CN113265403A - Soybean Dt1 gene editing site and application thereof - Google Patents

Abstract

The invention discloses a soybean Dt1 gene editing site and application thereof. The soybean Dt1 gene editing site of the invention is a DNA sequence of 23 deoxyribonucleotides, and the sequence is as follows: 5'-TGTATGAGAGAAAGAGACGAGGG-3', respectively; the accurate location of the soybean genome is 2029-2051 upstream of the promoter of the Dt1 gene on chromosome 19, and the coordinates of the chromosome are 45178492-45178514. The editing site is an effective target for editing the gene promoter, and double strand breakage is carried out under the mediation of endonuclease Cas9, so that allele mutants with different Dt1 are obtained. The invention provides a new strategy for regulating the expression quantity of Dt1 to change the pod bearing habit and yield of soybeans, also provides a reliable means and material for cultivating new varieties of soybeans and improving the yield of soybeans, and has very important effects on crop research and production.

Description

Soybean Dt1 gene editing site and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a soybean Dt1 gene editing site and application thereof.

Background

The CRISPR/Cas9 gene editing technology has been widely applied to the fields of plant gene function research, crop trait improvement and the like. Liu dazzling professor and its group developed a high-efficiency and simple CRISPR/Cas9 plant polygene editing vector system (Ma et al, 2016), in which through designing multiple guide RNAs (sgRNAs) with different target sequences, Cas9 protein can be targeted to multiple genome sites, and simultaneously polygene editing can be carried out, and also through designing target spots in the promoter or UTR region of the target gene, the promoter or UTR of the target gene can be edited, and the expression quantity of the target gene can be regulated. For example, Hendelman et al found pleiotropic effects of SlWOX9 in vegetative and reproductive development by editing the promoter of the SlWOX9 gene to create different alleles, which was of great significance for the use of genome editing in agriculture (Hendelman et al, 2021).

The pod bearing habit of soybean is a bridge linking the flowering phase of soybean with yield traits (rivastigmine et al, 2016). According to the comprehensive properties such as flowering period length, stem growth state, stem thickness, internode number, leaf size and stem apical podding condition, the soybean variety is divided into 3 types: limited pod bearing habit, sub-limited pod bearing habit and unlimited pod bearing habit (Bernard, 1972). Liu et al cloned gene locus Dt1 for controlling unlimited pod bearing habit for the first time by using a map-based cloning method, Dt1 is encoded by GmTFL1b gene, and the transformation of a genome fragment containing the full length of the GmTFL1b gene and a promoter into a limited soybean can remarkably increase the number of soybean nodes and delay the time of occurrence of a top inflorescence (Liu et al, 2010). Ping et al cloned Dt2, a gene containing the MADS domain, which is responsible for controlling the habit of subcontracting pods, and belongs to the APETALA1/SQUAMOSA (AP1/SQUA) subfamily (Ping et al, 2014) together with AP 1. Dt1 has an epistatic effect on Dt2, Dt1/Dt1 is a finite pod bearing habit, Dt1/Dt 1; dt2/Dt2 is a sub-finite pod habit (both Dt1 and Dt2 are homozygous dominant and are sub-finite), Dt1/Dt 1; dt2/Dt2 is an infinite pod habit (Dt1 is homozygous dominant and Dt2 is homozygous recessive but sub-finite) (Ping et al, 2014). It was speculated from the Dt 2-controlled soybean phenotype that Dt2 may not function similarly to the AP1 gene in arabidopsis thaliana, inhibiting expression of TFL1 in FMs and Dt2 may inhibit expression of Dt1 in Soybean Apical Meristems (SAMs), converting SAMs of soybean into reproductive inflorescences (Ping et al, 2014).

Recently, Chen et al knocked out four homologous genes (AP1a, AP1b, AP1c and AP1d) of soybean AP1 gene simultaneously by CRISPR/Cas9 technology, and obtain homozygous four mutants of AP1a AP1b AP1c AP1 d. Phenotypic analysis results demonstrated an increase in the number of main nodes following ap1 mutation. Further studies have shown that the AP1 gene controls the development and formation of the number of main nodes by inhibiting the expression of Dt1 (Chen et al, 2020). In addition, Yue et al found that Dt1/FT5a/FDc1-AP1-Dt1 negative feedback competition inhibition loops exist in soybeans to control the development of soybean main stalk counts (Yue et al, 2021). The new findings enable us to more deeply recognize the role of Dt1 in regulating and controlling the pod bearing habit of soybeans, thereby laying a theoretical foundation for improving the adaptability and yield of the soybeans; meanwhile, the method provides possibility for molecular design breeding and improvement of yield traits of soybean single plants by utilizing natural variation of the Dt1 gene. However, no studies have been reported so far on editing the promoter of Dt1 by CRISPR/Cas9 technology to change the expression level of Dt1, and thus change the pod bearing habit and yield traits of soybean.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a soybean Dt1 gene editing site.

The invention also aims to provide application of the soybean Dt1 gene editing site.

It is a further object of the present invention to provide a method for breeding Dt1 mutant improved soybean varieties with improved pod bearing habit and yield.

The purpose of the invention is realized by the following technical scheme: a soybean Dt1 gene editing site is a DNA sequence of 23 deoxyribonucleotides, and the sequence is as follows: 5'-TGTATGAGAGAAAGAGACGAGGG-3' (SEQ ID NO. 1); the accurate location of the locus in the soybean genome is 2029-2051 at the upstream of the Dt1 gene promoter of chromosome 19, and the coordinates of the locus are 45178492-45178514 (FIG. 1).

The editing sites are edited aiming at the promoter of the Dt1 gene so as to change the expression quantity of Dt1 and further change the pod bearing habit and yield character of the soybean.

The 3' end of the soybean Dt1 gene editing site contains GGG, and through complementary pairing of sgRNA and DNA base near a genome PAM site, Cas9 endonuclease is mediated to recognize a genome in a targeted manner and double strand break of the genome DNA is realized, so that a DNA damage repair mechanism is induced, nucleotide pairs are introduced or deleted randomly in the repair process, the target nucleotide pair is deleted or inserted, and mutation near the target is caused.

A recombinant expression vector, a recombinant gene cell line or a recombinant bacterium containing the soybean Dt1 gene editing site.

The expression vector adopted by the recombinant expression vector is pYLCRISPR/Cas 9.

The recombinant strain adopts agrobacterium rhizogenes.

The recombinant expression vector is obtained by connecting a sgRNA vector and the soybean Dt1 gene editing site of claim 1 after being subjected to enzyme digestion by Bsa I, and connecting the obtained sgRNA expression cassette and a pYLCRISPR/Cas9 vector after being subjected to enzyme digestion by Bsa I.

The sgRNA vector is pYLgRNA-AtU3 d.

Use of the soybean Dt1 gene editing site described above for altering the pod bearing habit and yield of soybean.

A method for cultivating a Dt1 mutant soybean variety with improved pod bearing habit and yield comprises the following steps:

(1) synthesizing sgRNA according to the sequence of the soybean Dt1 gene editing site shown in SEQ ID NO. 1;

(2) adding a base GTCA at the 5 'end of the sgRNA to obtain a nucleotide sequence shown as SEQ ID No.2, carrying out reverse complementation on the nucleotide sequence to obtain a reverse sequence of the sgRNA, and adding a base AAAC at the 5' end of the sgRNA to obtain a nucleotide sequence shown as SEQ ID No. 3; annealing SEQ ID NO.2 and SEQ ID NO.3 to form double-stranded DNA;

(3) constructing an sgRNA expression cassette: connecting the double-stranded DNA formed in the step (2) to the sgRNA vector;

(4) connecting the expression vector with the sgRNA expression cassette in the step (3) to obtain a Cas9 sgRNA recombinant expression vector;

(5) transforming the Cas9 sgRNA recombinant expression vector in the step (4) to agrobacterium rhizogenes and infecting soybean cotyledons;

(6) screening the herbicide to obtain transgenic plants.

The sgRNA vector in the step (3) is pYLgRNA-AtU3 d;

the expression vector in the step (4) is pYLCRISPR/Cas 9;

digesting the double-stranded DNA and the sgRNA vector in the step (3), the expression vector and the sgRNA expression cassette in the step (4) by Bsa I;

the agrobacterium rhizogenes in the step (5) is preferably K599.

The herbicide adopted for screening the transgenic line in the step (6) is preferably Basta.

Compared with the prior art, the invention has the following beneficial effects:

the editing site of the Dt1 gene provided by the invention is an effective target for editing the promoter of the gene, can edit the promoter of the Dt1 gene, and performs double-strand break under the mediation of endonuclease Cas9, thereby obtaining allelic mutants with different Dt 1. The invention provides a new strategy for regulating the expression quantity of Dt1 to change the pod bearing habit and yield of soybeans, also provides a reliable means and material for cultivating new varieties of soybeans and improving the yield of soybeans, and has very important effects on crop research and production.

Drawings

FIG. 1 is a schematic diagram showing the position of the editing site (2029-2051 gene upstream) on the soybean genome.

Fig. 2 is a schematic diagram of a Cas9 sgRNA expression vector inserted with an editing site T1, the Cas9 sgRNA expression vector uses a pYLRISPR/Cas 9 vector as a framework, and is an expression vector with a herbicide gene (Bar), a Cas9 gene, a AtU3d promoter, a target point T1 and sgRNA.

FIG. 3 is an electrophoretogram during construction of a knock-out vector; wherein, A is a first round PCR product amplified by the sgRNA expression cassette, B is a second round PCR product amplified by the sgRNA expression cassette, and C is a colony PCR product electrophoresis picture of escherichia coli DH 10B; m is 2kb DNA ladder.

FIG. 4 is a diagram showing the editing effect of the target point for detecting transgenic hairy roots; wherein, A is an electrophoresis picture of a PCR product of an agrobacterium K599 colony, B is a hairy root grown after the agrobacterium infects soybean cotyledon and is cultured for 15 days, C is an electrophoresis picture of a Cas9 product amplified by hairy root DNA, D is a product of a transgenic hairy root amplified by a target detection primer, and E is an editing result of the target; m is a 2kb ladder DNA marker.

FIG. 5 shows different allelic variants and their sequencing results; wherein, A and C are plants with single base insertion and sequencing results thereof, B and D are plants with deletion of 28bp and insertion of 17bp and sequencing results thereof; in FIGS. C and D W82 is control plant Williams 82.

Detailed Description

The technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention and the accompanying drawings. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention.

Unless specifically stated or defined otherwise, scientific and technical terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention belongs, regardless of ambiguity.

Example 1 construction of Cas9 sgRNA expression vector CLY2 inserted with Dt1 gene promoter editing target site T1

(1) Major reagents and sources

Coli competent cell e.coli DH10b, agrobacterium rhizogenes strain K599, all purchased from holo-type gold; the sgRNA vectors pYLgRNA-AtU3d and pYLCRISPR/Cas9 vectors (both disclosed in "A robust CRISPR/Cas9System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants") were provided by the professor Liudazzling light laboratory, university of agriculture, south China. BsaI restriction enzyme, T4 DNA ligase, Master Taq mix were purchased from TaKaRa; the PCR product recovery kit is purchased from the holo-type gold company; the plasmid extraction kit is purchased from holo-type gold company; other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50. mu.g/mL), spectinomycin (Spec, 100. mu.g/mL), rifampicin (Rif, 50. mu.g/mL) and the like are all domestic analytical pure reagents, and primer synthesis and sequencing are completed by Tianyihuiyuan company.

Target primer:

T1F:5’-gtcaTGTATGAGAGAAAGAGACGA-3’(SEQ ID NO.2)；

T1R:5’-aaacTCGTCTCTTTCTCTCATACA-3’(SEQ ID NO.3)。

the primers for the first round of PCR were:

U-F：5’-CTCCGTTTTACCTGTGGAATCG-3’(SEQ ID NO.4)；

gRNA-R：5’-CGGAGGAAAATTCCATCCAC-3’(SEQ ID NO.5)。

the primers for the second round of PCR were:

B1F:5’-TTCAGAGGTCTCTctcgACTAGTGGAATCGGCAGCAAAGG-3’(SEQ ID NO.6)；

BLR:5’-AGCGTGGGTCTCGaccgACGCGTCCATCCACTCCAAGCTC-3’(SEQ ID NO.7)。

vector sequencing primer

SP3F:5’-TGCAATAACTTCGTATAGGCT-3’(SEQ ID NO.8)；

SP1R:5’-GTCGTGCTCCACATGTTGACC-3’(SEQ ID NO.9)。

(2) Procedure for the preparation of the

The first step is as follows: the target primer is annealed to double strands.

Adding the forward primer and the reverse primer into 0.5 × TE to mix to 100 μmol/L, respectively adding 1 μ L of the forward primer and the reverse primer into a PCR tube, adding 98 μ L of sterile water to 100 μ L, setting the PCR program to be 90 ℃ for 30s, and cooling and annealing at room temperature to obtain the double-stranded DNA.

The second step is that: the double-stranded DNA is connected with the gRNA expression cassette by enzyme digestion.

10 μ L of the enzyme digestion ligation reaction system: mu.L of 10 ng/. mu.L sgRNA vector, 0.5. mu.L of 100. mu. mol/L double-stranded DNA, 0.5. mu.L Bsa I (10U/. mu.L), 0.2. mu. L T4 DNA ligase, 1. mu.L of 10 XNEB T4 DNA ligase Buffer, 1. mu.L of 10 XNEB Cut Smart Buffer, 4.8. mu.L sterile water. The PCR program was set up as follows: 5 cycles: 5min at 37 ℃ and 5min at 20 ℃.

The third step: 2 PCR rounds.

First round of PCR, amplification of gRNA expression cassette, 15 μ L PCR reaction: 2 μ L of the PCR product of the second step, 7.5 μ L Master Taq mix, 10 μmol/L U-F0.2 μ L, 10 μmol/L gRNA-R0.2 μ L, ddH₂O make up to 15. mu.L. The PCR program was set up as follows: 2min at 95 ℃; 10 cycles: 95 ℃ for 15s, 55 ℃ for 15s, and 72 ℃ for 10 s; 25 cycles: 95 ℃ for 15s, 60 ℃ for 15s and 72 ℃ for 10 s. Add 3. mu.L of PCR product into a sterile centrifuge tube, add 6. mu.L of sterile water, 1. mu.L of 10 × loading buffer, perform 1% agarose gel electrophoresis, and check whether the gel electrophoresis image has a target band of about 500bp (FIG. 3A).

In the second round of PCR, the universal primer B1F/BLR with specific position is used for amplification to obtain a complete expression cassette target with a specific joint, wherein the complete expression cassette target comprises a promoter, a target point and sgRNA. mu.L of the first round PCR product was added to 8. mu.L of sterile water, mixed and diluted 10 times, and 1. mu.L was used as a template for the second round PCR. 20 μ L of reaction system: mu.L Master Taq mixQ, 0.15. mu.L of each primer, 1. mu.L of the first round PCR product diluent, and sterile water to make up to 20. mu.L. The PCR reaction program was set up as follows: 95 ℃ for 2min, 35 cycles: 95 ℃ for 10s, 58 ℃ for 15s and 72 ℃ for 20 s. mu.L of the PCR product was subjected to 1% agarose gel electrophoresis, and a 500bp band was checked by a gel imager (FIG. 3B). Gel recovery was performed according to the procedure on the gel recovery kit, and the concentration of the recovered DNA fragment was detected with a DNA concentration detector.

The fourth step: the sgRNA expression cassette was linked to pYLCRISPR/Cas9 vector to obtain Cas9 sgRNA expression vector (FIG. 2)

15 μ L reaction: 1.5 mu L of Cut Smart Buffer, 0.5 mu L of pYLCRISPR/Cas9 plasmid, 1 mu L of BsaI, 4 mu L of the purified product of the previous step (the concentration is 60-70 ng/. mu.L), 0.2 mu L of T4 DNA ligase, 1.5 mu L of 10 XNEB T4 DNA ligase Buffer, 1.5 mu L of 10 XNEB Cut Smart Buffer, and sterile water is added to make up to 15 mu L. The PCR program was set up as follows: 5min at 37 ℃, 5min at 10 ℃, 5min at 20 ℃, 5min at 37 ℃ and 15 cycles.

The fifth step: conversion of ligation products

Coli DH10b competent cells were thawed on ice for 5 minutes, and 10. mu.L of the expression vector obtained in the previous step was added thereto, and mixed well by gentle flicking. After ice-bath for 30min, the mixture is put into a 42 ℃ water bath kettle to be thermally shocked for 1min and then immediately ice-bath for 2 min. Adding 500 μ L LB culture solution without antibiotic into a clean bench, culturing for 1 hr at 37 deg.C under 220rpm oscillation, centrifuging at 5000rpm for 1min, pouring out part of supernatant, sucking out heavy suspension liquid, uniformly coating on LB solid culture medium containing spectinomycin, and placing in 37 deg.C incubator overnight. Single bacterial clones were picked and PCR-tested using primers SP3F, SP1R (FIG. 3C), and positive clones were sent for one day long-range sequencing.

Example 2 detection of Soybean transgenic hairy root target editing Effect

(1) Major reagents and sources

The experiment extracts hair root DNA from cultivated soybean W82(Glycine max Wm82.a2.v 1). Agrobacterium rhizogenes competent cell K599 was purchased from holo-type gold; the plasmid extraction kit is purchased from holo-type gold company; the totipotent plant genome DNA extraction kit is purchased from Kangjieki, a century company; germination culture medium: agave nutrient solution (Coolaber), 0.8% agar, 2% sucrose, pH 5.8; hairy root induction culture medium: hoagland nutrient solution (Coolaber), 2% of sucrose, 0.8% of agar, 0.6g of MES, 500mg/L of carbenicillin, 5mg/L of herbicide Basta, and pH of 5.8. Other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50. mu.g/mL), spectinomycin (Spec, 100. mu.g/mL), rifampicin (Rif, 50. mu.g/mL) and the like are all domestic analytical pure reagents, and primer synthesis and sequencing are completed by Tianyihuiyuan company.

Primers for Cas9 were:

Cas9-F：5’-CAACACCGACCGCCACTC-3’(SEQ ID NO.10)；

Cas9-R：5’-TGCCGCTCTGCTTATCCC-3’(SEQ ID NO.11)。

the primers for target detection are as follows:

JCF:5’-GCATACTCGGCAATTTAATGAGG-3’(SEQ ID NO.12)；

JCR:5’-TGCCTTGCGTAGAGAACCTT-3’(SEQ ID NO.13)。

(2) procedure for the preparation of the

The first step is as follows: k599 Agrobacterium transformation.

Example 1 correctly positive clones were sequenced for plasmid extraction. Adding 0.1 μ g of positive plasmid into 50 μ L of Agrobacterium infected cells K599, mixing, ice-cooling for 30min, freezing in liquid nitrogen for 1min, heat-shocking in 37 deg.C water bath for 5min, and cooling on ice for 2 min. Inoculating the bacterial liquid into 500 μ L YEP culture medium, shake culturing at 28 deg.C and 220rpm for 2h, centrifuging for 1min, uniformly coating suspension cells on YEP culture medium containing kanamycin, spectinomycin, and rifampicin antibiotic, and performing inversion culture at 28 deg.C for 36 h. Colony PCR was performed with primers SP3F, SP1R, 10 μ L reaction: mu.L Master Taq mix, 0.2. mu.L each of primers, 3.6. mu.L sterile water, and 1. mu.L of bacterial suspension. The PCR program was set up as follows: 2min at 95 ℃; 35 cycles: 30s at 95 ℃, 30s at 58 ℃ and 90s at 72 ℃; 72 ℃ for 2 min. The gel was subjected to 1% agarose gel electrophoresis, and the presence of the desired band of about 2000bp was examined by a gel imaging system (FIG. 4A).

The second step is that: infecting soybean cotyledons.

Selecting full and uniform soybean Willam82 seeds with no seed coat crack, and adding 10% H₂O₂The seed surface was sterilized for 1min and then rinsed clean with sterile deionized water. The sterilized seeds were sown in germination medium and cultured in a soybean phytotron for 5 days until cotyledons were raised approximately at right angles to the hypocotyls. The agrobacterium rhizogenes K599 containing the objective plasmid obtained in the first step is placed in an incubator and cultured at 28 ℃ until the OD becomes about 0.6. Using a scalpel to dip bacteria liquid to scratch the front side of the soybean cotyledon in a grid shape, placing the treated cotyledon on a root induction culture medium, and culturing for about 15 days at 25 ℃ under illumination, wherein hairy roots grow out (figure 4B).

The third step: and detecting the editing effect of the target spot.

According to the steps of the DNA extraction kit, the transgenic hairy roots obtained in every 3 second steps are mixed into a sample for DNA extraction. Using the extracted hairy root DNA as a template, respectively amplifying fragments of the region of the target by using a CAS9 primer and a target detection primer, wherein a PCR reaction system comprises the following components: 5 μ L Master Taq mix, 0.2 μ L each of forward and reverse primers, 0.5 μ L DNA template, ddH₂O make up to 10. mu.L. The PCR procedure was: 94 ℃ for 2 min; 35 cyclesAnd (3) ring: 30s at 95 ℃, 30s at 59 ℃ and 1min at 72 ℃; finally 5min at 72 ℃. The amplified product (fig. 4D) of the target detection primer corresponding to the hairy root with CAS9PCR (fig. 4C) is sent to tianyihuiyuan company for sequencing, sequencing data is checked by using the BioEdit software, the editing effect (fig. 4E) of the target is checked by the sequencing result of the target site, the sequencing result shows that the target site is bimodal from the rear, which indicates that the target site can effectively edit the promoter of the gene, and the editing efficiency of the target site is 56%.

Example 3 acquisition of transgenic homozygous mutants of Soybean

(1) Major reagents and sources

The transformed explant of this experiment was the cultivated soybean williams 82(W82, Glycine max wm82.a2.v 1). Agrobacterium tumefaciens strain EHA101 was purchased from holo-type gold; the plasmid extraction kit is purchased from holo-type gold company; the totipotent plant genome DNA extraction kit is purchased from Kangjieki, a century company; germination culture medium: agave nutrient solution (Coolaber), 0.8% agar, 2% sucrose, pH 5.8. Co-culture nutrient medium: hoagland broth (Coolaber), 0.5% BBL agar, 3% sucrose, 1mg/mL BAP, 1mg/mL GA3, 0.4mg/mL cysteine amine, 0.154mg/mL dithiothreitol, pH 5.8. Bud induction medium: hoagland nutrient solution, 3 percent of cane sugar, 0.8 percent of agar, 0.6g of MES, 1mg/mL of BAP, 500mg/L of carbenicillin and 5mg/L of herbicide, wherein the pH value is 5.8. Stem elongation medium: hoagland nutrient solution, 3 percent of cane sugar, 0.8 percent of agar, 0.6g of MES, 500mg/L of carbenicillin, 5mg/L of herbicide, pH 5.8, 1mg/mL of IAA, 1mg/mL of GA3 and 1mg/mL of Zeatin Zeatin-R. Rooting culture medium: hoagland nutrient solution, 3% of cane sugar, 0.8% of agar, 0.6g of MES, 0.5mg/mL of NAA and pH value of 5.8. Other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50. mu.g/mL), spectinomycin (Spec, 100. mu.g/mL), rifampicin (Rif, 50. mu.g/mL) and the like are all domestic analytical pure reagents, and primer synthesis and sequencing are completed by Tianyihuiyuan company.

(2) Procedure for the preparation of the

1) Seed germination: drying soybean seeds with smooth and undamaged surfaces in chlorine gas, sterilizing the surfaces for 16 hours, taking out, placing in an ultra-clean workbench, blowing for 30min to remove the chlorine gas, then sowing on a germination culture medium, and culturing for 3 days at 28 ℃ by illumination.

2) Preparing agrobacterium liquid: a single clone (Agrobacterium rhizogenes K599 containing the objective plasmid obtained in example 2) was picked from a fresh YEP plate, and placed in 2mL of YEP liquid medium containing kanamycin, spectinomycin, and rifampicin antibiotic, and cultured overnight with shaking, and 2mL of saturated bacterial liquid was taken from the culture in 250mL of YEP liquid containing kanamycin, spectinomycin, and rifampicin antibiotic, and shaken overnight at 28 ℃ to collect colonies by centrifugation, and the bacterial liquid was suspended in CM liquid until OD650 was 1.0(EHA 101).

3) Co-culturing: pouring the bacterial liquid into a culture dish, cutting off germinated seeds by using a scalpel, vertically splitting beans along the hypocotyl of cotyledons, removing buds on the hypocotyl, and cutting 7-8 cuts in the cotyledonary node area in a manner of being vertical to the axis; placing the cut explants in a culture dish with a suspension bacterium solution for 30 minutes of infection, transferring the explants to a co-culture nutrient medium by using forceps, cutting downwards, sealing, and performing dark culture in an incubator for 3 days.

4) And (3) shoot induction: after 3 days of co-culture, the explants are placed on a bud induction culture medium to grow for 14 days, then cotyledonary node hypocotyls are cut at the same level at the cotyledonary node parts, newly exposed wounds are inserted into a new bud induction culture medium, and the culture is continued for 14 days.

5) And (3) sprout growth: cotyledons were excised from the differentiated explants and a new incision was made at the base of the node, then the explants were transferred to stem elongation medium and grown in the culture chamber for 2-8 weeks with new medium being changed every two weeks, each time with a fresh horizontal incision at the base of the explant.

6) Rooting: when the sprouts grow to 3cm long, they are cut off from the tissue and then transferred to a culture flask containing a rooting medium for culture, after 2 weeks, when enough seedlings grow, they are transferred to a substrate for culture in an incubator for 4 weeks, and then the seedlings are transferred to a greenhouse for culture until pod setting.

7) Detection of transgenic plants:

screening herbicides: one of the three fully-expanded compound leaves is selected from the transgenic plants, one half of the three fully-expanded compound leaves is marked by a marking pen, and the other half of the three fully-expanded compound leaves is dipped by a cotton swab and diluted herbicide Basta and smeared on the front surface of the leaves for 2-3 days, and then the change of the leaves is observed. If the leaves are green, yellow, withered or colored spots are generated, the plants are not resistant to the herbicide and are negative non-transgenic materials; if the leaves are not changed, the plants are indicated to have herbicide resistance and are possibly positive plants.

Identification of transgenic plants: herbicide resistant T₀After harvesting seeds for plants, performing T₁Generation and multiplication of seeds, T₁And (3) coating herbicide on the generation seedlings through leaves, and screening to obtain two herbicide-resistant separate strains, wherein the editing condition of the plants without herbicide resistance is mainly detected. Collecting new leaves to extract DNA, carrying out PCR identification by using SP3F and SP1R primers, carrying out PCR on negative plants by using target detection primers, and sending PCR products to sequencing to detect the editing condition of the target. The results of the tests showed that two allelic homozygous mutants without cas9 backbone were obtained, one with a single base G insertion at the target (FIG. 5A), the corresponding plants are shown in FIG. 5C, the other with a deletion of 28bp GCATGTATGAGAGAAGAGACGAGGTT at the target and an insertion of 17bp TTATATATAGTTATACATA (FIG. 5B), and the corresponding plants are shown in FIG. 5D.

While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.

Sequence listing

<110> Guangzhou university

<120> soybean Dt1 gene editing site and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Dt1 Gene editing site

<400> 1

tgtatgagag aaagagacga ggg 23

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> T1F

<400> 2

gtcatgtatg agagaaagag acga 24

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> T1R

<400> 3

aaactcgtct ctttctctca taca 24

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> U-F

<400> 4

ctccgtttta cctgtggaat cg 22

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> gRNA-R

<400> 5

cggaggaaaa ttccatccac 20

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> B1F

<400> 6

ttcagaggtc tctctcgact agtggaatcg gcagcaaagg 40

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BLR

<400> 7

agcgtgggtc tcgaccgacg cgtccatcca ctccaagctc 40

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> SP3F

<400> 8

tgcaataact tcgtataggc t 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> SP1R

<400> 9

gtcgtgctcc acatgttgac c 21

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Cas9-F

<400> 10

caacaccgac cgccactc 18

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Cas9-R

<400> 11

tgccgctctg cttatccc 18

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> JCF

<400> 12

gcatactcgg caatttaatg agg 23

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> JCR

<400> 13

tgccttgcgt agagaacctt 20

<210> 14

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> deletion of fragments at the target of the mutant

<400> 14

gcatgtatga gagaaagaga cgagggtt 28

<210> 15

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> insertion of the mutant at the target site

<400> 15

ttatatagtt atacata 17

Claims (8)

1. A soybean Dt1 gene editing site, wherein the editing site is a DNA sequence of 23 deoxyribonucleotides, and the sequence is as follows: 5'-TGTATGAGAGAAAGAGACGAGGG-3', respectively; the accurate location of the locus in the soybean genome is 2029-2051 at the upstream of the Dt1 gene promoter of chromosome 19, and the coordinates of the locus are 45178492-45178514.

2. The soybean Dt1 gene editing site of claim 2, wherein the soybean Dt1 gene editing site contains GGG at the 3' end, and the GGG mediates the targeting recognition of the genome by the Cas9 endonuclease and realizes the double strand break of the genome DNA through the base complementary pairing of sgRNA and DNA near the PAM site of the genome, induces a DNA damage repair mechanism, randomly introduces or deletes nucleotide pairs in the repair process, leads to the deletion or insertion of the target nucleotide pairs, and causes the mutation near the target.

3. A recombinant expression vector, a recombinant gene cell line or a recombinant bacterium comprising the soybean Dt1 gene editing site according to claim 1.

4. The recombinant expression vector of claim 3, wherein the expression vector adopted by the recombinant expression vector is pYLCISPR/Cas 9; the recombinant strain adopts agrobacterium rhizogenes.

5. The recombinant expression vector of claim 4, wherein the recombinant expression vector is obtained by digesting and connecting a sgRNA vector with the soybean Dt1 gene editing site of claim 1 by BsaI, and the sgRNA expression cassette is obtained by digesting and connecting a pYLCISPR/Cas 9 vector by BsaI;

the sgRNA vector is pYLgRNA-AtU3 d.

6. Use of the soybean Dt1 gene editing site of claim 1 for altering the pod bearing habit and yield of soybean.

7. A method for cultivating a Dt1 mutant soybean variety with improved pod bearing habit and yield is characterized by comprising the following steps:

(1) synthesizing sgRNA according to the sequence of the soybean Dt1 gene editing site shown in SEQ ID NO. 1;

(2) adding a base GTCA at the 5 'end of the sgRNA to obtain a nucleotide sequence shown as SEQ ID No.2, carrying out reverse complementation on the nucleotide sequence to obtain a reverse sequence of the sgRNA, and adding a base AAAC at the 5' end of the sgRNA to obtain a nucleotide sequence shown as SEQ ID No. 3; annealing SEQ ID NO.2 and SEQ ID NO.3 to form double-stranded DNA;

(3) constructing an sgRNA expression cassette: connecting the double-stranded DNA formed in the step (2) to the sgRNA vector;

(4) connecting the expression vector with the sgRNA expression cassette in the step (3) to obtain a Cas9 sgRNA recombinant expression vector;

(5) transforming the Cas9 sgRNA recombinant expression vector in the step (4) to agrobacterium rhizogenes and infecting soybean cotyledons;

(6) screening the herbicide to obtain transgenic plants.

8. The cultivation method as claimed in claim 7,

the sgRNA vector in the step (3) is pYLgRNA-AtU3 d;

the expression vector in the step (4) is pYLCRISPR/Cas 9;

digesting the double-stranded DNA and the sgRNA vector in the step (3), the expression vector and the sgRNA expression cassette in the step (4) by Bsa I;

the agrobacterium rhizogenes in the step (5) is K599;

the herbicide adopted for screening the transgenic line in the step (6) is Basta.

Images