CN109609537A - A kind of application of gene editing method in Amycolatopsis orientalis - Google Patents

A kind of application of gene editing method in Amycolatopsis orientalis Download PDF

Info

Publication number
CN109609537A
CN109609537A CN201811552697.8A CN201811552697A CN109609537A CN 109609537 A CN109609537 A CN 109609537A CN 201811552697 A CN201811552697 A CN 201811552697A CN 109609537 A CN109609537 A CN 109609537A
Authority
CN
China
Prior art keywords
plasmid
seq
cas9
gtfd
crispr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811552697.8A
Other languages
Chinese (zh)
Inventor
倪瑶
魏维
钱秀萍
夏兴
戈梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Laiyi Biomedical Research And Development Center LLC
Shanghai Jiaotong University
Original Assignee
Shanghai Laiyi Biomedical Research And Development Center LLC
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Laiyi Biomedical Research And Development Center LLC, Shanghai Jiaotong University filed Critical Shanghai Laiyi Biomedical Research And Development Center LLC
Priority to CN201811552697.8A priority Critical patent/CN109609537A/en
Publication of CN109609537A publication Critical patent/CN109609537A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/10—Vectors comprising a non-peptidic targeting moiety

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The method that the invention discloses a kind of to carry out gene knockout in Amycolatopsis orientalis based on CRISPR/Cas9 editing system and knock in, CRISPR/Cas9 is edited plasmid pLYNY04 and is introduced into Amycolatopsis orientalis Amycolatopsis orientalis HCCB10007 by this method, it realizes gene knockout simultaneously and knocks in, it can simplify genetic manipulation, improve the integration efficiency of Amycolatopsis orientalis.The invention also discloses a kind of CRISPR/Cas9 containing gtfD DNA homolog arm to edit plasmid pLYNY04, by the target sequence of eGFP insertion Amycolatopsis orientalis, in order to detect gene editing result.The invention also discloses the applications that a kind of CRISPR/Cas9 containing gtfD DNA homolog arm edits plasmid pLYNY04.

Description

A kind of application of gene editing method in Amycolatopsis orientalis
Technical field
The invention belongs to gene engineering technology fields, specifically, being to intend nothing in east about a kind of gene editing method Application in the sour bacterium of branch.
Background technique
CRISPR/Cas9 system, this is that the one kind developed at present quickly, simply carries out the new of fixed point editor to genome Technology, it is only necessary to as soon as single Cas9 albumen is combined with sgRNA, can identify and cut specific dna sequence and complete height The gene editing of effect.Using this feature, Cas9 system can succeed to be combined with vitro recombination system, directly from chromosome Perfect clone piece segment DNA.From CRISPR/Cas technology in 2013 applied to after gene knockout, this building is quick, structure is simple Single, efficient molecular tool is just received by everybody quickly, has nowadays been successfully applied to include rice, wheat, plasmodium, fruit In the eucaryotes such as fly, zebra fish and mammal.Not only in eucaryote, this system is in prokaryotes, such as large intestine bar Bacterium and the streptomycete of microbial medicine important sources etc. also show that in terms of gene functional research homologous better than traditional in vivo In place of other prior arts such as recombination.Cas9 system, which is also proved to succeed to be combined with In vivo recombination system, carries out large fragment The perfect clone of DNA.
Vancomycin is the choice drug that numerous drug-fast bacterias (Staphylococcus aureus of such as methicillin resistance) cause infection. Amycolatopsis orientalis A.orientalis is Vancomycine producing fungus, carries out gene volume using technique for gene engineering to the bacterium Volume, for improving the yield of vancomycin, understanding the biosynthesis mechanism of vancomycin and excavating vancomycin derivatives tool It is significant.However, methods of homologous recombination traditional at present carries out genetic manipulation, it is relatively inefficient.Then the present invention tastes CRISPR/Cas9 gene editing system is introduced into improve its integration efficiency in Amycolatopsis orientalis A.orientalis by examination, Simplify genetic manipulation.
Summary of the invention
The first purpose of the invention is to provide one kind to be based on CRISPR/Cas9 editing system in Amycolatopsis orientalis CRISPR/Cas9 is edited plasmid pLYNY04 and introduces Amycolatopsis orientalis by the method for carrying out gene knockout and knocking in, this method It in Amycolatopsis orientalis HCCB10007, while realizing gene knockout and knocking in, can simplify hereditary behaviour Make, improves the integration efficiency of Amycolatopsis orientalis.A second object of the present invention is to provide one kind to contain gtfD DNA homolog The CRISPR/Cas9 of arm edits plasmid pLYNY04, by the target sequence of eGFP insertion Amycolatopsis orientalis, in order to detect Gene editing result.Third object of the present invention is to provide a kind of CRISPR/Cas9 containing gtfD DNA homolog arm to edit Plasmid pLYNY04 is in the application for preparing vancomycin Producing Strain.Fourth object of the present invention is to provide one kind and contains gtfD base Answering in site-directed integration Amycolatopsis orientalis mutant strain is being prepared because the CRISPR/Cas9 of homology arm edits plasmid pLYNY04 With.Fifth object of the present invention is to provide a kind of vancomycin composite variety glycosyls that can effectively edit Amycolatopsis orientalis to turn The primer pair sequence of the sgRNA of enzyme gtfD gene is moved, the primer pair sequence is as shown in SEQ ID NO:1 and SEQ ID NO:2.
Based on object above, the first aspect of the invention provides one kind based on CRISPR/Cas9 editing system in east The method for carrying out gene knockout in amycolatosis and knocking in, includes the following steps:
Step 1: skeleton plasmid pKCpGcas9EgdgtfD-NA of the building containing Cas9 and sgRNA；
Step 2: target sequence homology arm of the building containing eGFP；
Step 3: the building of the editor plasmid pLYNY04 containing gtfD DNA homolog arm；
The skeleton plasmid pKCpGcas9EgdgtfD-NA of step 1 is linearized using restriction enzyme；Then, The target sequence homology arm with eGFP of step 2 is integrated into linearisation using homologous recombination kit In pKCpGcas9EgdgtfD-NA, editor's plasmid pLYNY04 containing gtfD DNA homolog arm is obtained；
Step 4: editor's plasmid pLYNY04 electrotransformation is entered A.orientalis HCCB10007
Editor's plasmid pLYNY04 electricity containing gtfD DNA homolog arm that step 3 is obtained is transferred to competence A.orientalis HCCB10007 cell, while realizing the knockout for knocking in and pinpointing target sequence of eGFP.
According to the present invention, the construction method of the skeleton plasmid pKCpGcas9EgdgtfD-NA containing Cas9 and sgRNA Are as follows: NdeI/HindIII double digestion pKCcas9dO is utilized, cas9sco carrier is obtained；Then, it using pKCcas9dO as template, uses The primer sequence as shown in SEQ ID NO:1 and SEQ ID NO:2 carries out PCR amplification, obtains sgRNA recombinant fragment；Then, with A.orientalis HCCB10007 genome is template, uses the primer sequence as shown in SEQ ID NO:3 and SEQ ID NO:4 Column carry out PCR amplification, obtain endogenous GA DPH promoter；Then, using pIB139 as template, with such as SEQ ID NO:3 and SEQ ID Primer sequence shown in NO:4 carries out PCR amplification, obtains PermE* promoter fragment；Then, by cas9sco carrier, sgRNA weight Group segment, endogenous GA DPH promoter, the connection of PermE* promoter fragment, obtain CRISPR/Cas9 skeleton plasmid pKCpGcas9EgdgtfD-NA。
According to the present invention, the construction method of the target sequence homology arm containing eGFP are as follows: with A.orientalis HCCB10007 genome is as template respectively with the primer sequence as shown in SEQ ID NO:7 and SEQ ID NO:8 and with such as Primer sequence shown in SEQ ID NO:9 and SEQ ID NO:10 expands upstream and downstream homology arm segment；The upstream and downstream that will be amplified Product is carried out after the recycling of DNA QIAquick Gel Extraction Kit using the primer sequence as shown in SEQ ID NO:11 and SEQ ID NO:12 Overlap recombination, the gtfD homology arm segment of acquisition carry out T/A clone and are sequenced after the recycling of DNA QIAquick Gel Extraction Kit, and sequencing is just True plasmid recycles after KpnI/PstI digestion；Using KpnI/PstI digested plasmid pLYGYQ2, recycling size is 1054bp's EGFP sequence, two segments obtain the gtfD homology arm for having eGFP by digestion connection.
The second aspect of the invention provides a kind of CRISPR/Cas9 containing gtfD DNA homolog arm and edits plasmid It is first to obtain skeleton plasmid using above method building that pLYNY04, the CRISPR/Cas9, which edit plasmid pLYNY04, PKCpGcas9EgdgtfD-NA and target sequence homology arm containing eGFP, then according to the above method by skeleton plasmid PKCpGcas9EgdgtfD-NA linearisation, and the gtfD homology arm with eGFP is integrated into line using homologous recombination kit Property pKCpGcas9EgdgtfD-NA in construct obtain.
The third aspect of the invention provides a kind of CRISPR/Cas9 containing gtfD DNA homolog arm and edits plasmid PLYNY04 is in the application for preparing vancomycin Producing Strain.
The fourth aspect of the invention provides a kind of CRISPR/Cas9 containing gtfD DNA homolog arm and edits plasmid PLYNY04 is preparing the application in site-directed integration Amycolatopsis orientalis mutant strain.
The fifth aspect of the invention provides a kind of vancomycin composite variety sugar that can effectively edit Amycolatopsis orientalis The primer pair sequence of the sgRNA of based transferase gtfD gene, the primer pair sequence such as SEQ ID NO:1 and SEQ ID NO:2 It is shown.
The beneficial effects of the present invention are: CRISPR/Cas9 gene editing system is constructed in Amycolatopsis orientalis for the first time, By the target sequence of eGFP insertion Amycolatopsis orientalis, it is more convenient for the detection of gene editing result as reporter gene, it is logical Cross whether fluorescence microscopy has fluorescence.Meanwhile CRISPR/Cas9 gene editing system is introduced east by the present invention Amycolatosis A.orientalis, compared to previous methods of homologous recombination, integration efficiency is greatly improved, and simplifies simultaneously Genetic manipulation.
Detailed description of the invention
Fig. 1 is the structural schematic diagram of pKCCas9dO plasmid.
Fig. 2 is the structural schematic diagram of pKCpGcas9EgdgtfD-NA skeleton plasmid.
Fig. 3 is the structural schematic diagram that CRISPR/Cas9 edits plasmid pLYNY04.
Fig. 4 is the PCR proof diagram of the gene knock-out bacterial strain of embodiment 5；Wherein,
Swimming lane 1 is Amycolatopsis orientalis chromosome (negative control)；Swimming lane 2 is that CRISPR/Cas9 edits plasmid PLYNY04 (positive control)；Swimming lane 3-7 is positive gene knock-out bacterial strain；Swimming lane M is 1kb DNA Ladder marker (1kb DNA molecular amount gradient scale).
A figure is Verify-Gg-F/Verify-Gg-R PCR verification result；B figure is Verify-g8-F/Verify-g8-R PCR verification result；C figure is Verify-10g-F/Verify-10g-R PCR verification result.
Fig. 5 is the gene knock-out bacterial strain fluorescence detection figure of embodiment 6；Wherein,
A figure is Amycolatopsis orientalis HCCB10007 fluorescence microscope testing result；B figure is The non-fluorescence Microscopy Results of Amycolatopsis orientalis HCCB10007；C figure is gene knock-out bacterial strain fluorescence Microscopy Results；D figure is the non-fluorescence Microscopy Results of gene knock-out bacterial strain.
Specific embodiment
The present invention is described in further details below in conjunction with specific embodiment.It should be understood that following embodiment is only used for The bright present invention is not for limiting the scope of the invention.
Reagent used in following embodiment and plasmid origin:
1, pKCCas9dO is as constructed by the research of Chinese Academy of Sciences's Shanghai plant physiological ecology, the structural representation of pKCCas9dO plasmid Figure is as shown in Figure 1；
2, pLYGYQ2 is voluntarily constructed (Chinese antibiotic magazine, 2014 (3): 193-197) by applicant；
3, Amycolatopsis orientalis (A.orientalis) HCCB10007 is preserved in Chinese microorganism strain preservation management committee Member's meeting common micro-organisms center, deposit number CGMCC No.6023；
4, E.coli JM110 and pIB139 is commercially available product.
The building and verifying of 1 plasmid pKCpGcas9EgdgtfD-NA of embodiment
Step 1: pKCcas9dO obtains cas9sco carrier, digestion system are as follows: 2 μ of plasmid through NdeI/HindIII double digestion Each 1 μ L of 0.5 μ L, Buffer of L, NdeI and HindIII restriction endonuclease, moisturizing to 10 μ L.37 DEG C of water-baths react 2h.
Step 2: the acquisition of sgRNA recombinant fragment
With the vancomycin composite variety sugar of Amycolatopsis orientalis Amycolatopsis orientalis HCCB10007 Based transferase gtfD gene designs sgRNA for edit object, using pKCcas9dO as template, with primer gRNADNrecom and GtfDgRNArecomPCR amplification obtains sgRNA recombinant fragment, clip size 103bp.
GRNADNrecom:ACGTTGTAAAACGACGGCCAGTGCCAAGCTTCTCAAAAAAAGCA CCGAC (HindIII)
(SEQ ID NO:1)
GtfDgRNArecom:
GGCACAATCGTGCCGGTTGGTAGGAACTAGTCGTCGAGATCGCGGTGTCGCGTTTTAGAGCTAGAAA (Spe I) (SEQ ID NO:2)
PCR reaction system are as follows: 10 × reaction buffer, 5 each 1 μ of μ l, gRNADNrecom and gtfDgRNArecom L, pKCCas9dO 1 μ l, dNTPs (2Mm) 0.5 μ l, KOD DNA polymerase (5U/ μ l) 1 μ l, Mg2+32 μ l of μ l, DMSO, dd H2O adds to 50 μ l.
PCR response procedures are as follows: 94 DEG C of thermal startings, 5min；94 DEG C of denaturation, 30s；68 DEG C of annealing temperature, 30s；68 DEG C of extensions, The efficiency of KOD PLUS NEO enzyme system are as follows: 1min/2kb extends 10s.Denaturation, annealing extend three steps totally 30 circulations.Most Afterwards, 68 DEG C of extension 10min, 16 DEG C of placements.
Step 3: the acquisition of endogenous GA DPH promoter
Using A.orientalis HCCB10007 genome as template, expanded using primer pGADPHfw and pGADPHrw PCR Increase, obtains endogenous GA DPH promoter, clip size 184bp；
PGADPHfw:ACACTCGCATGCATACTAGAGAATCTCTAGAAGCTGAGAGTTTTCCC AAG (XbaI)
(SEQ ID NO:3)
PGADPHrw:CCAGGCCGATGGAGTACTTCTTGTCCATATGTGCTGCCACTCCCTTG AGA (NdeI)
(SEQ ID NO:4) Step 4: PermE* promoter fragment acquisition
Using pIB139 as template, PermE* promoter fragment, segment are obtained with primer ermEfw and ermErw PCR amplification Size is 199bp.
ErmEfw:GGATTTGTTCAGAACGCTCGGTTGCTCTAGAGATTCTCTAGTATGCATG C (XbaI)
(SEQ ID NO:5)
ErmErw:CCTACCAACCGGCACGAT (SEQ ID NO:6) is Step 5: CRISPR/Cas9 skeleton plasmid The building of pKCpGcas9EgdgtfD-NA
Aforementioned four segment is attached with Gibson method, system are as follows: 15 μ l of Assembly buffer, company in need, institute The 5 μ l of segment connect, by reaction system in PCR instrument 50 DEG C of heat preservation 60min.Obtain CRISPR/Cas9 skeleton plasmid PKCpGcas9EgdgtfD-NA, structural schematic diagram are shown in 2.Connection product is converted, and competent cell DH5 α, picking list are imported It is cloned in LB liquid medium, 37 DEG C are incubated overnight, and verify correct rear extraction plasmid, spare.
The building of 2 CRISPR/Cas9 gene editing system homology arm of embodiment
Step 1: used respectively using A.orientalis HCCB10007 genome as template Vcm-8F/Vcm-8R and Vcm-10F/Vcm-10R expands upstream and downstream homology arm segment；
Vcm-8F:AAGCTTAGATCGGTGAGTCGCTGCTG (HindIII) (SEQ ID NO:7)
Vcm8R:TCACGTATTTCCCCGCTGCAGGGTACCTTCGCTACCCCTGTTTCGTG(PstI)(KpnI)
(SEQ ID NO:8)
Vcm10F:AACAGGGGTAGCGAAGGTACCCTGCAGCGGGGAAATACGTGATGCGT(KpnI)(PstI)
(SEQ ID NO:9)
Vcm-10R:AAGCTTTTGGTGATGATCAGGCGGGA (HindIII) (SEQ ID NO:10)
Step 2: the upstream and downstream product amplified carries out Overlap (Overlap extension PCR after the recycling of DNA QIAquick Gel Extraction Kit Method) it recombinates, the gtfD homology arm segment of acquisition carries out T/A clone and is sequenced after the recycling of DNA QIAquick Gel Extraction Kit, and sequencing is correct Plasmid recycles after KpnI/PstI digestion；
Overlap primer sequence are as follows:
TYCZ-F:GTAAAACGACGGCCAGTGCCAAGCTTAGATCGGTGAGTCGCTGCTG (HindIII)
(SEQ ID NO:11)
TYCZ-R:GAGTCGGTGCTTTTTTTGAGAAGCTTTTGGTGATGATCAGGCGGGA (HindIII)
(SEQ ID NO:12)
Overlap recombinant PCR program: primer uses the F primer of fragment upstream, the R primer of segments downstream, extension of time t Time needed for large fragment after being connected for two segments.Template is upstream and downstream segment mixture.Remaining and regular-PCR program phase Together.
Step 3: recycling size is 1054bp using digestion with restriction enzyme plasmid pLYGYQ2 identical with step 2 Green fluorescent protein (eGFP) sequence, two segments by digestion connection obtain with green fluorescent protein gtfD it is homologous Arm.
Embodiment 3 edits the building of plasmid containing the CRISPR/Cas9 of gtfD DNA homolog arm
According to homologous recombination kit specification, the gtfD homology arm with green fluorescent protein that embodiment 2 is obtained It is integrated into pKCpGcas9EgdgtfD-NA, obtains editor's plasmid containing gtfD DNA homolog arm.Carry out concrete operations such as Under:
Step 1: pKCpGcas9EgdgtfD-NA skeleton plasmid uses HindIII linearization for enzyme restriction；
Step 2: calculating amount of DNA required for recombination reflects according to formula.(ensure the accuracy being loaded, each component sample-adding Amount is not less than 1 μ l).
Linearized vector: X=[0.02* cloning vector base logarithm] ng, Insert Fragment: Y=Y1+Y2…+Yn=[0.04* Each Insert Fragment base logarithm] ng, 5 μ l of 2*ClonExpress Mix, water adds to 10 μ l；
Step 3: configuration reaction system；
Mixing (concussion does not mix) is beaten Step 4: gently inhaling using pipettor, of short duration centrifugation collects reaction solution to tube bottom, 50 DEG C, react 5min；It is down to 4 DEG C；
Step 5: connection is after reaction, the DH5 α competent cell pressure-vaccum of all products and 50 μ l are mixed, with routine Method is converted, and the LB solid plate of LB+ corresponding resistant is coated with, and 37 DEG C of inversions are incubated overnight.Verifying is correct to be CRISPR/Cas9 edits plasmid pLYNY04, and structural schematic diagram is shown in Fig. 3.
CRISPR/Cas9 is edited plasmid electrotransformation and enters A.orientalis HCCB10007 by embodiment 4
Step 1: CRISPR/Cas9, which is edited plasmid pLYNY04, is transformed into E.coli JM110 demethylation；
Step 2: taking 2-5 μ g plasmid in the 1.5ml EP pipe that ice is pre-chilled, it is thin that 60 μ l HCCB10007 competence are added Born of the same parents are immediately placed in the electric revolving cup (BTX, Φ 2mm) of pre-cooling after pressure-vaccum mixes.Electrotransformation condition: 600 Ω, 25 μ F, 7.5kV/ Cm, 13 milliseconds of duration.
Step 3: thallus is resuspended with 1ml TSB after electrotransformation, it is transferred in 15ml teat glass, in 28 DEG C of shaken cultivations 5 ~8 hours.
Step 4: 100 μ l bacterium solutions is taken to be coated on the bennet plating medium containing corresponding antibiotic, remaining bacterium solution Also corresponding plate is applied after centrifugal concentrating, 28 DEG C are cultivated 3~5 days.
CRISPR/Cas9 edits the elimination and verifying of plasmid in 5 positive strain of embodiment
More plants of transformants are selected, in the 3ml TSB fluid nutrient medium containing Apr resistance, 28 DEG C of 2~3d of culture thallus. Transformant bacterium solution nonreactive Ben's culture medium draw 37 DEG C of single colonie be incubated overnight after, picking single colonie control be coated on nonreactive and Ben's culture medium containing Apr, 28 DEG C are cultivated 2-3 days, normal growth on nonreactive plate and non-growing single colonie on resistant plate As successfully eliminate the positive strain of plasmid.It is verified using verifying primer, as a result such as Fig. 4, the verifying primer used is as follows:
Verify-g8-F:ACCGGTCAAATTGGGCGTCG (SEQ ID NO:13)
Verify-g8-R:GTGCAGTGCTTCAGCCGCTA (SEQ ID NO:14)
Verify-10g-F:GTGCAGTGCTTCAGCCGCTA (SEQ ID NO:15)
Verify-10g-R:ATCCACCGGCCGTCCGCCGC (SEQ ID NO:16)
Verify-Gg-F:GAGTTCGAGGCGCGCTATCG (SEQ ID NO:17)
Verify-Gg-R:ACCGGAGCATGTCCTCGGCC (SEQ ID NO:18)
Experimental result: it is carried out with primer Verify-g8-F/Verify-g8-R, Verify-10g-F/Verify-10g-R PCR, positive transformant obtain the band of 3340bp, 3357bp respectively；It is carried out with primer Verify-Gg-F/Verify-Gg-R, Positive control and positive transformant obtain the identical band of size, and negative control obtains the band of different sizes with it.
Conclusion: the positive strain correctly edited has been obtained.
The observation of 6 Amycolatopsis orientalis green fluorescent protein of embodiment
Control strain A.orientalis HCCB10007 and positive strain use 28 DEG C of culture 4- of TSB fluid nutrient medium 5 days.Bacterial strain mycelium is applied to above glass slide, first whether grow normal with ordinary optical microscope observation mycelia and is clapped According to, then with confocal laser microscope blue light with 40 × object lens observation green fluorescent protein expression effect.As a result such as Fig. 5, The positive strain of acquisition can obviously detect green fluorescence under confocal laser microscope.
The result shows that editor plasmid pLYNY04 successfully imports in cell and complete expected homologous recombination, it is incorporated into Green fluorescence protein gene eGFP thereon obtains effective expression.
The analysis of 7 gtfD gene knockout mutant strain tunning of embodiment
The content analysis of vancomycin and associated products is referring to 2000 editions " United States Pharmacopeia/national formulary " in fermentation liquid (USP24/NF19) the HPLC analysis method of vancomycin carries out in.By starting strain A.orientalis HCCB10007 and After gtfD gene knockout engineering bacteria is fermented, HPLC is shown in engineering bacterium fermentation liquid without vancomycin, is further illustrated CCRISPR/Cas9 successful knockout vancomycin composite variety glycosyl transferase gtfD gene.
The above, only presently preferred embodiments of the present invention, not to the present invention make in any form with substantial limit System, all those skilled in the art, without departing from the scope of the present invention, when using disclosed above skill Art content, and the equivalent variations for a little variation, modification and evolution made, are equivalent embodiment of the invention；Meanwhile it is all according to According to the variation, modification and evolution of substantial technological any equivalent variations to the above embodiments of the invention, this is still fallen within In the range of the technical solution of invention.
Sequence table
<110>Shanghai Communications University
SHANGHAI LAIYI BIOMEDICAL RES
<120>application of a kind of gene editing method in Amycolatopsis orientalis
<130> 181054
<141> 2018-12-18
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
acgttgtaaa acgacggcca gtgccaagct tctcaaaaaa agcaccgac 49
<210> 2
<211> 67
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ggcacaatcg tgccggttgg taggaactag tcgtcgagat cgcggtgtcg cgttttagag 60
ctagaaa 67
<210> 3
<211> 50
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
acactcgcat gcatactaga gaatctctag aagctgagag ttttcccaag 50
<210> 4
<211> 50
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ccaggccgat ggagtacttc ttgtccatat gtgctgccac tcccttgaga 50
<210> 5
<211> 50
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggatttgttc agaacgctcg gttgctctag agattctcta gtatgcatgc 50
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cctaccaacc ggcacgat 18
<210> 7
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
aagcttagat cggtgagtcg ctgctg 26
<210> 8
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
tcacgtattt ccccgctgca gggtaccttc gctacccctg tttcgtg 47
<210> 9
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
aacaggggta gcgaaggtac cctgcagcgg ggaaatacgt gatgcgt 47
<210> 10
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
aagcttttgg tgatgatcag gcggga 26
<210> 11
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gtaaaacgac ggccagtgcc aagcttagat cggtgagtcg ctgctg 46
<210> 12
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gagtcggtgc tttttttgag aagcttttgg tgatgatcag gcggga 46
<210> 13
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
accggtcaaa ttgggcgtcg 20
<210> 14
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
gtgcagtgct tcagccgcta 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gtgcagtgct tcagccgcta 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
atccaccggc cgtccgccgc 20
<210> 17
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
gagttcgagg cgcgctatcg 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
accggagcat gtcctcggcc 20

Claims (7)

1. a kind of method that gene knockout is carried out in Amycolatopsis orientalis based on CRISPR/Cas9 editing system and is knocked in, It is characterized by comprising the following steps:
Step 1: skeleton plasmid pKCpGcas9EgdgtfD-NA of the building containing Cas9 and sgRNA；
Step 2: target sequence homology arm of the building containing eGFP；
Step 3: the building of the editor plasmid pLYNY04 containing gtfD DNA homolog arm
The skeleton plasmid pKCpGcas9EgdgtfD-NA of step 1 is linearized using restriction enzyme；Then, it uses The target sequence homology arm with eGFP of step 2 is integrated into linearisation by homologous recombination kit In pKCpGcas9EgdgtfD-NA, editor's plasmid pLYNY04 containing gtfD DNA homolog arm is obtained；
Step 4: editor's plasmid pLYNY04 electrotransformation is entered A.orientalis HCCB10007
Editor's plasmid pLYNY04 electricity containing gtfD DNA homolog arm that step 3 is obtained is transferred to competence A.orientalis HCCB10007 cell, while realizing the knockout for knocking in and pinpointing target sequence of eGFP.
2. carrying out gene knockout in Amycolatopsis orientalis based on CRISPR/Cas9 editing system as described in claim 1 With the method knocked in, which is characterized in that the structure of the skeleton plasmid pKCpGcas9EgdgtfD-NA containing Cas9 and sgRNA Construction method are as follows:
Using NdeI/HindIII double digestion pKCcas9dO, cas9sco carrier is obtained；
Then, using pKCcas9dO as template, PCR is carried out with the primer sequence as shown in SEQ ID NO:1 and SEQ ID NO:2 Amplification obtains sgRNA recombinant fragment；
Then, using A.orientalis HCCB10007 genome as template, such as SEQ ID NO:3 and SEQ ID NO:4 is used Shown in primer sequence carry out PCR amplification, obtain endogenous GA DPH promoter；Then, using pIB139 as template, with such as SEQ ID Primer sequence shown in NO:3 and SEQ ID NO:4 carries out PCR amplification, obtains PermE* promoter fragment；
Then, cas9sco carrier, sgRNA recombinant fragment, endogenous GA DPH promoter, PermE* promoter fragment are connected, is obtained Obtain CRISPR/Cas9 skeleton plasmid pKCpGcas9EgdgtfD-NA.
3. carrying out gene knockout in Amycolatopsis orientalis based on CRISPR/Cas9 editing system as described in claim 1 With the method knocked in, which is characterized in that the construction method of the target sequence homology arm containing eGFP are as follows:
It is used respectively using A.orientalis HCCB10007 genome as template such as SEQ ID NO:7 and SEQ ID NO:8 institute The primer sequence that shows and the homologous arm pieces of upstream and downstream is expanded with the primer sequence as shown in SEQ ID NO:9 and SEQ ID NO:10 Section；
Then, by the upstream and downstream product amplified after the recycling of DNA QIAquick Gel Extraction Kit, using such as SEQ ID NO:11 and SEQ ID Primer sequence shown in NO:12 carries out Overlap recombination, and the gtfD homology arm segment of acquisition is after the recycling of DNA QIAquick Gel Extraction Kit It carries out T/A clone and is sequenced, correct plasmid is sequenced and is recycled after KpnI/PstI digestion；
Then, using KpnI/PstI digested plasmid pLYGYQ2, the eGFP sequence that size is 1054bp is recycled, two segments pass through Digestion connection obtains the gtfD homology arm for having eGFP.
4. a kind of CRISPR/Cas9 containing gtfD DNA homolog arm edits plasmid pLYNY04, which is characterized in that described It is by skeleton plasmid pKCpGcas9EgdgtfD-NA line of any of claims 1 or 2 that CRISPR/Cas9, which edits plasmid pLYNY04, Property, and the gtfD homology arm that eGFP is had described in claim 1 or 3 is integrated into linearisation using homologous recombination kit PKCpGcas9EgdgtfD-NA in construct obtain.
5. a kind of CRISPR/Cas9 as claimed in claim 4 containing gtfD DNA homolog arm edits plasmid pLYNY04 and is making The application of standby vancomycin Producing Strain.
6. a kind of CRISPR/Cas9 as claimed in claim 4 containing gtfD DNA homolog arm edits plasmid pLYNY04 and is making Application in standby site-directed integration Amycolatopsis orientalis mutant strain.
7. a kind of sgRNA's for the vancomycin composite variety glycosyl transferase gtfD gene that can effectively edit Amycolatopsis orientalis Primer pair sequence, which is characterized in that the primer pair sequence is as shown in SEQ ID NO:1 and SEQ ID NO:2.
CN201811552697.8A 2018-12-18 2018-12-18 A kind of application of gene editing method in Amycolatopsis orientalis Pending CN109609537A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811552697.8A CN109609537A (en) 2018-12-18 2018-12-18 A kind of application of gene editing method in Amycolatopsis orientalis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811552697.8A CN109609537A (en) 2018-12-18 2018-12-18 A kind of application of gene editing method in Amycolatopsis orientalis

Publications (1)

Publication Number Publication Date
CN109609537A true CN109609537A (en) 2019-04-12

Family

ID=66009833

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811552697.8A Pending CN109609537A (en) 2018-12-18 2018-12-18 A kind of application of gene editing method in Amycolatopsis orientalis

Country Status (1)

Country Link
CN (1) CN109609537A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111635914A (en) * 2020-06-05 2020-09-08 电子科技大学中山学院 Plasmid for knocking out aerolysin gene of aeromonas hydrophila and construction method thereof
CN112899382A (en) * 2021-02-05 2021-06-04 浙江省农业科学院 Detection method for identifying amycolatopsis
CN113061560A (en) * 2021-03-11 2021-07-02 江南大学 Genetically engineered bacterium of amycolatopsis as well as construction method and application thereof
CN114317580A (en) * 2022-01-13 2022-04-12 上海交通大学 Specific gene knockout CRISPR/Cas9 editing plasmid containing double sgRNAs and application thereof

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111635914A (en) * 2020-06-05 2020-09-08 电子科技大学中山学院 Plasmid for knocking out aerolysin gene of aeromonas hydrophila and construction method thereof
CN112899382A (en) * 2021-02-05 2021-06-04 浙江省农业科学院 Detection method for identifying amycolatopsis
CN113061560A (en) * 2021-03-11 2021-07-02 江南大学 Genetically engineered bacterium of amycolatopsis as well as construction method and application thereof
CN114317580A (en) * 2022-01-13 2022-04-12 上海交通大学 Specific gene knockout CRISPR/Cas9 editing plasmid containing double sgRNAs and application thereof

Similar Documents

Publication Publication Date Title
CN109609537A (en) A kind of application of gene editing method in Amycolatopsis orientalis
CN105907758B (en) CRISPR-Cas9 guide sequence and primer thereof, transgenic expression vector and construction method thereof
CN110093349A (en) SgRNA and application using CRISPR/Cas9 systemic characteristic shearing rice xal3 gene promoter
CN111057654B (en) Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof
CN103772495B (en) A cotton macrofiber cance high-expression gene (GhLFHE1) and application thereof
CN113265406A (en) Soybean FDL12 gene editing site and application thereof
CN116948975A (en) IFNAR1 gene knockout MDCK cell strain, construction method and application thereof
CN102776202B (en) Cultivation method of male sterile plant
CN109486844B (en) Specific labeling method of enterotoxigenic escherichia coli
CN108103025B (en) Hematopoietic stem cell and preparation method and application thereof
CN113832180B (en) CRISPR/Cas13b mediated cotton RNA transcription regulation method
CN114213515B (en) Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness
KR20190139756A (en) Method for regenerating modified plant from cell having modified gene involved in flavonoid biosynthesis using CRISPR/Cas9 system in Petunia protoplast
CN113046379B (en) CRISPRCAS 9-based continuous gene editing method
CN111269932B (en) Method for changing cucumber tendril character
CN104293792B (en) Paddy rice stamen and lodicules expression promoter STA4 and its application
CN103540587A (en) Method of target-integrating foreign DNA (Deoxyribonucleic Acid) sequence to Rosa26 sites of rat and mouse as well as application thereof
CN110156883B (en) Tobacco SLs signal transduction protein NtDAD2, coding gene, recombinant expression vector, gene editing vector and application thereof
CN114736909A (en) VIGS-based Rhododendron splendens leaf gene silencing system and construction method thereof
CN110734917A (en) Lycoris longituba LlDFRc genes, expressed protein and application thereof
CN113005124B (en) gRNA primer for targeted knocking out ATG5 gene, expression system, cell strain and construction method
CN113025621B (en) Application of CIPK14 gene in improving drought resistance of pigeon pea
CN114181943B (en) Method for creating early maturing corn germplasm and application thereof
CN109022299A (en) A kind of ERG1 gene defect Yeast engineering bacteria, its construction method and its utilization
CN112574994B (en) Method for screening active region of pig miR-155 gene promoter and transcriptional regulatory element

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190412