size of 5561bp obtained in the step (2) to obtain the pNEOC10 vector. After ligation, the AgeI and NcoI recognition sites disappeared while the SbfI and SphI sites were introduced on the recombinant vector pNEOC 10.

3. Obtaining of pNEOC11 vector

(1) obtaining of HIS3 Gene fragment

And (3) carrying out PCR amplification by taking the pRS403 vector as a template and adopting a primer 5(TTACgagctcAGTCAGGGAAGTCATAACACAGTCC) and a primer 6(TAggtctcTTGTGTTTAAACCTGTGCGGTATTTCACACCGC) and pfu enzyme to obtain a PCR amplification product, namely the HIS3 gene fragment, wherein the nucleotide sequence of the PCR amplification product is shown as a sequence 3 in the sequence table.

And carrying out double enzyme digestion on the PCR amplification product by using restriction enzymes SacI and BsaI to obtain a DNA fragment with the size of 1168 bp.

PCR amplification reaction conditions: 94 ℃ for 3 min; 94 ℃, 30s, 55 ℃, 30s, 68 ℃, 45s, 30 cycles; at 68 ℃ for 3 min; 4 ℃ and + ∞.

(2) The pUC19-F126 vector is subjected to double enzyme digestion by restriction enzymes AgeI and BsaI, a DNA fragment with the size of 770bp is recovered, and the nucleotide sequence of the DNA fragment is shown as a sequence 1 in a sequence table.

(3) and (3) carrying out double enzyme digestion on the pNEOC10 vector obtained in the step 2 by using restriction enzymes SacI and XmaI, and recovering to obtain a vector large fragment with the size of 5593 bp.

(4) And (3) connecting the HIS3 gene fragment with the size of 1160bp obtained in the step (1), the DNA fragment with the size of 770bp obtained in the step (2) and the large vector fragment with the size of 5593bp obtained in the step (3), and using AgeI and XmaI as isocaudarner to obtain a pNEOC11 vector.

4. Obtaining of pNEOC12 vector

pRS414 with BsaI and BsmBI enzyme cutting sites removed is used as a template, and a pfu enzyme is adopted to carry out PCR amplification by using a primer 7(TTAgcatgcCACCGCATAGGCAAGTGCAC) and a primer 8(TTActcgagCCGAAgagacgCGATcgtctcATGACaccggtactagtGAAAAGTGCCACCTGGGTCC) to obtain PCR amplification products, namely a TRP1 gene and a CEN/ARS, wherein the nucleotide sequences of the PCR amplification products are shown as a sequence 4 in a sequence table.

And (3) carrying out double enzyme digestion on the PCR amplification product and the pNEOC11 vector obtained in the step (3) by using restriction enzymes XhoI and SphI, and connecting to obtain a pNEOC12 vector.

5. obtaining of pNEOC13 vector

(1) synthesis of spacers

artificially synthesizing a primer 9(catgggcgccTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGggatcc) and a primer 10(AATTggatccCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAggcgcc), mixing the primer 9 and the primer 10 in equal molar quantity, heating for denaturation, and cooling at room temperature to obtain a DNA fragment with the size of 80bp, namely an isolator, wherein the nucleotide sequence of the DNA fragment is shown as a sequence 5 in a sequence table.

(2) The pNEOC12 vector obtained in step 4 was subjected to double digestion with restriction enzymes AgeI and NcoI, and the vector large fragment of 6751bp in size was recovered.

(3) and (3) connecting the DNA fragment with the size of 80bp obtained in the step (1) with the vector large fragment with the size of 6751bp obtained in the step (2) to obtain the pNEOC13 vector. After ligation, EcoRI recognition sites were removed and BamHI and KasI sites were introduced into the recombinant vector pNEOC 13.

6. obtaining of pNEOC14 vector

PCR amplification is carried out by taking pJD280 vector as a template and adopting a primer 11(GCGTAATACGACTCACTATAGGGC) and a primer 12(GGactagtGTGAGTTACCTCACTCATTAGGCACC) and KOD enzyme to obtain a PCR amplification product of 1896bp, namely pol30 gene, wherein the nucleotide sequence of the gene is shown as a sequence 6 in a sequence table.

PCR amplification reaction: 94 ℃ for 3 min; 94 ℃, 30s, 55 ℃, 30s, 68 ℃, 75s, 30 cycles; at 68 ℃ for 3 min; 4 ℃ and + ∞.

the PCR amplification product with the size of 1896bp and the pNEOC13 vector are subjected to double digestion by using restriction enzymes SpeI and XhoI and are connected to obtain a pNEOC14 vector.

Sequencing the pNEOC14 vector, and the sequencing result shows that: the pNEOC14 vector is a circular DNA molecule shown as a sequence 7 in a sequence table.

7. pNEOC14 vector linearization

the pNEOC14 vector obtained in step 6 above was digested with restriction enzyme PmeI, and the digestion was carried out at 37 ℃ for 3 hours to obtain a digestion mixture.

And transforming the enzyme digestion mixture into a saccharomyces cerevisiae strain with a pol30 gene knocked out on a genome and containing a URA-pol30 plasmid by using a conventional yeast transformation method (the saccharomyces cerevisiae strain is a saccharomyces cerevisiae JDY52 with a pol30 gene knocked out on a genome and containing a URA-pol30 plasmid, and the nucleotide sequence of the URA-pol30 plasmid is shown as a sequence 8 in a sequence table), so as to obtain the transformed yeast strain.

And screening the transformed yeast strains on a culture medium lacking tryptophan to obtain transformants. After single colonies were grown out, 4 single colonies randomly picked from each plate were streaked onto new SC-TRP plates. After incubation at 30 ℃ for about 48 hours, the plates were sequentially replica-printed onto SC-URA, SC-HIS, SC-TRP plates. After incubation at 30 ℃ for about 24 hours, two TRP +, HIS-, URA-monoclonals were selected from the plates containing the enzyme digestion mixture, and the strains were streaked on SC-TRP plates to obtain yeast strains containing pNEOC14 vector.

II, obtaining of yeast strains containing new chromosomes

1. Design and synthesis of repeat recombination cassettes

The length of the recombination target sequence in the repeated recombination box is 500bp, and the recombination target sequence is randomly generated. The GC content was set at 50% and no homology was found in the sequenced database by NCBI blast. The recombination target sequences of the repeated recombination box 1 are URR1 and URR2, wherein the URR1 sequence is shown as a sequence 9 in a sequence table, and the URR2 sequence is shown as a sequence 10 in the sequence table; the recombination target sequences of the repeated recombination box 2 are URR3 and URR4, wherein the URR3 sequence is shown as the sequence 11 in the sequence table, and the URR4 sequence is shown as the sequence 12 in the sequence table. URR1, URR2, URR3 and URR4 are all synthesized by Wuxi blue Biotechnology Co., Ltd, cloned in pMV vector, and sequence verified to be identical to the designed sequence.

2. acquisition of the RFP Gene

the sequence of the designed RFP gene is shown as a sequence 13 in a sequence table according to the sequence of RFP in GeneBank. Synthesized by Scotch blue Biotech, Inc., cloned in pMV vector, and sequence confirmed to be identical to the designed sequence.

3. Obtaining a Yeast selectable marker

using pRS404 vector as a template, adopting a primer 13(TGATGTggtctcGTGAGCTGTGCGGTATTTCACACCG) and a primer 14(AGCGTGggtctcTAGCGAGATTGTACTGAGAGTGCAC), carrying out PCR amplification by using KOD enzyme to obtain a PCR amplification product, namely a TRP1 gene, wherein the nucleotide sequence of the TRP1 gene is shown as a sequence 14 in a sequence table, cloning the TRP1 gene into a pSMART HCKan vector, and carrying out sequencing to verify that no mutation occurs.

4. acquisition of Yeast strains with repetitive recombination cassettes

(1) Obtaining a Yeast Strain containing a repeating recombination cassette

Taking a DNA molecule shown as a sequence 15 in a sequence table as a template, adopting a primer 15(ATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGGTCATCTAAGCACAGTCGCG) and a primer 16(CTATTTCTTAGCATTTTTGACGAAATTTGCTATTTTGTTAGAGTCTTTTATTAGCGTGGCGAGCCCGCCT), and carrying out PCR amplification by using KOD enzyme to obtain a PCR amplification product with the size of 3475 bp.

PCR amplification reaction conditions: 94 ℃ for 3 min; 94 ℃, 30s, 55 ℃, 30s, 68 ℃, 3min, 30 cycles; at 68 ℃ for 5 min; 4 ℃ and + ∞.

Transforming the PCR amplification product (sequence 15) into the microzyme containing the pNEOC14 vector obtained in the first step, screening to obtain a clone which can grow on SC-HIS and can not grow on SC-TRP, extracting the genome of the clone, designing primers, and carrying out PCR verification on the left arm, the right arm and the full length of the integration site where the inserted fragment is located to obtain a yeast strain containing a repeated recombination cassette. The specific steps of the verification are as follows:

performing PCR amplification on the left arm of the yeast strain containing the repeated recombination cassette by using an F1 primer (CGCATAGGCAAGTGCACAAAC) and an R1 primer (GCGTCAGGACGACTAGCATG) and using KOD enzyme to obtain a PCR amplification product with the size of 520 bp; on the other hand, the PCR amplification was carried out using KOD enzyme using F2 primer (CGCATAGGCAAGTGCACAAAC) and R2 primer (ATGGAGATGAGTCGTGGCAAG), without any band.

Performing PCR amplification on the right arm of the yeast strain containing the repeated recombination cassette by using an F3 primer (ACGGTCACAGCTTGTCTGTAAG) and an R3 primer (AACGCCGGAGTATGGGAATG) and using KOD enzyme to obtain a PCR amplification product with the size of 717 bp; on the other hand, the PCR amplification was carried out using KOD enzyme using F4 primer (ACGGTCACAGCTTGTCTGTAAG) and R4 primer (CAGCAAGTCAGCATCGGAATC), without any band.

The full length of the yeast strain containing one repeat recombination cassette was subjected to PCR amplification using KOD enzyme using F5 primer (CGCATAGGCAAGTGCACAAAC) and R5 primer (ACGGTCACAGCTTGTCTGTAAG) to obtain a PCR amplification product of 3941bp in size.

(2) yeast strains containing two repeat recombination cassettes

taking a DNA molecule shown as a sequence 16 in a sequence table as a template, adopting a primer 17(CAGCAGTTAAGGCCTTCCACCTCTCACCCAATATTCTGCCTACTTGGCCAGTCAGTCTCGTATTTCTCTTGGAGA) and a primer 18(ATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCTAACGCCCCTAACCGAAGGAACTAGAGGTCTTCTTTA), and carrying out PCR amplification by using KOD enzyme to obtain a PCR amplification product with the size of 3387 bp.

PCR amplification reaction conditions: 94 ℃ for 3 min; 94 ℃, 30s, 55 ℃, 30s, 68 ℃, 3min, 30 cycles; at 68 ℃ for 5 min; 4 ℃ and + ∞.

transforming the PCR amplification product into the yeast strain containing one repeat recombination cassette obtained in the step (1), screening to obtain a clone capable of growing on SC-HIS and SC-LEU, extracting the genome of the clone, designing a primer 19(CGTCGGATGGAGAAGAAAAA) and a primer 20(CGGCCAAACAACCAATTACT), carrying out PCR verification on the integration site where the inserted fragment is positioned, amplifying to obtain a PCR amplification product with the size of 1088bp, namely the yeast strain containing two repeat recombination cassettes, and extracting plasmids, namely the yeast artificial chromosome. The first repeat recombination cassette integration site is located within the TRP1 gene with homology arms CTATTTCTTAGCATTTTTGACGAAATTTGCTATTTTGTTAGAGTCTTTTA and CAAACTTTCACCAATGGACCAGAACTACCTGTGAAATTAATAACAGACAT, respectively; the second repeat recombination cassette integration site is located between the pol30 gene and the isolator with homology arms CAGCAGTTAAGGCCTTCCACCTCTCACCCAATATTCTGCCTACTTGGCCA and TTAGGGGCGTTAGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTAT, respectively.

according to the method, the invention can introduce a plurality of repeated recombination cassettes to obtain the yeast strain containing the repeated recombination cassettes.

example 2 application of Yeast chromosome in production of beta Carotene

1. Synthesis of the fragment of interest

The DNA fragment shown in sequence 17 in the sequence table is artificially synthesized, and the fragment sequentially consists of URR1, a TDH3 promoter, a crtE gene, a TEF1 terminator, an ADH1 promoter, a crtI gene, an ADH1 terminator, a TEF2 promoter, a crtYB gene, a TEF2 terminator, LEU2 (screening marker gene) and URR 2. All promoters, genes, terminators are seamlessly linked.

2. transformation of

The DNA fragment shown in sequence 17 in the sequence table synthesized in step 1 was transformed into the yeast strain containing one repeat recombination cassette prepared in example 1, and yeast homologous recombination was used to obtain a correctly integrated yeast strain. And PCR identification is carried out on the DNA. Wherein the PCR identification steps are as follows:

Taking the genome DNA of the transformant as a template, and taking Primer A and Primer B as primers to carry out PCR amplification, wherein the transformant of which the PCR amplification product is a target fragment of 568bp is the transformant containing URR 1; performing PCR amplification by using Primer C and Primer D as primers, wherein a transformant of which the PCR amplification product is a target fragment of 752bp is a transformant containing URR1, a TDH3 promoter and a crtE gene; performing PCR amplification by using Primer E and Primer F as primers, wherein a transformant of a target fragment with a PCR amplification product of 735bp is a transformant containing a crtE gene, a TEF1 terminator, an ADH1 promoter and crtI; PCR amplification is carried out by taking Primer G and Primer H as primers, and a transformant of a target fragment with a PCR amplification product of 880bp is a transformant containing a crtI gene, an ADH1 terminator, a TEF2 promoter and crtYB; performing PCR amplification by using Primer I and Primer J as primers, wherein a transformant of a target fragment with a PCR amplification product of 1335bp is a transformant containing a crtYB gene, a TEF2 terminator and LEU 2; performing PCR amplification by using PrimerK and Primer L as primers, wherein a transformant of which the PCR amplification product is a 977bp target fragment is a transformant containing LEU2 and URR 2; and performing PCR amplification by using Primer M and Primer N as primers, wherein a transformant of which the PCR amplification product is a 555bp target fragment is a transformant containing URR2, and transformants containing all target fragments are finally obtained target transformants. The primer sequences identified by PCR were as follows:

Primer A:5’-GGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACG-3’；

Primer B:5’-CCAGAATCCGGGGCCTCTAAAGTAGAGCTAGGTTCGGAC-3’；

Primer C:5’-ACCCAACGATGTGGGGACGGCGTTGCAACTTCGAGGACCT-3’；

Primer D:5’-ACTCCAATGGGATAGCGGTCAAGATGTTAGCGTAGTCCAT-3’；

Primer E:5’-GGAAGCTATCTTGAAGAAGTTGGCTGACATCCCATTGTA-3’；

Primer F:5’-TGATAGCGGTTGGCTTGTCTTGGTCTTGTTCCTTACCCAT-3’；

Primer G:5’-GTAAGCCATTGAAGTCTAACGGAACCGGTATCGACTCTCA-3’；

Primer H:5’-TGTAGATCAAGTGGATTTGGTAGTAAGCCAAAGCGGTCAT-3’；

Primer I:5’-TACTCTTTGCCATTGGTTGCTTACGCTGAAGACTTGGCTA-3’；

Primer J:5’-GGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACAT-3’；

Primer K:5’-CTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCT-3’；

Primer L:5’-CCCCGACAGTGCGATTTAGCGAGCCTCTAACTCTTTCG-3’；

Primer M:5’-GCGTGCCTGCTCTCTCGTATTTCTCCTGGAGATC-3’；

Primer N:5’-CTGTTACTGATATGTCTGAGGAAAGTTGATCAAGACCC-3’。

3. beta carotene production and characterization

Inoculating the yeast strains which are verified to be correctly integrated into a YPD culture medium, culturing for 2-3 days, collecting, freeze-drying, extracting carotenoid in yeast cells by using 90% acetone after wall breaking, performing HPLC detection analysis by using beta-carotene (Sigma-Aldrich product, catalog number of C4582-5mG) as a standard substance, and obtaining the relative yield of the target transformant beta-carotene according to peak area.

the detection results are shown in fig. 1: the retention time of the sample was consistent with that of the beta carotene standard. The invention is proved to successfully produce beta carotene.

Example 3 application of Yeast chromosomes to the production of violacein

1. Synthesis of the fragment of interest

The DNA fragment shown as a sequence 18 in the sequence table is artificially synthesized, and the fragment sequentially comprises URR1, TEF2 promoter, vioA gene, ADH1 terminator, TEF2 promoter, vioB gene, ADH1 terminator, TEF2 promoter, vioC gene, ADH1 terminator, TEF2 promoter, vioD gene, ADH1 terminator, TEF2 promoter, vioE gene, ADH1 terminator, LEU2 (screening marker gene) and URR 2. All promoters, genes, terminators are seamlessly linked.

2. Transformation of

the DNA fragment shown in sequence 18 in the sequence table synthesized in step 1 was transformed into the yeast strain containing the repeat recombination cassette prepared in example 1, and yeast homologous recombination was used to obtain a correctly integrated yeast strain. And PCR identification is carried out on the DNA. Wherein the PCR identification steps are as follows:

Taking the genome DNA of the transformant as a template, and taking Primer a and Primer b as primers to carry out PCR amplification, wherein the transformant of which the PCR amplification product is a 568bp target fragment is the transformant containing URR 1; performing PCR amplification by using Primer c and Primer d as primers, wherein a transformant of a 682bp target fragment of a PCR amplification product is a transformant containing URR1, a TEF2 promoter and a vioA gene; performing PCR amplification by using Primer e and Primer f as primers, wherein a transformant of a target fragment with a PCR amplification product of 956bp is a transformant containing a vioA gene, an ADH1 terminator, a TEF2 promoter and a vioB gene; performing PCR amplification by using Primer g and Primer h as primers, wherein a transformant of a target fragment with a PCR amplification product of 1052bp is a transformant containing a vioB gene, an ADH1 terminator, a TEF2 promoter and a vioC gene; performing PCR amplification by using Primer i and Primer j as primers, wherein a transformant of a target fragment with a PCR amplification product of 1158bp is a transformant containing a vioC gene, an ADH1 terminator, a TEF2 promoter and a vioD gene; performing PCR amplification by using Primer k and Primer l as primers, wherein a transformant of a 1256bp target fragment obtained by PCR amplification is a transformant containing a vioD gene, an ADH1 terminator, a TEF2 promoter and a vioE gene; performing PCR amplification by using Primer m and Primer n as primers, wherein a transformant of a target fragment with a PCR amplification product of 1134bp is a transformant containing a vioE gene, an ADH1 terminator and LEU 2; performing PCR amplification by using Primer o and Primer p as primers, wherein a transformant of which the PCR amplification product is a 977bp target fragment is a transformant containing LEU2 and URR 2; and performing PCR amplification by using Primer q and Primer r as primers, wherein a transformant of which the PCR amplification product is a 555bp target fragment is a transformant containing URR2, and a transformant containing all target fragments is a finally obtained target transformant.

Primer a:5’-GGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACG-3’；

Primer b:5’-CCAGAATCCGGGGCCTCTAAAGTAGAGCTAGGTTCGGAC-3’；

Primer c:5’-ACCCAACGATGTGGGGACGGCGTTGCAACTTCGAGGACCT-3’；

Primer d:5’-TCTACCACCAGCTTCTTGTTGCATGTCGAAGATTCTCAA-3’；

Primer e:5’-GTAGATTGTTGTTGCAAAGAATCGCTGCTTTGAGAAGA-3’；

Primer f:5’-GAAGTGGATACGCGGGAAATCCAGAATGCTCATC-3’；

Primer g:5’-GAGCGTCTGCTGGAGCAGGCGAGCATG-3’；

Primer h:5’-CCAGCCAAACCACCACCAACGATGATAGCTCTTTTCATC-3’；

Primer i:5’-GAGAAAGGTTCAAGCTGACGCTATGCAAGACATGGCTA-3’；

Primer j:5’-CCAGCTGGACCAGCACCGATAACCAAGATTTTCATC-3’；

Primer k:5’-GGTAAGTTGGTTTTGTTGGGTGACGCTTTGCAATCT-3’；

Primer l:5’-CTAGCTGGCAACAATGGTGGTTCTCTGTTTTCCATC-3’；

Primer m:5’-GCTGAAATCCCAGACGCTGTTTTCGCTGCTAAGAGA-3’；

Primer n:5’-GGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACAT-3’；

Primer o:5’-CTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCT-3’；

Primer p:5’-CCCCGACAGTGCGATTTAGCGAGCCTCTAACTCTTTCG-3’；

Primer q:5’-GCGTGCCTGCTCTCTCGTATTTCTCCTGGAGATC-3’；

Primer r:5’-CTGTTACTGATATGTCTGAGGAAAGTTGATCAAGACCC-3’。

3. production and characterization of violacein

Inoculating the yeast strains which are verified to be correctly integrated in the step 2 into a YPD culture medium, culturing for 2-3 days, collecting, freeze-drying, extracting violacein in yeast cells by using methanol after wall breaking, and detecting by HPLC. Control was performed with the yeast strain containing one repeat cassette obtained in example 1.

The detection results are shown in fig. 2: the sample extracted from the correctly integrated yeast strain had a single peak compared to the control strain, i.e.violacein. The successful production of violacein by the present invention is demonstrated.

Claims (11)

1. A saccharomyces cerevisiae artificial chromosome comprising n repeat recombination cassettes, 2 telomere repeat sequences, 2 spacer sequences, a centromere-autonomous replication sequence, and pol30 genes;

Each repeating recombination box consists of an upstream recombination target sequence, a reporter gene, a screening marker gene and a downstream recombination target sequence; the reporter gene and the screening marker gene are both positioned between the upstream recombination target sequence and the downstream recombination target sequence;

N is 1 or 2;

The saccharomyces cerevisiae artificial chromosome sequentially comprises a telomere repetitive sequence, an insulator sequence, a first repetitive recombination box, a centromere-autonomous replication sequence, pol30 gene, a second repetitive recombination box, another insulator sequence and another telomere repetitive sequence from upstream to downstream;

Or the saccharomyces cerevisiae artificial chromosome sequentially comprises a telomere repetitive sequence, an insulator sequence, a first repetitive recombination box, a centromere-autonomous replication sequence, pol30 gene, another insulator sequence and another telomere repetitive sequence from upstream to downstream.

2. the saccharomyces cerevisiae artificial chromosome of claim 1, wherein:

The reporter gene is RFP gene;

The screening marker gene is TRP1 gene;

the upstream recombination target sequence of the first repeated recombination box is a sequence 9 in a sequence table;

The downstream recombination target sequence of the first repeated recombination box is a sequence 10 in a sequence table;

the upstream recombination target sequence of the second repeated recombination box is a sequence 11 in a sequence table;

The downstream recombination target sequence of the second repeated recombination box is a sequence 12 in a sequence table;

The sequence of the first repeated recombination box is a sequence 15 in a sequence table;

The sequence of the second repeated recombination box is sequence 16 in the sequence table.

3. The saccharomyces cerevisiae artificial chromosome of claim 2, wherein:

The telomere repetitive sequences are all a sequence 1 in a sequence table;

The insulator sequences are all the sequences 2 in the sequence table;

The centromere-autonomous replication sequence is a sequence 4 in a sequence table;

The sequence of the pol30 gene is a sequence 6 in a sequence table;

The reporter gene is an RFP gene;

The screening marker gene is TRP1 gene.

4. A method for preparing Saccharomyces cerevisiae artificial chromosome comprises integrating n repeated recombination cassettes into pNEOC14 vector to obtain Saccharomyces cerevisiae artificial chromosome; each repeating recombination box consists of an upstream recombination target sequence, a reporter gene, a screening marker gene and a downstream recombination target sequence; the reporter gene and the screening marker gene are both positioned between the upstream recombination target sequence and the downstream recombination target sequence; and n is 1 or 2.

5. The method of claim 4, wherein: the method comprises the following steps: transferring the n repeated recombination boxes into saccharomyces cerevisiae containing a linearized pNEOC14 vector to obtain recombinant bacteria, and extracting plasmids of the recombinant bacteria to obtain saccharomyces cerevisiae artificial chromosomes;

The saccharomyces cerevisiae containing the linearized pNEOC14 vector is an intermediate bacterium obtained by transferring the linearized pNEOC14 vector into a host saccharomyces cerevisiae;

The linearized pNEOC14 vector is a linear DNA molecule obtained by using a restriction enzyme PmeI to cut the pNEOC14 vector;

The nucleotide sequence of the pNEOC14 vector is a circular DNA molecule shown as a sequence 7 in a sequence table.

6. The method according to claim 4 or 5, characterized in that:

The reporter gene is RFP gene;

The screening marker gene is TRP1 gene;

The upstream recombination target sequence of the first repeated recombination box is a sequence 9 in a sequence table;

the downstream recombination target sequence of the first repeated recombination box is a sequence 10 in a sequence table;

The upstream recombination target sequence of the second repeated recombination box is a sequence 11 in a sequence table;

the downstream recombination target sequence of the second repeated recombination box is a sequence 12 in a sequence table;

The sequence of the first repeated recombination box is shown as a sequence 15 in a sequence table;

the sequence of the second repeated recombination box is shown as a sequence 16 in a sequence table.

7. A DNA fragment which is the repeat recombination cassette as claimed in claim 1.

8. the yeast containing the saccharomyces cerevisiae artificial chromosome is obtained by introducing the saccharomyces cerevisiae artificial chromosome described in any one of claims 1 to 3 into saccharomyces cerevisiae.

9. use of the saccharomyces cerevisiae artificial chromosome of any one of claims 1-3 or the DNA fragment of claim 7 or the saccharomyces cerevisiae artificial chromosome-containing yeast of claim 8 for expressing an exogenous gene;

or the Saccharomyces cerevisiae artificial chromosome of any one of claims 1-3 or the DNA fragment of claim 7 or the Saccharomyces cerevisiae artificial chromosome-containing yeast of claim 8 for use in the preparation of products expressing exogenous genes.

10. A method for expressing a foreign gene comprising the steps of: introducing a DNA fragment containing an exogenous gene into the saccharomyces cerevisiae artificial chromosome-containing saccharomyces cerevisiae as claimed in claim 8 to obtain a recombinant bacterium A, and culturing the recombinant bacterium A to realize the expression of the exogenous gene;

the DNA fragment of the exogenous gene comprises an upstream homology arm, an exogenous gene expression cassette, a screening marker gene and a downstream homology arm;

The upstream homologous arm is an upstream recombination target sequence of the repeated recombination box of the saccharomyces cerevisiae artificial chromosome;

And the downstream homologous arm is a downstream recombination target sequence of the repeated recombination box of the saccharomyces cerevisiae artificial chromosome.

11. the method of claim 10, wherein:

The exogenous gene is a gene for synthesizing beta carotene or a gene for synthesizing violacein;

The nucleotide sequence of the DNA fragment containing the synthetic beta carotene gene is a sequence 17;

The nucleotide sequence of the DNA fragment containing the synthesized violacein gene is sequence 18.