CN109486844B - Specific labeling method of enterotoxigenic escherichia coli - Google Patents
Specific labeling method of enterotoxigenic escherichia coli Download PDFInfo
- Publication number
- CN109486844B CN109486844B CN201811191215.0A CN201811191215A CN109486844B CN 109486844 B CN109486844 B CN 109486844B CN 201811191215 A CN201811191215 A CN 201811191215A CN 109486844 B CN109486844 B CN 109486844B
- Authority
- CN
- China
- Prior art keywords
- gene
- escherichia coli
- coli
- pseudogene
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a specific labeling method of enterotoxigenic escherichia coli, which takes a red fluorescent protein gene as a reporter gene and utilizes a CRISPR/Cas9 system to knock an RFP gene into an enterotoxigenic escherichia coli genome at a fixed point. The enterotoxigenic escherichia coli with the specific marker constructed by the invention can realize specific recognition and monitoring of pathogenic escherichia coli, and provides a methodological basis for researching the infection path and pathogenic mechanism of the enterotoxigenic escherichia coli in vivo.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a fluorescence labeling of pathogenic bacteria, more particularly relates to a specific labeling method of enterotoxigenic escherichia coli, and particularly relates to a method for knocking red fluorescent protein into enterotoxigenic escherichia coli by using a CRISPR/Cas9 technology to establish ETEC specific labeling.
Background
Enterotoxigenic Escherichia coli (ETEC) is an important pathogenic bacterium causing diarrhea of people and young animals, has high morbidity and mortality, and is one of the current research hotspots, and the pathogenicity of the Enterotoxigenic Escherichia coli is closely related to adhesin and Enterotoxigenic bacteria.
At present, a virus attacking model is constructed for enterotoxigenic escherichia coli ETEC at home and abroad, pathogenic bacteria are marked, real-time monitoring is realized, and biological processes such as distribution, field planting, infection and the like of the enterotoxigenic escherichia coli ETEC in an animal body can be directly observed. For example, Corr et al (2007) adopts lux gene-labeled Listeria monocytogenes as an attacking model to illustrate that the secretion and production of bacteriocin by Lactobacillus salivarius UCC118 is an anti-infection action mechanism in vivo; yang Pan et al (2014) established a model for implantation of Lux transgenic E.coli in the intestinal tract of mice. The result shows that the spontaneous blue-green and other short-wave fluorescence of the intestinal tracts of animals is stronger, and the real-time imaging and monitoring interference on exogenous pathogenic bacteria is very large. In addition, when the reporter gene is applied to an animal challenge model, fluorescent plasmids are easy to lose, and certain resistance pressure needs to be maintained when the stability of the plasmids is maintained, so that the actual situation of an exogenous strain in the gastrointestinal tract of an animal is difficult to reflect by the challenge model. These models lack versatility, and labeled strains have poor specificity and stability, and high sensitivity detection cannot be achieved in actual detection.
CRISPR (clustered regulated short palindromic repeats)/Cas system is a genome site-directed editing technology emerging in recent years. The technology is successfully applied to site-directed knockout, knock-in or mutation of genomes of various organisms, and is an effective gene editing tool.
Disclosure of Invention
In order to solve the problems, the invention is based on the CRISPR/Cas9 technology, and realizes the fixed-point insertion of the exogenous red fluorescent protein RFP by taking enterotoxigenic Escherichia coli ETEC as pathogenic bacteria, thereby realizing the specific marking of the enterotoxigenic Escherichia coli. Specifically, the method comprises the following steps:
in one aspect, the invention provides a method for marking escherichia coli, which is characterized in that a red fluorescent protein gene is knocked into a pseudogene locus where an exogenous gene can be inserted on an escherichia coli chromosome at a fixed point, and the knocking-in of the red fluorescent protein gene at the pseudogene locus does not change the biological performance of the escherichia coli.
The Escherichia coli marking method is characterized in that the Escherichia coli is enterotoxigenic Escherichia coli, the site-specific knock-in uses a CRISPR/Cas system, and the pseudogene locus is selected from yaiT, yaiX, ygeO, yheO, wbbL and ykgA, preferably yheO.
Specifically, the Escherichia coli marking method of the present invention is characterized by comprising the steps of:
(1) identifying enterotoxigenic escherichia coli;
(2) selecting and verifying pseudogene loci;
(3) designing an sgRNA target primer and constructing a gene editing vector;
(4) screening a gene editing strain and removing a gene editing carrier;
(5) validation of RFP spot knock-in labeled enterotoxigenic E.coli.
The escherichia coli marking method comprises the steps of (1) designing a primer according to an escherichia coli enterotoxin gene conserved sequence, carrying out PCR amplification by taking escherichia coli DNA as a template, and selecting escherichia coli with enterotoxin genes as a target strain for carrying out specific marking.
The escherichia coli marking method comprises the steps of (2) referring to an escherichia coli K12 gene sequence, and performing bioinformatics analysis to obtain candidate pseudogene loci; designing a primer according to the candidate pseudogene sequence, carrying out PCR amplification by using the enterotoxigenic escherichia coli genome in the step (1) as a template, confirming a pseudogene locus contained in the enterotoxigenic escherichia coli genome, and knocking in the pseudogene locus as a red fluorescent protein gene.
The escherichia coli marking method comprises the steps of (3) designing sgRNA according to the pseudogene locus sequence selected and verified in the step (2), and constructing a pTargetF-sgRNA vector; a gene editing vector containing the foreign gene RFP is constructed by homologous recombination.
The Escherichia coli marking method comprises the steps of connecting a T5 promoter, a target gene RFP, a left homologous arm, a right homologous arm and a fragment J23119(SpeI) -sgRNA-gRNAscfold by designing a primer and utilizing overlap extension PCR, and finally carrying out a connection reaction with a Kpn I and Sph I double-enzyme digestion linearized vector pUC 57.
The escherichia coli marking method comprises the steps of (4) preparing ETEC-Cas9 competence, transforming the gene editing vector in the step (3) into ETEC-Cas9 competence, and screening a gene editing strain; after PCR verification, selecting the successfully knocked-in monoclonal, adding an inducer, performing shake culture at 30 ℃ overnight, and removing a Donor vector; the culture was carried out at 42 ℃ for 16 hours, and the pCas9 vector was removed.
The escherichia coli marking method comprises the steps of respectively coating an LB plate without resistance, Kan resistance and Amp resistance after ETEC-Cas9 competence transformation gene editing vectors, and enabling successfully edited clones to grow colonies on the resistance-free plate and grow colonies on the Kan resistance and Amp resistance plate.
The escherichia coli marking method comprises the steps of (5) sequencing verification of successful knocking-in of RFP genes and verification of red fluorescent protein expression under a fluorescent microscope.
In a second aspect, the present invention provides an escherichia coli specifically labeled with a red fluorescent protein prepared by the escherichia coli labeling method.
The escherichia coli specifically marked by the red fluorescent protein is characterized in that: when 3-7g/L lactose is added into the culture medium for induced expression, the expression of red fluorescent protein in the escherichia coli ETEC living cells can be seen through microscopic examination under a fluorescent microscope; the specificity detection is carried out by adopting a fluorescence spectrophotometer method, and the detection limit is 104-105CFU/mL。
In a third aspect, the invention also provides the application of the escherichia coli specifically labeled by the red fluorescent protein.
The application of the escherichia coli specifically marked by the red fluorescent protein comprises the application of the escherichia coli in constructing an escherichia coli virus attacking model.
The application of the escherichia coli specifically marked by the red fluorescent protein comprises the research of infection ways and pathogenic mechanisms in escherichia coli.
The use of the red fluorescent protein-specifically labelled E.coli according to the invention, although it may involve in vivo experiments and studies, does not involve any diagnosis or treatment of diseases, i.e.it is for non-disease diagnosis and treatment purposes.
Compared with the prior art, the technical scheme of the invention has the following advantages:
(1) the red fluorescent protein has longer wavelength and stronger penetrating power, and is not interfered by the widely existing short-wave fluorescence. The labeling is carried out using wild, pathogenic enterotoxigenic E.coli, rather than using E.coli, a tool commonly used in genetic engineering. The red fluorescent protein is used for marking pathogenic enterotoxigenic escherichia coli, can be more accurately used for the infection way and the pathogenic mechanism of the escherichia coli in an animal body, can be used for specific detection through a fluorescence spectrophotometer, and has high detection sensitivity.
(2) The marker protein is stably inserted into the pseudogene locus, the stability is good, and the proliferation and the pathogenicity of enterotoxigenic escherichia coli are not influenced. The introduction of the marker protein plasmid into the escherichia coli through the plasmid is easy to lose, and the expression of the marker protein is unstable; introduction of a marker protein into the genome of E.coli by means of transposon, homologous recombination, etc. is inefficient and can easily change the biological properties of pathogenic E.coli.
(3) The method uses CRISPR/Cas editing technology to knock in the marker protein, has high editing efficiency, does not leave artificially added resistance screening markers in the edited pathogenic enterotoxigenic escherichia coli, is environment-friendly, avoids the diffusion of resistance genes, and is suitable for directly operating pathogenic bacteria.
Drawings
Various other advantages and benefits will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. The drawings are only for purposes of illustrating the preferred embodiments and are not to be construed as limiting the invention. Also, like reference numerals are used to refer to like parts throughout the drawings. In the drawings:
FIG. 1: PCR (polymerase chain reaction) verification electrophoretogram of enterotoxigenic escherichia coli toxic gene;
FIG. 2: PCR (polymerase chain reaction) verification electrophoretogram of enterotoxigenic escherichia coli pseudogene yheO;
FIG. 3: pCas9 plasmid map;
FIG. 4: a Donor plasmid map;
FIG. 5: editing electrophoresis chart of PCR screening of clone by RFP gene;
FIG. 6: morphological characteristics of ETEC-RFP:
(a) fluorescence microscopy, (b) plate colony map, (c) test tube thalli map;
FIG. 7: detection limit of ETEC-RFP;
FIG. 8: fluorescence stability assay of ETEC-RFP.
Detailed Description
Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.
Example 1: selection of enterotoxigenic E.coli strains
Detecting Escherichia coli strains capable of causing intestinal pathogenicity, extracting Escherichia coli genome DNA, and identifying the genome DNA by 0.8% agarose electrophoresis. Synthesizing a pair of primers according to an enterotoxigenic gene sequence published on NCBI, detecting a toxic gene by PCR, and identifying a PCR product by 2% agarose gel electrophoresis, wherein the size of the PCR product is 219bp as shown in figure 1;
ST-F：5’-CCATGGCATCTACACAATCAA-3’(SEQ ID NO:4)；
ST-R：5’-CTCGAGTTAGCATCCTTTTGCT-3’(SEQ ID NO:5)。
the results in FIG. 1 show that the E.coli strain capable of causing enteropathogenicity is enterotoxigenic E.coli.
Example 2: selection and validation of pseudogene loci
Using the sequence of Escherichia coli K12 gene as a reference, the positions of 6 pseudogenes, yaiT, yai X, yge O, yheO, wbb L and ykg A, into which foreign genes were inserted were predicted by bioinformatics analysis using ABCPred. PCR primers were designed based on the above pseudogene loci, and detection was carried out using the enterotoxigenic E.coli genome in example 1 as a template.
Primers yheO-F and yheO-R are designed according to a yheO gene sequence (GenBank accession number NC-000913.3) published in Genbank, PCR amplification detection of the yheO gene in ETEC is completed by taking enterotoxigenic escherichia coli genome DNA in example 1 as a template, the size of an amplified target band is 814bp, the size of the PCR amplified band accords with the expectation, and a PCR amplification product is sequenced as shown in figure 2, wherein the yheO sequence is shown as SEQ ID NO: 1.
yheO-F：GTAGAAGCCGGTAAAGGCGA(SEQ ID NO:6)；
yheO-R：AGAAACGCTGCTATCCGCTC(SEQ ID NO:7)。
FIG. 2 shows that the genome of E.coli having enterotoxicity described in example 1 contains a yheO pseudogene site, which can be used as an insertion site for carrying a foreign gene.
Example 3: design of sgRNA target primers and construction of gene editing vector
1. Target sequence design
Designing primers according to the principle of designing Cas9 target spots: g is arranged at the 5 'end, a PAM sequence (NGG) is arranged at the 3' end, and a guide sequence yheO-gRNA is designed: ATATAATTAGTGCTGGAAAGCGG (SEQ ID NO: 8).
2. Double digestion ligation of PCR amplified sgRNA fragments and plasmids
The primers P1, P2 and P3 are designed by taking pTarget plasmid as a template, PCR amplification is carried out through the primers P1 and P3 to obtain a PCR product, the PCR product is identified through 2% agarose gel electrophoresis, the PCR product is purified and recovered by using DNA Fragment Purification Kit (the sequence is shown as SEQ ID NO:20), then the recovered PCR product is taken as the template, PCR is carried out through the primers P2 and P3 to obtain a linearized PCR product containing a target sequence, and the linearized PCR product is purified and recovered (the sequence is shown as SEQ ID NO: 21).
P1：ATATAATTAGTGCTGGAAAGgttttagagctagaaatagca(SEQ ID NO:9)
P2：agtcctaggtataatactagtATATAATTAGTGCTGGAAAG(SEQ ID NO:10)
P3：cttatggagctgcacatgaactcgagtagggataacagggt(SEQ ID NO:11)
TABLE 1 reaction System for PCR
PCR reaction conditions (precious organism Primer STAR Max enzyme): pre-denaturation at 98 ℃ for 2 min; then 35 cycles were performed: denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, and extension at 72 ℃ (the enzyme activity extends about 1kb in 1 min); extending for 10min at 72 ℃; maintaining the temperature at 4 ℃.
And (3) carrying out double enzyme digestion on the PCR product and the plasmid pTarget obtained by the two-step purification by using Spe I and Xho I, placing each enzyme digestion system in a constant-temperature water bath kettle at 37 ℃ for 2 hours, carrying out a ligation reaction on the recovered product under the action of T4 ligase, standing the reaction system, and placing the reaction system in a constant-temperature water bath kettle at 16 ℃ for 2 hours. Add 20. mu.L of the cooled reaction solution to 100. mu.L of competent cells, flick the tube wall, mix well, and stand on ice for 30 min. Heat shock at 42 ℃ for 90s and incubation with ice water for two minutes. Add 600. mu.L LB medium, shake bacteria at 37 ℃ and 120rmp for 1h, take 100. mu.L on antibiotic plates, invert the plates, incubate overnight at 37 ℃. And (3) inoculating the positive clone identified by colony PCR into an LB culture medium containing spectinomycin for culture overnight for seed conservation, extracting plasmid, and carrying out enzyme digestion identification.
TABLE 2 the cleavage reaction is as follows
TABLE 3 enzyme Linked systems as follows
3. Gene editing vector construction
The recombination templates used for knock-ins were: upstream homology arm-target gene-downstream homology arm-sgRNA. The upstream and downstream homologous arms are derived from the gene yheO of the knocked-in site, the target gene is RFP, and the sgRNA is used for amplifying a fragment J23119(SpeI) -sgRNA-gRNA scaffold by using the constructed pTargetF-sgRNA as a template. Utilizing primer design software primer 5.0, utilizing the principle of homologous recombination to design primers for genes to be integrated, respectively amplifying upper and lower homologous arms, RFP gene and J23119(SpeI) -sgRNA-gRNA scaffold by a PCR method, then performing overlapping PCR to prepare recombinant fragments, finally performing ligation reaction with Kpn I and Sph I double-enzyme digestion linearized vector pUC57, transforming the recombinant plasmid into DH5 alpha, selecting a single clone on an ampicillin-containing plate, performing colony PCR, double-enzyme digestion verification and sequencing to identify positive recombinants, and naming the plasmid map of the Donor vector as a Donor vector, wherein the plasmid map of the Donor vector is shown in figure 4.
TABLE 4 primers required in the construction of the strains
TABLE 5 PCR amplification System
TABLE 6 overlapping PCR amplification System
PCR reaction conditions (precious organism Primer STAR Max enzyme): pre-denaturation at 98 ℃ for 2 min; then 35 cycles were performed: denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, and extension at 72 ℃ (the enzyme activity extends about 1kb in 1 min); extending for 10min at 72 ℃; maintaining the temperature at 4 ℃.
The Donor sequencing is constructed by the gene editing vector, and the sequence of the upstream homology arm-target gene-downstream homology arm-sgRNA region is shown as SEQ ID NO. 2.
Example four: screening of Gene-editing Strain and removal of Gene-editing vector
1. Preparation of ETEC-Cas9 expression competence
The target strain ETEC was first transformed with pCas9 to prepare ETEC-Cas9, in which the plasmid map of pCas9 is shown in FIG. 3.
1) Thawing the competent cells ETEC on ice;
2) adding 2 mu L of pCas9 plasmid into 100 mu L of competent cells, and mixing uniformly;
3) thermally shocking for 90s at 42 ℃, and immediately putting on ice;
4) uniformly coating the bacterial liquid on an LB plate containing Kan, and culturing at 30 ℃ for 12-16 h.
Preparation of competence for expressing Cas9 protein by ETEC-Cas9
1) Selecting single clone, inoculating into 50mL LB culture medium containing Kan, and culturing at 30 deg.C to OD600Adding 50 μ L inducer about 0.2, and culturing OD600About 0.5;
2) transferring the culture to a 50mL centrifuge tube, and placing the centrifuge tube on ice for 30 min;
3) centrifuging at 4000rmp at 4 ℃ for 10min, and removing the supernatant;
4) 10ml of ice-cold 100mM CaCl were added2Suspending the cells in water, ice-cooling for 10min, centrifuging at 4 deg.C 4000rmp for 10min, and discardingSupernatant fluid;
5) repeating step (4), discarding the supernatant, and adding 2mL of CaCl containing 15% glycerol2Resuspend the solution, divide it rapidly, 100. mu.L per tube, and store at-80 ℃.
2. Transformation of Gene-editing vector, screening of Gene-editing Strain, removal of Gene-editing plasmid
The Donor plasmid was transformed into ETEC-Cas9 competent cells (same as step 3), arabinose was added for induction and plating, gene editing strain screening was performed, and the PCR amplification of the yheO-F and yheO-R primers in example II was used to verify that the edited ETEC monoclonal antibody had a band size of 1650bp for successful knocking-in of RFP gene (FIG. 5) and 814bp for successful knocking-in. The sequencing result of the PCR product of the RFP gene successfully knocked into the enterotoxigenic escherichia coli gene is shown in SEQ ID NO. 3.
And selecting a monoclonal colony which is verified by PCR and successfully knocked in by the RFP gene, inducing by IPTG, and carrying out shake culture at 30 ℃ overnight to remove the Donor vector. The pCas9 vector was removed by incubation at 42 ℃ for 16 h. The removed strain is pink (FIG. 6c), and the test tube thallus is coated with non-resistant, Kan-resistant, Amp-resistant LB plate, non-resistant plate colony growth (FIG. 6b), Kan-resistant and Amp-resistant plate sterile colony growth. Sequencing verified that the RFP gene was successfully knocked in, and red fluorescent protein was expressed under a fluorescent microscope (fig. 6 a).
Example five: strain ETEC-RFP fluorescence detection limit determination and stability verification
The strain is streaked on a plate added with 5g/L lactose for culturing for 16h, and a red single colony is picked up and cultured in a medium filled with 50mLLB at 37 ℃ and 200rmp for 16-24 h. Taking 4mL of the cultured bacterial liquid into a 10mL centrifuge tube, centrifuging for 1min at 12000rmp, abandoning the supernatant, and resuspending twice with sterile water. Fluorescence measurements were performed at 2-fold gradient dilutions, with sterile water as the control (FIG. 7). The result shows that the fluorescence intensity is in linear positive correlation with the cell density, and the fluorescence intensity value can accurately reflect the number of the escherichia coli, so that the method has a good application prospect in the research of the infection way and the pathogenic mechanism of the enterotoxigenic escherichia coli in vivo.
Culturing the activated gene-edited strain ETEC-RFP under the condition of no selective pressure, adding 3-7g/L lactose into a culture medium for induced expression, wherein the inoculum size of the bacterial liquid is 1% of the volume of the culture medium, transferring the bacterial liquid once every 24h for 10 times continuously, taking 4mL of the bacterial liquid each time, resuspending the bacterial liquid twice with sterile water, and determining the relative fluorescence intensity of the bacterial liquid at different successive transfer times (figure 8) by using the sterile water as a control group. The result shows that the strain ETEC-RFP has good passage stability, the fluorescence performance is not lost or varied after long-term passage, and the strain ETEC-RFP has higher reliability when being used for the research of the infection way and the pathogenic mechanism of enterotoxigenic escherichia coli.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the appended claims.
SEQUENCE LISTING
<110> university of southern ethnic group in applicant's name
<120> specific labeling method of enterotoxigenic escherichia coli
<130> do not
<160>21
<170>PatentIn version 3.5
<210>1
<211>814
<212>DNA
<213>E.coli
<400>1
gtagaagccg gtaaaggcga agcaccgaaa gacagcgata ctgttgtagt gaactacaaa 60
ggtacgctga tcgacggtaa agagttcgac aactcttaca cccgtggtga accgctttct 120
ttccgtctgg acggtgttat cccgggttgg acagaaggtc tgaagaacat caagaaaggc 180
ggtaagatca aactggttat tccaccagaa ctggcttacg gcaaagcggg tgttccgggg 240
atcccaccga attctaccct ggtgtttgac gtagagctgc tggatgtgaa accagcgccg 300
aaggctgatg caaagccgga agctgatgcg aaagccgcag attctgctaa aaaataagca 360
ttaagaaccg ccgcctgacc aggcggcggt ttttttatta caggccggat ataattagtg 420
ctggaaagcg gaacctccgc tgtattaatt tagttacccg catcattaat gagcctgccc 480
tgaaaagtta acgacaggct cctgaaaagg agtgtttttt ttcatgtcca ggtcgctttt 540
aaccaacgaa accagtgagt tggatttact ggatcaacgt cctttcgacc agaccgattt 600
tgatattctg aaatcctacg aagcggtggt ggacgggtta gcgatgctta ttggctccca 660
ctgtgaaatc gttttgcact ctttgcagga tctaaaatgt tcagccattc gcattgctaa 720
cggtgaacat acaggccgga agattggttc gccaattact gacctggcgc tacgtatgct 780
gcacgatatg acgggagcgg atagcagcgt ttct 814
<210>2
<211>1711
<212>DNA
<213> Artificial sequence
<400>2
gtagaagccg gtaaaggcga agcaccgaaa gacagcgata ctgttgtagt gaactacaaa 60
ggtacgctga tcgacggtaa agagttcgac aactcttaca cccgtggtga accgctttct 120
ttccgtctgg acggtgttat cccgggttgg acagaaggtc tgaagaacat caagaaaggc 180
ggtaagatca aactggttat tccaccagaa ctggcttacg gcaaagcggg tgttccgggg 240
atcccaccga attctaccct ggtgtttgac gtagagctgc tggatgtgaa accagcgccg 300
aaggctgatg caaagccgga agctgatgcg aaagccgcag attctgctaa aaaataagca 360
ttaagaaccg ccgcctgacc aggcggcggt ttttttatta caggccggat ataatcataa 420
aaaatttatt tgctttgtga gcggataaca attataatag attcaattgt gagcggataa 480
caatttcaca cagaattcat taaagaggag aaattaacta tgagaggatc gcatcaccat 540
caccatcacg gatccatggt gagcaagggc gaggaggata acatggccat catcaaggag 600
ttcatgcgct tcaaggtgca catggagggc tccgtgaacg gccacgagtt cgagatcgag 660
ggcgagggcg agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag 720
ggtggccccc tgcccttcgc ctgggacatc ctgtcccctc agttcatgta cggctccaag 780
gcctacgtga agcaccccgc cgacatcccc gactacttga agctgtcctt ccccgagggc 840
ttcaagtggg agcgcgtgat gaacttcgag gacggcggcg tggtgaccgt gacccaggac 900
tcctccctgc aggacggcga gttcatctac aaggtgaagc tgcgcggcac caacttcccc 960
tccgacggcc ccgtaatgca gaagaagacc atgggctggg aggcctcctc cgagcggatg 1020
taccccgagg acggcgccct gaagggcgag atcaagcaga ggctgaagct gaaggacggc 1080
ggccactacg acgctgaggt caagaccacc tacaaggcca agaagcccgt gcagctgccc 1140
ggcgcctaca acgtcaacat caagttggac atcacctccc acaacgagga ctacaccatc 1200
gtggaacagt acgaacgcgc cgagggccgc cactccaccg gcggcatgga cgagctgtac 1260
aaggcggaac ctccgctgta ttaatttagt tacccgcatc attaatgagc ctgccctgaa 1320
aagttaacga caggctcctg aaaaggagtg ttttttttca tgtccaggtc gcttttaacc 1380
aacgaaacca gtgagttgga tttactggat caacgtcctt tcgaccagac cgattttgat 1440
attctgaaat cctacgaagc ggtggtggac gggttagcga tgcttattgg ctcccactgt 1500
gaaatcgttt tgcactcttt gcaggatcta aaatgttcag ccattcgcat tgctaacggt 1560
gaacatacag gccggaagat ttgacagcta gctcagtcct aggtataata ctagtatata 1620
attagtgctg gaaaggtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta 1680
tcaacttgaa aaagtggcac cgagtcggtg c 1711
<210>3
<211>1650
<212>DNA
<213> Artificial sequence
<400>3
gtagaagccg gtaaaggcga agcaccgaaa gacagcgata ctgttgtagt gaactacaaa 60
ggtacgctga tcgacggtaa agagttcgac aactcttaca cccgtggtga accgctttct 120
ttccgtctgg acggtgttat cccgggttgg acagaaggtc tgaagaacat caagaaaggc 180
ggtaagatca aactggttat tccaccagaa ctggcttacg gcaaagcggg tgttccgggg 240
atcccaccga attctaccct ggtgtttgac gtagagctgc tggatgtgaa accagcgccg 300
aaggctgatg caaagccgga agctgatgcg aaagccgcag attctgctaa aaaataagca 360
ttaagaaccg ccgcctgacc aggcggcggt ttttttatta caggccggat ataatcataa 420
aaaatttatt tgctttgtga gcggataaca attataatag attcaattgt gagcggataa 480
caatttcaca cagaattcat taaagaggag aaattaacta tgagaggatc gcatcaccat 540
caccatcacg gatccatggt gagcaagggc gaggaggata acatggccat catcaaggag 600
ttcatgcgct tcaaggtgca catggagggc tccgtgaacg gccacgagtt cgagatcgag 660
ggcgagggcg agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag 720
ggtggccccc tgcccttcgc ctgggacatc ctgtcccctc agttcatgta cggctccaag 780
gcctacgtga agcaccccgc cgacatcccc gactacttga agctgtcctt ccccgagggc 840
ttcaagtggg agcgcgtgat gaacttcgag gacggcggcg tggtgaccgt gacccaggac 900
tcctccctgc aggacggcga gttcatctac aaggtgaagc tgcgcggcac caacttcccc 960
tccgacggcc ccgtaatgca gaagaagacc atgggctggg aggcctcctc cgagcggatg 1020
taccccgagg acggcgccct gaagggcgag atcaagcaga ggctgaagct gaaggacggc 1080
ggccactacg acgctgaggt caagaccacc tacaaggcca agaagcccgt gcagctgccc 1140
ggcgcctaca acgtcaacat caagttggac atcacctccc acaacgagga ctacaccatc 1200
gtggaacagt acgaacgcgc cgagggccgc cactccaccg gcggcatgga cgagctgtac 1260
aaggcggaac ctccgctgta ttaatttagt tacccgcatc attaatgagc ctgccctgaa 1320
aagttaacga caggctcctg aaaaggagtg ttttttttca tgtccaggtc gcttttaacc 1380
aacgaaacca gtgagttgga tttactggat caacgtcctt tcgaccagac cgattttgat 1440
attctgaaat cctacgaagc ggtggtggac gggttagcga tgcttattgg ctcccactgt 1500
gaaatcgttt tgcactcttt gcaggatcta aaatgttcag ccattcgcat tgctaacggt 1560
gaacatacag gccggaagat tggttcgcca attactgacc tggcgctacg tatgctgcac 1620
gatatgacgg gagcggatag cagcgtttct 1650
<210>4
<211>21
<212>DNA
<213> Artificial sequence
<400>4
ccatggcatc tacacaatca a 21
<210>5
<211>22
<212>DNA
<213> Artificial sequence
<400>5
ctcgagttag catccttttg ct 22
<210>6
<211>20
<212>DNA
<213> Artificial sequence
<400>6
gtagaagccg gtaaaggcga 20
<210>7
<211>20
<212>DNA
<213> Artificial sequence
<400>7
agaaacgctg ctatccgctc 20
<210>8
<211>23
<212>DNA
<213> Artificial sequence
<400>8
atataattag tgctggaaag cgg 23
<210>9
<211>41
<212>DNA
<213> Artificial sequence
<400>9
atataattag tgctggaaag gttttagagc tagaaatagc a 41
<210>10
<211>41
<212>DNA
<213> Artificial sequence
<400>10
agtcctaggt ataatactag tatataatta gtgctggaaa g 41
<210>11
<211>41
<212>DNA
<213> Artificial sequence
<400>11
cttatggagc tgcacatgaa ctcgagtagg gataacaggg t 41
<210>12
<211>29
<212>DNA
<213> Artificial sequence
<400>12
ggtaccgtag aagccggtaa aggcgaagc 29
<210>13
<211>40
<212>DNA
<213> Artificial sequence
<400>13
agcaaataaa ttttttatga ttatatccgg cctgtaataa 40
<210>14
<211>40
<212>DNA
<213> Artificial sequence
<400>14
ttattacagg ccggatataa tcataaaaaa tttatttgct 40
<210>15
<211>40
<212>DNA
<213> Artificial sequence
<400>15
taatacagcg gaggttccgc cttgtacagc tcgtccatgc 40
<210>16
<211>40
<212>DNA
<213> Artificial sequence
<400>16
gcatggacga gctgtacaag gcggaacctc cgctgtatta 40
<210>17
<211>43
<212>DNA
<213> Artificial sequence
<400>17
aggactgagc tagctgtcaa atcttccggc ctgtatgttc acc 43
<210>18
<211>43
<212>DNA
<213> Artificial sequence
<400>18
ggtgaacata caggccggaa gatttgacag ctagctcagt cct 43
<210>19
<211>28
<212>DNA
<213> Artificial sequence
<400>19
gcatgcgcac cgactcggtg ccactttt 28
<210>20
<211>183
<212>DNA
<213> Artificial sequence
<400>20
atataattag tgctggaaag gttttagagc tagaaatagcaagttaaaat aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttgaattct ctagagtcga 120
cctgcagaag cttagatcta ttaccctgtt atccctactc gagttcatgt gcagctccat 180
aag 183
<210>21
<211>204
<212>DNA
<213> Artificial sequence
<400>21
agtcctaggt ataatactag tatataatta gtgctggaaa ggttttagag ctagaaatag 60
caagttaaaa taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt 120
ttttgaattc tctagagtcg acctgcagaa gcttagatct attaccctgt tatccctact 180
cgagttcatg tgcagctcca taag 204
Claims (12)
1. An Escherichia coli marking method is characterized in that red fluorescent protein gene is knocked into a pseudogene locus where exogenous genes can be inserted on an Escherichia coli chromosome at a fixed point, and the knocking-in of the red fluorescent protein RFP gene at the pseudogene locus does not change the biological performance of the Escherichia coli;
the site-specific knock-in uses a CRISPR/Cas system, and the pseudogene site is yheO;
the nucleotide sequence of guide sequence gRNA in the CRISPR/Cas system is SEQ ID NO: 8.
2. the method of Escherichia coli labeling according to claim 1, wherein the Escherichia coli is enterotoxigenic Escherichia coli.
3. The method for labeling Escherichia coli according to claim 2, comprising the steps of:
(1) identifying enterotoxigenic escherichia coli;
(2) selecting and verifying pseudogene loci;
(3) designing an sgRNA target primer and constructing a gene editing vector;
(4) screening a gene editing strain and removing a gene editing carrier;
(5) and (4) verifying RFP gene site-directed knock-in labeled enterotoxigenic Escherichia coli.
4. The E.coli labeling method according to claim 3, wherein the step (1) comprises designing primers based on the conserved sequence of E.coli enterotoxin gene, performing PCR amplification using E.coli DNA as a template, and selecting E.coli having enterotoxin gene as a target strain for specific labeling.
5. The E.coli labeling method of claim 3, wherein the step (2) comprises performing bioinformatics analysis with reference to the E.coli K12 gene sequence to obtain candidate pseudogene loci; designing a primer according to the candidate pseudogene sequence, carrying out PCR amplification by using the enterotoxigenic escherichia coli genome in the step (1) as a template, confirming a pseudogene locus contained in the enterotoxigenic escherichia coli genome, and using the pseudogene locus as a red fluorescent protein gene fixed-point knocking-in point.
6. The E.coli labeling method of claim 3, wherein the step (3) comprises designing sgRNA based on the pseudogene site sequence selected and verified in the step (2), and constructing pTargetF-sgRNA vector; a gene editing vector containing the foreign gene RFP is constructed by homologous recombination.
7. The E.coli labeling method of claim 3 or 6, wherein the gene editing vector is constructed by connecting the T5 promoter, the RFP gene of the target gene, the left and right homology arms, and the fragment J23119(SpeI) -sgRNA-gRNA scaffold by overlap extension PCR by designing primers, and finally performing a ligation reaction with the Kpn I and Sph I double-cut linearized vector pUC 57.
8. The E.coli labeling method of claim 3, wherein step (4) comprises making ETEC-Cas9 competent, transforming the gene-editing vector in step (3) into ETEC-Cas9 competent, performing gene-editing strain screening; after PCR verification, selecting the successfully knocked-in monoclonal, adding an inducer, performing shake culture at 30 ℃ overnight, and removing a Donor vector; the culture was carried out at 42 ℃ for 16 hours, and the pCas9 vector was removed.
9. The E.coli labeling method of claim 3 or 8, wherein the selection of the gene-editing strain comprises coating a non-resistant, Kan-resistant, Amp-resistant LB plate with ETEC-Cas9 competent transformation gene-editing vector, respectively, and allowing colonies of successfully edited clones to grow on the non-resistant plate and colonies to grow on the Kan-resistant and Amp-resistant plates.
10. The E.coli labeling method of claim 3, wherein step (5) comprises verifying the successful knock-in of the RFP gene by sequencing and verifying the expression of the red fluorescent protein under a fluorescent microscope.
11. Escherichia coli specifically labeled with a red fluorescent protein, prepared by the Escherichia coli labeling method according to any one of claims 1 to 10.
12. The labeled E.coli of claim 11, wherein: when 3-7g/L lactose is added into the culture medium for induction expression, the cells are subjected to fluorescenceThe expression of red fluorescent protein in the escherichia coli ETEC living cells can be seen through microscopic examination under a light microscope; the specificity detection is carried out by adopting a fluorescence spectrophotometer method, and the detection limit is 104-105CFU/mL。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811191215.0A CN109486844B (en) | 2018-10-12 | 2018-10-12 | Specific labeling method of enterotoxigenic escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811191215.0A CN109486844B (en) | 2018-10-12 | 2018-10-12 | Specific labeling method of enterotoxigenic escherichia coli |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109486844A CN109486844A (en) | 2019-03-19 |
| CN109486844B true CN109486844B (en) | 2020-08-25 |
Family
ID=65689807
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811191215.0A Active CN109486844B (en) | 2018-10-12 | 2018-10-12 | Specific labeling method of enterotoxigenic escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109486844B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111110865A (en) * | 2019-11-27 | 2020-05-08 | 哈尔滨医科大学 | Adeno-associated virus dual-vector gene therapy system and application thereof in treatment of mucopolysaccharidosis type II |
| CN111378660B (en) * | 2020-02-29 | 2021-08-06 | 浙江大学 | sgRNA targeting tetracycline resistance gene tetA, knockout vector thereof, vector construction method and application |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805048B (en) * | 2014-12-24 | 2019-08-02 | 温州医科大学 | The escherichia coli of one plant of detection lead |
| US20190241880A1 (en) * | 2016-09-13 | 2019-08-08 | Jason Wright | Proximity-dependent biotinylation and uses thereof |
| CN106801029B (en) * | 2017-01-22 | 2020-05-01 | 山东大学 | Recombinant escherichia coli and application thereof in preparation of sugar vaccine for resisting shigella |
| CN107365793A (en) * | 2017-06-19 | 2017-11-21 | 百格基因科技（江苏）有限公司 | A kind of method of extensive genome editor suitable for plant |
| CN108130306B (en) * | 2018-01-10 | 2019-03-05 | 天津科技大学 | The genetic engineering bacterium and its construction method of high yield uridine and application |
-
2018
- 2018-10-12 CN CN201811191215.0A patent/CN109486844B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109486844A (en) | 2019-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108410911B (en) | LMNA gene knockout cell line constructed based on CRISPR/Cas9 technology | |
| CN111607594A (en) | Cell line for knocking out pig IRF8 gene based on CRISPR-Cas9 editing technology and construction method thereof | |
| CN109486844B (en) | Specific labeling method of enterotoxigenic escherichia coli | |
| CN109266650B (en) | Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter | |
| CN109609537A (en) | A kind of application of gene editing method in Amycolatopsis orientalis | |
| CN112029699B (en) | Clostridium butyricum gene editing system based on endogenous CRISPR-Cas system and application thereof | |
| CN112575006B (en) | Elicitin gene for inducing HR and active oxygen accumulation in biocontrol pythium and expression vector and application thereof | |
| CN113881678B (en) | C/EBPZ gene promoter and application thereof | |
| CN109504680B (en) | Salt stress inducible promoter, primer, expression vector and application thereof | |
| CN111944811B (en) | Double sgRNA for targeted knockout of FRZB gene, pig fibroblast line for knockout of FRZB gene and application of pig fibroblast line | |
| CN111269932B (en) | Method for changing cucumber tendril character | |
| CN113088559A (en) | Method for rapidly screening CRISPR-Cas9 genome editing gRNA target site | |
| CN111793624A (en) | Oligo DNA group of sgRNA for site-directed knockout of rice Osaurora1 gene | |
| CN107893077B (en) | Corn ZmLTP3 gene promoter and application thereof | |
| CN113215187A (en) | Method for rapidly obtaining fragrant rice material by using CRISPR/Cas9 technology | |
| CN111849997B (en) | Macrobrachium carinicauda compound eye development regulation gene and guide RNA as well as acquisition and application | |
| CN114672491B (en) | Application of corn ZmTIP4 family gene or coded protein thereof in regulation and control of plant cold resistance | |
| CN114891786B (en) | Dog Rosa26 gene and application thereof | |
| Huan et al. | Chromosomal localization of 5S rDNA in Chinese shrimp (Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification | |
| CN114854757B (en) | Potato vascular bundle specific expression promoter PStmlp1 responding to bacterial wilt infection and application thereof | |
| JP2009514506A (en) | E. Plasmid-free clone of E. coli strain DSM6601 | |
| CN111471685B (en) | Trypanosoma japonicum RNA interference expression vector, construction method and application thereof | |
| CN110129359B (en) | Method for detecting gene editing event and determining gene editing efficiency and application thereof | |
| CN112852805B (en) | Preparation method of rice miRNA homozygous lethal mutant | |
| CN116334087A (en) | sgRNA sequence of specific targeting porcine Pax3 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |