CN114213515B - Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness - Google Patents

Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness Download PDF

Info

Publication number
CN114213515B
CN114213515B CN202111503187.3A CN202111503187A CN114213515B CN 114213515 B CN114213515 B CN 114213515B CN 202111503187 A CN202111503187 A CN 202111503187A CN 114213515 B CN114213515 B CN 114213515B
Authority
CN
China
Prior art keywords
rice
seq
gene
protein
chalkiness
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111503187.3A
Other languages
Chinese (zh)
Other versions
CN114213515A (en
Inventor
肖浪涛
蔺万煌
苏益
谢琴
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Agricultural University
Original Assignee
Hunan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Agricultural University filed Critical Hunan Agricultural University
Priority to CN202111503187.3A priority Critical patent/CN114213515B/en
Publication of CN114213515A publication Critical patent/CN114213515A/en
Application granted granted Critical
Publication of CN114213515B publication Critical patent/CN114213515B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a gene OsR498G0917707800.01 and application of a coded protein thereof in regulating rice chalkiness, and relates to the field of plant genetic engineering. The invention discloses a protein encoded by a gene OsR498G0917707800.01, such as 1) or 2) or 3): 1) A protein with an amino acid sequence shown as SEQ ID No. 2; 2) A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.2 and has the same function as the protein in 1); 3) Fusion proteins obtained by ligating tags at the N-terminal and/or C-terminal of the amino acid sequence of 1) or 2). The invention discovers that the OsR498G0917707800.01 gene in the rice can be knocked out, so that the chalkiness of the rice can be obviously reduced.

Description

Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness
Technical Field
The invention relates to the field of plant genetic engineering, in particular to application of a gene OsR498G0917707800.01 and a protein coded by the gene OsR4987800.01 in regulation of rice chalkiness.
Background
Rice (Oryza sativa l.) is native to china and is one of the world's important food crops. The rice is used as the most important grain crop in China, the yield is the first place of the grain crop, and the sowing area accounts for 1/3 of the total area of the grain crop. In China, besides improving the yield of rice, improving the quality of rice is also an important target for rice breeding. Chalky is one of the important traits for measuring the quality of rice, and directly affects the appearance quality and commodity circulation of rice and the processing quality of rice. Reduction of chalkiness is one of the main targets of rice quality breeding. The research of quality gene functions is carried out, which is helpful to promote the breeding of new rice varieties and the industrialization of rice, and further improves the grain production benefit.
Disclosure of Invention
The present invention aims to solve at least one of the technical problems existing in the prior art. Therefore, the invention provides a gene for regulating and controlling rice chalkiness and a protein coded by the gene, wherein the gene is named as an OsR498G0917707800.01 gene, the protein coded by the gene is named as a protein OsR498G0917707800.01, the expression level of the protein OsR498G0917707800.01 is reduced or the expression of the protein OsR498G0917707800.01 is blocked, and the rice chalkiness can be obviously reduced.
In a first aspect of the invention, there is provided the use of any one of 1) to 3) for regulating rice chalkiness:
1) A protein with an amino acid sequence shown as SEQ ID No. 2;
2) A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.2 and has the same function as the protein in 1);
3) Fusion proteins obtained by ligating tags at the N-terminal and/or C-terminal of the amino acid sequence of 1) or 2).
In some embodiments of the present invention, in the above protein, the amino acid sequence of the protein in 1) is shown in SEQ ID No.2 and consists of 469 amino acid residues.
In some embodiments of the present invention, the protein may be synthesized artificially or may be obtained by synthesizing the gene encoding the protein and then biologically expressing the protein.
In some embodiments of the present invention, the tag in 3) refers to a polypeptide or protein that is fusion expressed with the target protein using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.
In some embodiments of the invention, the modulation of rice chalkiness is a reduction in rice chalkiness.
In some embodiments of the invention, the rice is specifically another rice variety having the same allele as that of Xiangearly indica 11, xiangearly indica 24, xiangearly indica 7 or OsR498917707800.01.
In a second aspect of the invention, there is provided the use of any of (1) to (4) in the regulation of rice chalkiness,
(1) A nucleic acid molecule encoding the protein of the first aspect of the invention;
(2) An expression cassette comprising the nucleic acid molecule of (1);
(3) A recombinant vector comprising the nucleic acid molecule of (1) or the expression cassette of (2);
(4) A recombinant microorganism comprising the nucleic acid molecule of (1) or the expression cassette of (2) or the recombinant vector of (3).
In some embodiments of the invention, in the above biological material, the nucleic acid molecule of (1) may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
In some embodiments of the present invention, in the above biological material, the nucleotide sequence of the nucleic acid molecule of (1) is shown in SEQ ID No.1, and the nucleic acid molecule consists of 1410 nucleotides.
In some embodiments of the present invention, in the above biological material, the expression cassette in (2) refers to a DNA molecule capable of expressing the above protein in a host cell, which may include an enhancer sequence.
In some embodiments of the present invention, in the above biological material, the recombinant vector in (3) comprises a nucleotide sequence as shown in SEQ ID No. 1.
In some embodiments of the present invention, in the above biological material, the vector in (3) may be a plasmid, a cosmid, a phage, or a viral vector.
In some embodiments of the present invention, in the above biological material, the carrier in (3) is-Blunt Simple Cloning vector。
In some embodiments of the present invention, in the above biological material, the recombinant microorganism of (4) may be yeast, bacteria, algae or fungi.
In some embodiments of the present invention, in the above biological material, the recombinant microorganism of (4) is E.coli.
In some embodiments of the invention, in the above biological material, the recombinant microorganism of (4) is E.coli DH 5. Alpha.
In a third aspect of the invention there is provided a rice chalky regulation product comprising a protein according to the first aspect of the invention, or a biomaterial according to the second aspect of the invention, or any one of (1) to (4):
(1) A nucleic acid molecule which disrupts the expression level of a gene of the protein of the first aspect of the invention and/or inhibits the activity of the protein and/or reduces the content of the protein;
(2) An expression cassette comprising the nucleic acid molecule of (1);
(3) A recombinant vector comprising the nucleic acid molecule of (1) or the expression cassette of (2);
(4) A recombinant microorganism comprising the nucleic acid molecule of (1) or the expression cassette of (2) or the recombinant vector of (3);
wherein the biological material comprising the protein according to the first aspect of the invention or the biological material according to the second aspect of the invention is used to increase rice chalkiness;
the biological material of any one of (1) - (4) is used for reducing rice chalkiness.
In some embodiments of the invention, in the above-described product, the nucleic acid molecule of (1) may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
In some embodiments of the present invention, in the above product, the recombinant vector in (3) is a recombinant vector comprising the sequence shown in SEQ ID No.5 or SEQ ID No.6.
In some embodiments of the invention, in the above product, the vector in (3) is pYLCRISPR/Cas 9P 35s-H plasma or LB-DNAi plasma.
In some embodiments of the present invention, in the above product, the recombinant microorganism of (4) may be yeast, bacteria, algae or fungi.
In some embodiments of the invention, in the above product, the recombinant microorganism of (4) is E.coli.
In some embodiments of the invention, in the above product, the recombinant microorganism of (4) is E.coli DH 5. Alpha.
In some embodiments of the invention, the rice is specifically another rice variety having the same allele as that of Xiangearly indica 11, xiangearly indica 24, xiangearly indica 7 or OsR498917707800.01.
In a fourth aspect, the present invention provides the use of a protein according to the first aspect of the present invention or a biomaterial according to the second aspect of the present invention in any one of (1) to (3), characterized in that:
(1) Application in rice breeding;
(2) Application in cultivating chalky rice plants with reduced gene knockout;
(3) The application of the gene knockout rice plant with reduced chalkiness in preparing and cultivating the gene knockout rice plant products with reduced chalkiness.
In some embodiments of the invention, the rice is specifically another rice variety having the same allele as that of Xiangearly indica 11, xiangearly indica 24, xiangearly indica 7 or OsR498917707800.01.
In some embodiments of the present invention, the use in plant breeding as described in (1) above may specifically be to cross-line rice, which disrupts the expression of the gene of the protein of the first aspect of the present invention and/or inhibits the activity of the protein of the first aspect of the present invention and/or reduces the content of the protein of the first aspect of the present invention, with other rice for rice breeding.
In a fifth aspect of the present invention, there is provided a method for reducing the chalkiness of rice comprising disrupting the expression level of a gene of a protein of the first aspect of the present invention in a rice plant of interest and/or inhibiting the activity of a protein of the first aspect of the present invention in a rice plant of interest and/or reducing the protein content of the first aspect of the present invention in a rice plant of interest to obtain a knock-out rice plant; the chalkiness of the gene knockout rice plants are reduced compared with the target rice plants.
In some embodiments of the invention, the method of disrupting the amount of expression of a gene encoding a protein of the first aspect of the invention in a rice plant of interest and/or inhibiting the activity of a protein of the first aspect of the invention in a rice plant of interest and/or reducing the amount of a protein of the first aspect of the invention in a rice plant of interest is by knocking out or inhibiting or mutating a gene encoding a protein of the first aspect of the invention in said rice plant of interest.
In some embodiments of the invention, the method of disrupting the amount of expression of a gene encoding a protein of the first aspect of the invention in a rice plant of interest and/or inhibiting the activity of a protein of the first aspect of the invention in a rice plant of interest and/or reducing the amount of a protein of the first aspect of the invention in a rice plant of interest is accomplished by knocking out a gene encoding a protein of the first aspect of the invention in said rice plant of interest by CRISPR/Cas9 technology.
In some embodiments of the invention, the target sequence in the CRISPR/Cas9 technology is shown as SEQ ID No.5 (corresponding to positions 118-140 of SEQ ID No. 1) and/or SEQ ID No.6 (corresponding to positions 371-393 of SEQ ID No. 1).
In some embodiments of the invention, the CRISPR/Cas9 technology comprises a CRISPR/Cas9 gene editing recombinant vector of any one of (1) - (3):
(1) The recombinant vector pYLCRISPR/Cas9-gRNA1 contains coding genes of gRNA1 and Cas9, and the sequence of the gRNA1 is shown as SEQ ID No. 15;
(2) The recombinant vector LB-DNAi/gRNA2 contains gRNA2, and the sequence of the gRNA2 is shown as SEQ ID No. 16;
(3) The recombinant vector pYLCRISPR/Cas9-OsR498G0917707800.01 contains gRNA1, gRNA2 and Cas9 coding genes, the gRNA1 sequence is shown as SEQ ID No.15, and the gRNA2 sequence is shown as SEQ ID No. 16.
In some embodiments of the invention, the pair of adaptor primers for gRNA1 is shown in SEQ ID No.7 and SEQ ID No. 8.
In some embodiments of the invention, the pair of adaptor primers for gRNA2 is shown in SEQ ID No.9 and SEQ ID No. 10.
In some embodiments of the invention, the rice is specifically another rice variety having the same allele as that of Xiangearly indica 11, xiangearly indica 24, xiangearly indica 7 or OsR498917707800.01.
In a sixth aspect of the invention there is provided the use of the method of the fifth aspect of the invention in (1) or (2),
(1) Application in rice breeding;
(2) The application of the gene knockout rice plants with reduced chalkiness is used for cultivating the gene knockout rice plants with reduced chalkiness.
In some embodiments of the present invention, in the above application, the application in plant breeding described in (1) may specifically be that the knock-out rice plant obtained by the method of the fifth aspect of the present invention is crossed with other rice to conduct rice breeding.
In some embodiments of the invention, the rice is specifically another rice variety having the same allele as that of Xiangearly indica 11, xiangearly indica 24, xiangearly indica 7 or OsR498917707800.01.
The beneficial effects of the invention are as follows:
the invention discovers that the rice gene OsR498G0917707800.01 and the encoding protein thereof are related to rice chalkiness, and can obviously reduce the rice chalkiness when being knocked out. Therefore, the OsR498G0917707800.01 gene can be used as an effective target point for genetic breeding of rice, and has good application prospect in the aspects of rice breeding and rice quality improvement.
The invention also provides a method for cultivating the OsR498G0917707800.01 gene knockout rice plant, which can effectively knockout the OsR498G0917707800.01 gene, and compared with a wild type, the OsR498G0917707800.01 gene knockout rice plant constructed by the method has obviously reduced chalkiness and effectively improved rice quality.
Drawings
The invention is further described with reference to the accompanying drawings and examples, in which:
FIG. 1 is a plasmid map of pYLCRISPR/Cas9-OsR 49840917707800.01 in an example of the invention.
FIG. 2 shows the results of gene sequence analysis of OsR498G0917707800.01 gene knockout plants (pYLCRISPR/Cas 9-OsR498G0917707800.01-1) in examples of the present invention.
FIG. 3 is a diagram showing the appearance of OsR498G0917707800.01 gene knockout plant (pYLCRISPR/Cas 9-OsR498G0917707800.01-1) compared with wild type plant (X11) in the example of the present invention.
FIG. 4 is a graph comparing the grain phenotype of OsR498G0917707800.01 knockout plant (pYLCRISPR/Cas 9-OsR498G0917707800.01-1) with wild type plant (X11) in the examples of the present invention.
FIG. 5 shows the chalkiness results of OsR498G0917707800.01 gene knockout plants (pYLCRISPR/Cas 9-OsR498G0917707800.01-1) and wild type plants (X11) in examples of the present invention.
FIG. 6 shows the chalkiness results of OsR498G0917707800.01 gene knockout plants (pYLCRISPR/Cas 9-OsR498G0917707800.01-1) and wild type plants (X11) in examples of the present invention.
Detailed Description
In order to make the technical solutions of the present invention more apparent to those skilled in the art, the following examples will be presented. It should be noted that the following examples do not limit the scope of the invention.
The reagents, methods and apparatus employed in the examples which follow are all conventional in the art. The test methods for specific experimental conditions are not noted in the examples below, and are generally performed under conventional experimental conditions or under experimental conditions recommended by the manufacturer.
Used in the following examplesFastPfu DNAPolymeras, 10 XEasypfu Buffer and +.>Blunt Simple Cloning vector is offered by Beijing all gold biotechnology limited; gel recovery purification kits HiPure Gel Pure DNAMini Kit and HiPure Plasmid Micro Kit are provided by the guangzhou mei biotechnology company, inc; 2 xTaq mix was carried out by Beijing bo Ling Kerui Biotechnology Co., ltdSupplying; pYLCRISPR/Cas 9P 35s-H plasma is offered by Wohan Bober remote biotechnology Co., ltd; LB-DNAi plasma is supplied by Wohan Bober Biotechnology Co.
Cloning of OsR498G0917707800.01 Gene
(1) cDNA extraction
(1) Leaves of 7 d-age rice (X11) seedlings were ground to powder with liquid nitrogen, about 100mg was transferred into RNase-free 2mL centrifuge tubes, and RNA was extracted using plant tissue RNA extraction kit HiPure Plant RNA Mini Kit (available from Shanghai Michaelis Biotechnology Co., ltd.). 1% agarose gel electrophoresis was used to detect the purity and integrity of RNA, and an enzyme-labeled instrument was used to detect the concentration of RNA.
(2) cDNA was synthesized using the reverse transcription kit EasScript One-Step gDNARemoval and cDNASynthesis SuperMix (available from Beijing full gold Biotechnology Co., ltd.). The reaction system is shown in Table 1.
Table 1:
centrifuging the above reaction system in a miniature desk centrifuge for a short time to thoroughly mix the components, placing into a PCR instrument, incubating at 42deg.C for 30min, and heating at 85deg.C for 5s (to makeAnd inactivating the RT/RI Enzyme Mix and the gDNA remote) to obtain cDNA. After the reaction is completed, the mixture is put into a refrigerator at the temperature of minus 20 ℃ for standby.
(2) Amplification of OsR498G0917707800.01 Gene
The nucleotide sequence of the rice OsR498G0917707800.01 gene is specifically as follows:
5’-ATGAAGAAGACGGTGGTTCTCTACCCCGGCCTCGCCGTCGGCCACCTGAACCCCATGATGGAGCTCGCCGACGTCTTCCTGGACCACGGCTACGCCGTCGCCGTGGCGCTCATCGACCCGTCGGTCATGGAGAACGAAGCCAACCTCGCCGCCGCCGTCGCCCGCGCCGTCTCCTCCAAGAGCTCCACCATCTCCTTCCACACGCTCCCGGGCATCCCGGACCCTCCCTCGCTCGTCTTCAACGATCAGTTCTTCAAGAACTACTTCGACCTCGTGCGACGCCACAACGAGCACCTCCACGACTTCCTCCGCTCCGTGCGGGGCCTCCATGCCGTGGTCATCGACGCATCGTGCGCCCATGCCCATGAAGCCGCGAGGAAGCTGGGAGTCCCTGTCTTGATGTTCTACCCGTCCAACGCCGGCCACCTCGCCGTTAACTTGCAGACTCCTCTGCTTGTTGACGGGTTCAAGAAGCATCTGGGAGGAGATAGTACTAGTCCTGTCGAGTTCTTGGGTGTTCGACCCATGTCGGCTTCTCACTTGGCTGGCCTTTTTGGGCCGATTAGCGAGGTGAACAAGGATTTCGAGGCCATGATTTTTGCCGGTGCGCGCATGAACGCGGAGTTCGACGGAATCCTGATCAACACGTCCGTGTCGCTGGAGGAGCGGGCGCTGCGAGCTCTCGCCGACCCGCGCTGCTGCCCCGACGGCGTGGTAATCCCGCCGGTGTACGCCGTGGGGCCACTGGTCGACAAAGCCGCCGCCGCCGCCGGTGATGAGAGCAGCCGACATCAGTGCCTCGTGTGGCTCGACGGACAACCCGACCGCAGCGTCGTGTTCCTCTGCTTCGGGAGCATCGCCGACGCATGTGAACAGTCCGACCAGCAGCTGAAGGAGATCGCCGCCGGCCTGGACAAGTCCGGCCACCGCTTCCTGTGGGTGGTTCGGGCAACCAGCACCCAACACCTCGACGCGCTCCTACCGGAGGTGTTCTTCGCAAGAACCAGCGGCCGCGGCCTCGTCGTCAACAGCTGGGTGCCCCAGCCGAGCATCCTCCGCCACCGCGCCACCGCCGCGTTCGTGACGCACTGCGGGTGGAACTCGGTGCTAGAGGGGATCACCGCGGGGGTGCCGATGCTCTGCTGGCCGCTGTACGCGGAGCAGAGGATGAACAAGGTGCTCATGGTGGAGGACATGGGCGTCGGCGTGGAGATGGAGGGATGGCTGGAAGGGCTGGTGACCGCCGAGGAGGTGGAGACGAAGGTGAGGCTGGTCATGGAGTCCGAGCATGGAAGGAAGGTTAGAGAGCGTGTCGAGGCGCACAGAGATGGCGTGGCCATGGCCTGGAAAGATGGTGGCTCGTCGCGTGTCGCGTTTGCCCGTCTCATGTCTGAATTGCTCAACGTGTGA-3’(SEQ ID No.1)。
the amino acid sequence of the protein encoded by the rice OsR498G0917707800.01 gene (SEQ ID No. 1) is specifically as follows:
MKKTVVLYPGLAVGHLNPMMELADVFLDHGYAVAVALIDPSVMENEANLAAAVARAVSSKSSTISFHTLPGIPDPPSLVFNDQFFKNYFDLVRRHNEHLHDFLRSVRGLHAVVIDASCAHAHEAARKLGVPVLMFYPSNAGHLAVNLQTPLLVDGFKKHLGGDSTSPVEFLGVRPMSASHLAGLFGPISEVNKDFEAMIFAGARMNAEFDGILINTSVSLEERALRALADPRCCPDGVVIPPVYAVGPLVDKAAAAAGDESSRHQCLVWLDGQPDRSVVFLCFGSIADACEQSDQQLKEIAAGLDKSGHRFLWVVRATSTQHLDALLPEVFFARTSGRGLVVNSWVPQPSILRHRATAAFVTHCGWNSVLEGITAGVPMLCWPLYAEQRMNKVLMVEDMGVGVEMEGWLEGLVTAEEVETKVRLVMESEHGRKVRERVEAHRDGVAMAWKDGGSSRVAFARLMSELLNV(SEQ ID No.2)。
the sequence of the amplification primer F1/R1 of the OsR498G0917707800.01 gene is specifically as follows:
F1：5’-ATGAAGAAGACGGTGGTTCTC-3’(SEQ ID No.3)；
R1：5’-TCACACGTTGAGCAATTCAGA-3’(SEQ ID No.4)。
using the cDNA extracted in the step (1) as a template, and adopting a primer F1/R1 and high-fidelity DNA polymeraseFastPfu DNA Polymerase amplification of the target gene. Wherein the amplification system is shown in Table 2.
Table 2:
the reaction procedure is: 3min at 95 ℃;95℃for 30s,55℃for 30s,72℃for 2min,35cycles; and at 72℃for 5min.
After the reaction, a PCR product is obtained.
(3) Recovery and ligation of fragments of interest
And (3) separating the target band with the size of 1410bp from the PCR product obtained in the step (2) after running on a 1% agarose gel for electrophoresis, and recovering the target band by using a gel recovery and purification kit HiPure Gel Pure DNA Mini Kit, wherein the operations are strictly carried out according to the specification, and the recovered product is obtained.
Connecting the recovered product to-Blunt Simple Cloning vector. Wherein, the reaction system is: 4. Mu.L of recovered product and 1. Mu.L +.>Blunt Simple Cloning vector, the reaction conditions are: 25 ℃ for 15min to obtain a connecting product (& lt, & gt)>-Blunt Simple Cloning vector/OsR498G0917707800.01)。
(4) Transformation
Adding 5 mu L of the ligation product obtained in the step (3) and 10 mu L of KCM (containing 0.5M KCl,0.15M CaCl) into a centrifuge tube 2 And 0.25M MgCl 2 ) And 35. Mu.L ddH 2 O. 50. Mu.L of DH 5. Alpha. Competent cells were removed from-80℃and placedRapidly adding the mixture into the centrifuge tube after the mixture is completely melted on ice, lightly blowing and uniformly mixing the mixture by using a gun head, sequentially standing the centrifuge tube on ice for 30min, carrying out heat shock on the centrifuge tube in a 42 ℃ water bath for 30s, standing the centrifuge tube on ice for 5min, adding 500 mu L of LB liquid medium into the centrifuge tube in an ultra-clean workbench, culturing the centrifuge tube for 1h at 37 ℃ and 180rpm, and centrifuging the centrifuge tube for 5min at 6000 Xg. Part of the supernatant was discarded in a super clean bench, 200. Mu.L of the supernatant was left to re-suspend the strain, and then the strain suspension was uniformly spread on LB solid medium (containing 50mg/L kanamycin) and cultured upside down at 37℃for 12 hours.
(5) Identification of Positive clones
In an ultra clean bench, the single colony on LB solid medium in the step (4) is gently dipped with a gun head and dissolved in 4 mu L ddH 2 In O, 5. Mu.L of 2 XTaq mix, 0.5. Mu. L F1 (10. Mu.M) and 0.5. Mu. L R1 (10. Mu.M) were then added, and after mixing, amplification was performed according to the reaction procedure in step (1), to obtain a PCR product.
The PCR products were run on a 1% agarose gel and samples with a single band of interest of approximately 1410bp in size were identified as positive clones.
(6) Extraction of plasmids
The single colony identified as positive clone in step (5) was dissolved in 20mL LB liquid medium (containing 50mg/L kanamycin) and cultured at 37℃and 180rpm until the bacterial liquid OD was reached 600 About 0.6. The bacterial liquid is treated by HiPure Plasmid Micro Kit to extract plasmids, and the operations are strictly carried out according to the specification.
And (3) conveying the extracted plasmids to a qing department for sequencing, lightly reversing and uniformly mixing the bacterial liquid with the correct sequencing and 50% glycerol according to the proportion of 1:1 (V/V), and storing the bacterial liquid in a refrigerator at the temperature of minus 80 ℃.
Construction of OsR498G0917707800.01 Gene knockout Rice plants
OsR498G0917707800.01 gene knockout rice plants are constructed in Xiangearly indica type 11 (X11) by using a CRISPR/Cas9 system.
1. Construction method
a. Design target
Two specific targets (Target 1 and Target 2) were designed by an online design tool (http:// skl. Scau. Edu. Cn/home /), the specific sequences were as follows:
target 1:5'-GCTTCGTTCTCCATGACCGACGG-3' (SEQ ID No.5, positions 118-140 corresponding to SEQ ID No. 1);
target 2:5'-AGGGACTCCCAGCTTCCTCGCGG-3' (SEQ ID No.6, corresponding to positions 371-393 of SEQ ID No. 1).
b. Construction of recombinant vectors containing gRNA1 and gRNA2
The grnas were designed and adaptor primers for the grnas were synthesized separately for the two Target sequences (Target 1 and Target 2). Wherein, the sequence of the gRNA1 and the linker primer PF2/PR2 for Target 1 is as follows:
gRNA1：5’-TGCAGCTTCGTTCTCCATGACCGAGTTT-3’(SEQ ID No.15)；
PF2：5’-cagtGGTCTCatgcagcttcgttctccatgaccga-3’(SEQ ID No.7)；
PR2：5’-cagtGGTCTCaaaactcggtcatggagaacgaagc-3’(SEQ ID No.8)；
the sequence of gRNA2 and its adaptor primer PF3/PR3 for Target2 is as follows:
gRNA2：5’-TGCAAGGGACTCCCAGCTTCCTCGGTTT-3’(SEQ ID No.16)
PF3：5’-cagtGGTCTCatgcaagggactcccagcttcctcg-3’(SEQ ID No.9)；
PR3：5’-cagtGGTCTCaaaaccgaggaagctgggagtccct-3’(SEQ ID No.10)。
PF2 and PR2 were dissolved in ddH, respectively 2 O gives a mother liquor having a concentration of 10. Mu.M, 5. Mu.L each of which is added to 40. Mu.L of ddH 2 O, uniformly mixing and reacting, wherein the reaction procedure is as follows: pre-denaturing for 10min at 95 ℃, denaturing for 10min at 55 ℃, and annealing for 5min at 14 ℃ to obtain the gRNA1.
The steps of PF3 and PR3 are the same, thus obtaining gRNA2.
The annealed primer strands were subjected to cleavage ligation, and cleavage ligation systems of gRNA1 and gRNA2 are shown in tables 3 and 4, respectively.
Table 3:
component (A) Volume of
gRNA1 2μL
pYLCRISPR/Cas9 P35s-H plasmid 1.5μL
T4 DNA ligase 0.5μL
10×Buffer 1μL
Eco31I 0.5μL
ddH 2 O 4.5μL
Total amount of 10μL
Table 4:
and (3) respectively carrying out enzyme digestion and connection reaction on the enzyme digestion and connection systems of the gRNA1 and the gRNA2 at 37 ℃ for 2 hours to respectively obtain a connection product 1 and a connection product 2. The ligation product 1 and ligation product 2 were transformed and plasmids were extracted according to step (4) and step (6) in the above examples, respectively, to obtain pYLCRISPR/Cas9-gRNA1 and LB-DNAi/gRNA2, respectively. pYLCRISP R/Cas9-gRNA1 and LB-DNAi/gRNA2 were sent to the Optimago for sequencing.
And carrying out enzyme digestion connection on the pYLCRISPR/Cas9-gRNA1 and LB-DNAi/gRNA2 with correct sequence to obtain a recombinant vector pYLCRISPR/Cas9-OsR 498717707800.01 containing gRNA1 and gRNA2. The reaction system is shown in Table 5.
Table 5:
component (A) Volume of
pYLCRISPR/Cas9-gRNA1 with correct sequencing 1μL
LB-DNAi/gRNA2 with correct sequencing 1.5μL
LguI 0.5μL
T4 DNAligase 0.5μL
10×Buffer 1μL
ddH 2 O 5.5μL
Total amount of 10μL
The reaction system is subjected to enzyme digestion and connection reaction at 37 ℃ for 2 hours, and then a connection product (pYLCRISPR/Cas 9-OsR 4989G0917707800.01) is obtained. The plasmid map of pYLCRISPR/Cas9-OsR 498917707800.01 is shown in FIG. 1.
The ligation products were transformed and positive clones identified as in step (4) and step (5) in the examples above. The primer used for identifying the positive clone is PF4/PR4, and the sequence is specifically as follows:
PF4：5’-GCGATTAAGTTGGGTAACGCCAGGG-3’(SEQ ID No.11)；
PR4：5’-ACCGGTAAGGCGCGCCGTAGT-3’(SEQ ID No.12)；
the reaction procedure is: 3min at 95 ℃;95℃for 30s,55℃for 30s,72℃for 2min,35cycles; and at 72℃for 5min.
The PCR products were run on a 1% agarose gel and samples with a single band of interest of approximately 312bp in size were identified as positive clones.
Plasmids were extracted as in step (5) of the above examples, and the plasmids obtained by extraction were sent to the qinghaos for sequencing.
c. Construction of OsR498G0917707800.01 Gene knockout Rice plants
And c, conveying the pYLCRISPR/Cas9-OsR 49889597000.01 plasmid extracted from the bacterial liquid with correct sequencing in the step b to Wohan remote biotechnology Co., ltd to construct an OsR 49840917707800.01 gene knockout rice plant. The specific construction steps are as follows:
(1) And (3) disinfection: firstly, mechanically removing shells of seeds (X11), screening high-quality embryo-containing rice grains, placing the selected rice grains in a sterilized triangular flask in an ultra-clean workbench, soaking the rice grains in 75% ethanol for 30s, and cleaning the rice grains with sterile water for 1 time. Soaking in 84 disinfectant for 30min, and cleaning with sterile water for 3 times each for 1min; soaking in sterile water for 60min.
(2) Induction: pouring out the sterile water which is used for soaking the seeds finally in the step (1), subpackaging the rice grains on a culture dish containing an induction culture medium by using a spoon, placing 25-30 rice grains on each dish uniformly by using tweezers, sealing a flat plate by using a sealing film, culturing for 4-8d by illumination at 28 ℃, separating the rice grains from the buds by using tweezers, and culturing for 2d after the rice is pulled out, thus obtaining the callus.
(3) Conversion: after pYLCRISPR/Cas9-OsR498G0917707800.01 plasmid is introduced into agrobacterium EHA105, recombinant bacterium EHA105-pYLCRISPR/Cas9-OsR498G0917707800.01 is obtained. Transferring the callus obtained in the step (2) into a sterile triangular flask, and pouring into OD 600 0.1-0.2 of recombinant bacterium EHA105-pYLCRISPR/Cas9-OsR 4988X109707800.01 bacterial liquid, soaking for 10min; the callus is transposed on a sterile filter paper board, and is aired on an ultra-clean workbench for 30min, and is shaken once every 10min to dry the moisture. Transferring the dried callus onto co-culture medium (50-70 pieces/dish), and culturing in a co-incubator at 20deg.C for 48-72 hr. Transferring the callus into a sterile triangular flask, cleaning with sterile water for 6 times, adding cefuroxime axetil (1 g/L) to soak the callus, and shake culturing at 30deg.C and 180rpm for 30min. Then, the callus is washed for 1 time by using cefuroxime water (1 g/L), and then transferred to a sterile filter paper board for 2 hours, and is shaken once every 30 minutes to dry the water.
(4) Screening: transferring the callus which is dried after being washed by the cefuroxime water in the step (3) to a screening culture medium (containing 20mg/L hygromycin) for 20d, and transferring the callus to a new screening culture medium (containing 35mg/L hygromycin); after 30d of culture, calli from which resistant calli developed were selected and transferred to a new screening medium (containing 35mg/L hygromycin) and dark cultured at 30℃for 7d.
(5) Differentiation and rooting: transferring the callus obtained in the step (4) to a sterile filter paper board, placing the sterile filter paper board for 24 hours in a dark place, transferring the callus to a differentiation medium, culturing the callus for 15 days at the temperature of 25-27 ℃ under illumination, obviously turning the callus green and accompanying the emergence of leaf primordia, transferring the callus to a new differentiation medium, and culturing the callus at the high temperature of 28-30 ℃ for 10 days to obtain seedlings. Transferring the seedlings to rooting culture medium, culturing until the seedling height is about 10cm, transplanting to a big basin for normal field management to obtain T 0 And (5) replacing rice.
Identification of OsR498G0917707800.01 Gene knock-out Oryza sativa plants
T constructed in the step c is obtained 0 Rice substituteSelfing to obtain T 1 Extracting T from rice 1 Genomic DNA from leaves of the progeny rice was amplified with the primers PF5/PR5, the product was sequenced in a Prinsepia organism and the sequencing result was compared with the wild-type plant sequence (SEQ ID No. 1) before the transgene. The sequence of the primer PF5/PR5 is specifically as follows:
PF5：5’-CGAGCTATTCCACCCTCCC-3’(SEQ ID No.13)；
PR5：5’-CCCAAGAACTCGACAGGACTAG-3’(SEQ ID No.14)；
the reaction procedure is: 3min at 95 ℃;95℃for 30s,55℃for 30s,72℃for 2min,35cycles; and at 72℃for 5min.
The comparison result is shown in fig. 2.
As can be seen from FIG. 2, T is compared with the wild-type plant sequence (SEQ ID No. 1) 1 In the rice generation (noted as pYLCRISPR/Cas 9-OsR49889717707800.01-1), the site sequence corresponding to Target 1 (SEQ ID No. 5) is one nucleotide less-G, and the site sequence corresponding to Target2 (SEQ ID No. 6) is three nucleotides less-GGA. This shows that OsR498G0917707800.01 gene knock-out rice plants are successfully constructed.
Chalky character identification of OsR498G0917707800.01 gene knock-out rice plants
Wild rice (X11) and OsR498G0917707800.01 identified as correct in the above examples were knocked out into rice plants (T 1 The generation of rice is recorded as: pYLCRISPR/Cas 9-OsR498917707800.01-1) are respectively cultivated to maturity, plant morphology in different periods is observed, grain phenotypes of X11 and OsR498917707800.01 gene knocked-down rice plants are compared, and chalkiness of X11 and OsR498G0917707800.01 gene knocked-down rice plants are measured according to national rice standard GB/T1354-2018.
The plant morphology comparison results are shown in FIG. 3.
As can be seen from FIG. 3, there was no difference in vegetative growth of the OsR498G0917707800.01 knock-out rice plants compared to the wild rice plants.
Grain phenotype comparison is shown in fig. 4, and chalkiness statistics are shown in fig. 5 and 6, respectively.
As can be seen from fig. 4, the osr498g0917707800.01 gene knock-out rice plants had significantly less grain chalkiness than X11. From fig. 5 and 6, compared with X11, the chalk rate of the kernel of the osr498g0917707800.01 gene knockout rice plant did not change significantly, but the chalk level was extremely reduced from 41.33% to 15.65%.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of one of ordinary skill in the art without departing from the spirit of the present invention. Furthermore, embodiments of the invention and features of the embodiments may be combined with each other without conflict.
Sequence listing
<110> Hunan agricultural university
<120> gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1410
<212> DNA
<213> Rice (Oryza sativa L.)
<400> 1
atgaagaaga cggtggttct ctaccccggc ctcgccgtcg gccacctgaa ccccatgatg 60
gagctcgccg acgtcttcct ggaccacggc tacgccgtcg ccgtggcgct catcgacccg 120
tcggtcatgg agaacgaagc caacctcgcc gccgccgtcg cccgcgccgt ctcctccaag 180
agctccacca tctccttcca cacgctcccg ggcatcccgg accctccctc gctcgtcttc 240
aacgatcagt tcttcaagaa ctacttcgac ctcgtgcgac gccacaacga gcacctccac 300
gacttcctcc gctccgtgcg gggcctccat gccgtggtca tcgacgcatc gtgcgcccat 360
gcccatgaag ccgcgaggaa gctgggagtc cctgtcttga tgttctaccc gtccaacgcc 420
ggccacctcg ccgttaactt gcagactcct ctgcttgttg acgggttcaa gaagcatctg 480
ggaggagata gtactagtcc tgtcgagttc ttgggtgttc gacccatgtc ggcttctcac 540
ttggctggcc tttttgggcc gattagcgag gtgaacaagg atttcgaggc catgattttt 600
gccggtgcgc gcatgaacgc ggagttcgac ggaatcctga tcaacacgtc cgtgtcgctg 660
gaggagcggg cgctgcgagc tctcgccgac ccgcgctgct gccccgacgg cgtggtaatc 720
ccgccggtgt acgccgtggg gccactggtc gacaaagccg ccgccgccgc cggtgatgag 780
agcagccgac atcagtgcct cgtgtggctc gacggacaac ccgaccgcag cgtcgtgttc 840
ctctgcttcg ggagcatcgc cgacgcatgt gaacagtccg accagcagct gaaggagatc 900
gccgccggcc tggacaagtc cggccaccgc ttcctgtggg tggttcgggc aaccagcacc 960
caacacctcg acgcgctcct accggaggtg ttcttcgcaa gaaccagcgg ccgcggcctc 1020
gtcgtcaaca gctgggtgcc ccagccgagc atcctccgcc accgcgccac cgccgcgttc 1080
gtgacgcact gcgggtggaa ctcggtgcta gaggggatca ccgcgggggt gccgatgctc 1140
tgctggccgc tgtacgcgga gcagaggatg aacaaggtgc tcatggtgga ggacatgggc 1200
gtcggcgtgg agatggaggg atggctggaa gggctggtga ccgccgagga ggtggagacg 1260
aaggtgaggc tggtcatgga gtccgagcat ggaaggaagg ttagagagcg tgtcgaggcg 1320
cacagagatg gcgtggccat ggcctggaaa gatggtggct cgtcgcgtgt cgcgtttgcc 1380
cgtctcatgt ctgaattgct caacgtgtga 1410
<210> 2
<211> 469
<212> PRT
<213> Rice (Oryza sativa L.)
<400> 2
Met Lys Lys Thr Val Val Leu Tyr Pro Gly Leu Ala Val Gly His Leu
1 5 10 15
Asn Pro Met Met Glu Leu Ala Asp Val Phe Leu Asp His Gly Tyr Ala
20 25 30
Val Ala Val Ala Leu Ile Asp Pro Ser Val Met Glu Asn Glu Ala Asn
35 40 45
Leu Ala Ala Ala Val Ala Arg Ala Val Ser Ser Lys Ser Ser Thr Ile
50 55 60
Ser Phe His Thr Leu Pro Gly Ile Pro Asp Pro Pro Ser Leu Val Phe
65 70 75 80
Asn Asp Gln Phe Phe Lys Asn Tyr Phe Asp Leu Val Arg Arg His Asn
85 90 95
Glu His Leu His Asp Phe Leu Arg Ser Val Arg Gly Leu His Ala Val
100 105 110
Val Ile Asp Ala Ser Cys Ala His Ala His Glu Ala Ala Arg Lys Leu
115 120 125
Gly Val Pro Val Leu Met Phe Tyr Pro Ser Asn Ala Gly His Leu Ala
130 135 140
Val Asn Leu Gln Thr Pro Leu Leu Val Asp Gly Phe Lys Lys His Leu
145 150 155 160
Gly Gly Asp Ser Thr Ser Pro Val Glu Phe Leu Gly Val Arg Pro Met
165 170 175
Ser Ala Ser His Leu Ala Gly Leu Phe Gly Pro Ile Ser Glu Val Asn
180 185 190
Lys Asp Phe Glu Ala Met Ile Phe Ala Gly Ala Arg Met Asn Ala Glu
195 200 205
Phe Asp Gly Ile Leu Ile Asn Thr Ser Val Ser Leu Glu Glu Arg Ala
210 215 220
Leu Arg Ala Leu Ala Asp Pro Arg Cys Cys Pro Asp Gly Val Val Ile
225 230 235 240
Pro Pro Val Tyr Ala Val Gly Pro Leu Val Asp Lys Ala Ala Ala Ala
245 250 255
Ala Gly Asp Glu Ser Ser Arg His Gln Cys Leu Val Trp Leu Asp Gly
260 265 270
Gln Pro Asp Arg Ser Val Val Phe Leu Cys Phe Gly Ser Ile Ala Asp
275 280 285
Ala Cys Glu Gln Ser Asp Gln Gln Leu Lys Glu Ile Ala Ala Gly Leu
290 295 300
Asp Lys Ser Gly His Arg Phe Leu Trp Val Val Arg Ala Thr Ser Thr
305 310 315 320
Gln His Leu Asp Ala Leu Leu Pro Glu Val Phe Phe Ala Arg Thr Ser
325 330 335
Gly Arg Gly Leu Val Val Asn Ser Trp Val Pro Gln Pro Ser Ile Leu
340 345 350
Arg His Arg Ala Thr Ala Ala Phe Val Thr His Cys Gly Trp Asn Ser
355 360 365
Val Leu Glu Gly Ile Thr Ala Gly Val Pro Met Leu Cys Trp Pro Leu
370 375 380
Tyr Ala Glu Gln Arg Met Asn Lys Val Leu Met Val Glu Asp Met Gly
385 390 395 400
Val Gly Val Glu Met Glu Gly Trp Leu Glu Gly Leu Val Thr Ala Glu
405 410 415
Glu Val Glu Thr Lys Val Arg Leu Val Met Glu Ser Glu His Gly Arg
420 425 430
Lys Val Arg Glu Arg Val Glu Ala His Arg Asp Gly Val Ala Met Ala
435 440 445
Trp Lys Asp Gly Gly Ser Ser Arg Val Ala Phe Ala Arg Leu Met Ser
450 455 460
Glu Leu Leu Asn Val
465
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atgaagaaga cggtggttct c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
tcacacgttg agcaattcag a 21
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gcttcgttct ccatgaccga cgg 23
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
agggactccc agcttcctcg cgg 23
<210> 7
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cagtggtctc atgcagcttc gttctccatg accga 35
<210> 8
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cagtggtctc aaaactcggt catggagaac gaagc 35
<210> 9
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cagtggtctc atgcaaggga ctcccagctt cctcg 35
<210> 10
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
cagtggtctc aaaaccgagg aagctgggag tccct 35
<210> 11
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
gcgattaagt tgggtaacgc caggg 25
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
accggtaagg cgcgccgtag t 21
<210> 13
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
cgagctattc caccctccc 19
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
cccaagaact cgacaggact ag 22
<210> 15
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
tgcagcttcg ttctccatga ccgagttt 28
<210> 16
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
tgcaagggac tcccagcttc ctcggttt 28

Claims (4)

1. The application of the protein with the amino acid sequence shown as SEQ ID No.2 in regulating rice chalkiness is characterized in that,
the regulation of rice chalkiness is realized by knocking out genes of proteins in target rice plants through CRISPR/Cas9 technology, so that the reduction of rice chalkiness is realized;
the target sequences in the CRISPR/Cas9 technology are SEQ ID No.5 and SEQ ID No.6.
2. The use of the protein according to claim 1 in any one of (1) to (3), characterized in that:
(1) Application in rice breeding;
(1) The application of the protein gene in rice breeding is specifically that rice with the protein gene knocked out by CRISPR/Cas9 technology is hybridized with other rice to carry out rice breeding; the target sequences in the CRISPR/Cas9 technology are SEQ ID No.5 and SEQ ID No.6;
(2) Application in cultivating chalky rice plants with reduced gene knockout;
(3) The application of the gene knockout rice plant with reduced chalkiness in preparing and cultivating the gene knockout rice plant products with reduced chalkiness;
(2) Or (3) the application is: the CRISPR/Cas9 technology is used for knocking out the gene of the protein in the target rice plant to reduce the chalkiness of the rice; the target sequences in the CRISPR/Cas9 technology are SEQ ID No.5 and SEQ ID No.6.
3. A method for reducing the chalkiness of rice is characterized by comprising the steps of knocking out the gene of the protein with the amino acid sequence shown as SEQ ID No.2 in a target rice plant by using a CRISPR/Cas9 technology to obtain a gene knocked-out rice plant; the chalkiness of the gene knockout rice plants are reduced compared with that of target rice plants;
the target sequences in the CRISPR/Cas9 technology are SEQ ID No.5 and SEQ ID No.6.
4. The method of claim 3, wherein the method is used in (1) or (2),
(1) Application in rice breeding;
(2) The application of the gene knockout rice plants with reduced chalkiness is used for cultivating the gene knockout rice plants with reduced chalkiness.
CN202111503187.3A 2021-12-09 2021-12-09 Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness Active CN114213515B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111503187.3A CN114213515B (en) 2021-12-09 2021-12-09 Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111503187.3A CN114213515B (en) 2021-12-09 2021-12-09 Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness

Publications (2)

Publication Number Publication Date
CN114213515A CN114213515A (en) 2022-03-22
CN114213515B true CN114213515B (en) 2024-03-22

Family

ID=80700691

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111503187.3A Active CN114213515B (en) 2021-12-09 2021-12-09 Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness

Country Status (1)

Country Link
CN (1) CN114213515B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114990153B (en) * 2022-05-19 2024-04-02 湖南农业大学 Application of rice lipid transfer protein in improving rice fatty acid content and reducing rice chalkiness

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016002790A1 (en) * 2014-06-30 2016-01-07 日産化学工業株式会社 Insecticide, miticide, nematicide, molluscicide, disinfectant, or bactericide composition, and pest control method
CN111116725A (en) * 2020-02-20 2020-05-08 中国农业科学院作物科学研究所 Gene Os11g0682000 and application of protein coded by same in regulation and control of bacterial leaf blight resistance of rice
CN112852865A (en) * 2021-02-02 2021-05-28 中国科学院遗传与发育生物学研究所 Oaan-1 protein, coding gene and application of related biological material thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016002790A1 (en) * 2014-06-30 2016-01-07 日産化学工業株式会社 Insecticide, miticide, nematicide, molluscicide, disinfectant, or bactericide composition, and pest control method
CN111116725A (en) * 2020-02-20 2020-05-08 中国农业科学院作物科学研究所 Gene Os11g0682000 and application of protein coded by same in regulation and control of bacterial leaf blight resistance of rice
CN112852865A (en) * 2021-02-02 2021-05-28 中国科学院遗传与发育生物学研究所 Oaan-1 protein, coding gene and application of related biological material thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
hypothetical protein OsI_31813 [Oryza sativa Indica Group];Yu. J et al;《Gene Bank》;第1-3页 *

Also Published As

Publication number Publication date
CN114213515A (en) 2022-03-22

Similar Documents

Publication Publication Date Title
AU2019297209B2 (en) Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant
CN111333707B (en) Plant grain type related protein and coding gene and application thereof
CN112250741B (en) Use of protein derived from rice
CN112250742B (en) Use of proteins and their related biomaterials for modulating mechanical strength in plants
CN113637060B (en) Application of soybean GmSPA3a/3b protein and related biological materials thereof in regulating plant flowering and plant height
CN114369147B (en) Application of BFNE gene in tomato plant type improvement and biological yield improvement
CN113621037B (en) Cucumber CsHEC2 protein and application of encoding gene thereof in reducing fruit thorn tumor density
CN113583099B (en) Method for cultivating alfalfa male sterile line and corresponding maintainer line and related biological material thereof
CN114213515B (en) Gene OsR498G0917707800.01 and application of encoded protein in regulation of rice chalkiness
US11365423B2 (en) Method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants
CN113265403A (en) Soybean Dt1 gene editing site and application thereof
CN110655561B (en) Corn bract length regulating protein ARR8, and coding gene and application thereof
CN109666069B (en) Plant flowering time character related protein AtJAZ5, and coding gene and application thereof
CN114456244B (en) Gene OsR49841018986900.01 and application of encoded protein in regulation of rice chalkiness
CN114958867B (en) Corn ear grain weight and yield regulation gene KWE2, coded protein, functional marker, expression vector and application thereof
CN108690127B (en) Stress-resistance-associated protein TaMYB85 and coding gene and application thereof
CN113481176B (en) Application of GA3ox1 protein in regulating alfalfa plant type
CN116064568A (en) Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants
WO2021047377A1 (en) Application of tpst gene in regulation of traits of plant
CN111961124B (en) Plant precocity protein and coding gene and application thereof
CN111560055B (en) Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat
CN114717241A (en) Rice salt tolerance related gene OsMSRFP and encoding protein and application thereof
CN114292855A (en) PagARR9 gene for regulating and controlling growth of xylem of poplar and application thereof
CN111440231A (en) Application of protein GmFU L a in regulating and controlling plant type and yield of soybean
CN115304662B (en) CsHEC1 protein and application of encoding gene thereof in reducing length of fruit melon handle

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant