CN114480427A

CN114480427A - Editing site of soybean NLP gene and application thereof

Info

Publication number: CN114480427A
Application number: CN202210180054.5A
Authority: CN
Inventors: 孔凡江; 廖春梅; 陈丽玉; 杨涔
Original assignee: Guangzhou University
Current assignee: Guangzhou University
Priority date: 2022-02-25
Filing date: 2022-02-25
Publication date: 2022-05-13

Abstract

The invention discloses an editing site of a soybean NLP gene and application thereof, belonging to the technical field of biology. The soybean NLP gene editing sites comprise 5 gene editing sites which are respectively SEQ ID NO: 1-2, SEQ ID NO: 4-6, the gene editing site is an effective target for editing NLP4a/b and NLP5a/b genes, and double strand break can be carried out under the mediation of endonuclease Cas9, so that allele mutants with different NLP4a/b and NLP5a/b genes are obtained. The invention provides a new strategy for creating GmNLP4a/b and GmNLP5a/b gene mutants to research the nodulation character of the soybean, and also provides a reliable means for breeding new soybean varieties.

Description

Editing site of soybean NLP gene and application thereof

Technical Field

The invention relates to the technical field of biology, and relates to an editing site of a soybean NLP gene, in particular to a soybean GmNLP4a/b and GmNLP5a/b gene editing site and application thereof.

Background

Nitrogen is an essential macroelement in plants, is an essential component of protein and nucleotide, influences the metabolic process and growth and development of plants in various aspects, and is the basis of plant life activities. The pathway for obtaining nitrogen from plants mainly comprises N in the atmosphere₂Fixation of (C), absorption of N in the soil, etc. (thread)Strong, etc. 2007). Although the air contains about 78.1% N₂However, plants cannot be directly absorbed and utilized, and nitrogen in soil is limited, so that the nitrogen requirement of plants cannot be met. For this reason, chemical nitrogen fertilizers are used in large quantities to increase the yield of plants. The production and transportation costs of nitrogen fertilizers are expensive, and with the increase of the usage amount of nitrogen fertilizers, a series of environmental problems are caused, including nitrogen enrichment pollution phenomena of water, atmosphere, soil and even the whole ecological system, which seriously damage the ecological chemical cycle of the earth and affect human health (land swallow, etc., 2014). Biological nitrogen fixation, especially symbiotic nitrogen fixation of leguminous plants and rhizobia is one of the most effective ways to fix nitrogen in nature with highest nitrogen fixation efficiency (Roxipeng et al, 2019), reduce dependence on chemical nitrogen fertilizers and increase plant yield.

Soybean (Glycine max (L.) Merr.) is one of the important food crops in China, contains rich nutritional ingredients such as protein, grease, isoflavone and the like, and has important nutritional value for human (liaote, 2020). At present, the soybean yield in China is far less than the market demand, and as of 2019, the total imported soybean amount in China accounts for 84% of the total demand (in Ranunculus, 2021), and the expansion of the production demand gap makes the import demand more strong, which is extremely unfavorable for the development of the soybean industry in China. Therefore, the method has profound significance for the soybean industry in China by digging related genes of soybean nodulation, clearing related mechanisms of the nodulation and utilizing molecular assisted breeding to culture high-quality soybean varieties.

Root nodule formation includes rhizosphere invasion, root hair cell deformation curling, formation of invasion lines its (infection threads), root nodule primordium, root nodule formation (Suzaki et al, 2014). Rhizobium is able to synthesize and secrete an oligosaccharide signaling molecule called nodulation factor (NOD) which triggers signaling pathways in the host plant, thereby activating downstream transcription factors including nodulation initiation factor NIN, ethylene response factor ERN1 required for nodulation, and two GRAS protein nodulation signaling pathway transcription factors NSP1 and NSP2(Schauser et al, 1999; Yasuyuki et al, 2017; Liu et al, 2021; Smit et al, 2005; Kalo et al, 2005). These transcription factors activate nodulation gene expression to initiate invasion and root nodule primordia formation.

The first discovery of the NIN (nodelementapart) gene in Lotus corniculatus (L.japonicum) by Schauser et al (1999) was that NIN protein is a transcription regulator of a gene required for root nodule development. Early nodule development depends on the function of the NIN gene, which is responsible for the formation of rhizobial ITs and the initiation of primordial cells. Recent studies by the Giles Oldroyd team of Royal, UK have found that NIN regulates the late stages of nodulation through proteolysis of the signal peptidase complex (Feng et al, 2021). NLP (NIN-like protein) homologous to NIN has been found to play an important role in the nodulation signaling pathway (Loren et al, 2009; Marchive et al, 2013; Nishida et al, 2018). NLPs contain 3 conserved domains, an amino-terminal nitrate signal-responsive domain, an intermediate RWP-RK domain and a carboxy-terminal PB1 domain (Schauser et al, 2005; Konishi et al, 2014).

In Arabidopsis (Arabidopsis) 9 NLP proteins were found, all of which could bind to nitrate-responsive elements (NREs) present in NIR1 gene promoters of different plants and other nitrate-induced genes, and NLPs interact with NREs to activate the expression of nitrate-responsive genes (Konishi et al, 2011; Konishi et al, 2013; Wang at al, 2009). Mutations in atllp 7 resulted in a significant decrease in the expression levels of some nitrate-induced genes and reduced effects of nitrate-dependent growth (Loren et al, 2009; marchie et al, 2013). Yan et al (2016) in Arabidopsis studies show that NLP8 is a key factor responding to nitrate signals in the seed germination process, and NLP8 responds to the nitrate signals to promote the seed germination and directly activate the expression of ABA catabolic enzyme CYP707A 2. In Lotus corniculatus NRSYM1/LjNLP4 and NRSYM2/LjNLP1 have overlapping functions in nitrate-induced nodulation control and act as major regulators of nitrate-responsive genes (Nishida et al, 2021). The thank-seng topic group emphasizes the core role of NLPs in mediating nitrate inhibition of nodulation in Medicago truncatula (Medicago truncatula), the mutation or the expression quantity reduction of NLP gene can relieve the inhibition of nitrate on infection, nodulation and nitrogen fixation, and NIN and NLP can interact through a PB1 structural domain; MtNLP1 mediates nitrate inhibition of nodulation via the SUNN-CRA2 pathway (Lin et al, 2018; Luo et al, 2021). Recent studies by the Jeremy Murray team have also found that MtNIN and MtNLP2 can directly activate expression of leghemoglobin genes by binding to their promoter elements (Jiang et al, 2021). In maize, ZmNLP5 directly regulates the expression of zmnir1.1 by binding to a nitrate response element at the 5' UTR of the gene, and is involved in the response to nitrogen (Ge et al, 2020). In rice, OsNLP4 coordinates nitrogen absorption, assimilation, and signal transduction, and plays a key regulatory role in nitrogen utilization efficiency (Wu et al, 2020).

GmNINA/GmNIN1a have been found in soybean as transcriptional activators of miR172c, NNCI interacts with GmNINA and blocks its transcriptional activation of GmNiC 1 and GmNiC 2, and the GmNiNa-miR172c-NNC1(NMN) network is a master switch that synergistically regulates and optimizes NF and AON signals, maintaining the balance between soybean nodulation and AON (Wang et al, 2019; Wang et al, 2020). It has also been recently discovered that GmNIN1a, GmNIN2a, and GmNIN2b have redundant roles in mediating rhizobial infestation and nodule formation, while GmNIN1b has less of a role (Fu et al, 2021). Therefore, the NLP gene in the soybean plays an important role in nodulation, and the functions of other NLP genes are not reported except for 4 reported NIN genes.

Disclosure of Invention

In order to solve the problems, the invention provides an editing site of a soybean NLP gene and application thereof.

The purpose of the invention is realized by adopting the following technical scheme:

an editing site of a soybean NLP gene, the NLP gene comprising: NLP4a, NLP4b, NLP5a, and NLP5 b;

the gene editing sites of the NLP4a gene are three DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are respectively shown in SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 4, the accurate locations of the soybean genome are 118-140, 170-192 and 235-257 of CDS of NLP4a chromosome 10, and the coordinates of the chromosome are 46384350-46384328, 46384298-46384276 and 46384233-46384211; the invalid gene editing site is a DNA sequence of 23 deoxyribonucleotides, and the nucleotide sequence is shown as SEQ ID NO: 3 is shown in the specification;

the gene editing sites of the NLP4b gene are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are respectively shown as SEQ ID NO: 1. SEQ ID NO: 2, the accurate locations of the soybean genome are 112-; the invalid gene editing sites are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are shown as SEQ ID NO: 3. SEQ ID NO: 4 is shown in the specification;

the gene editing sites of the NLP5a gene are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are respectively shown as SEQ ID NO: 5. SEQ ID NO: 6, the accurate locations of the soybean genome are 184-206 and 678-700 of CDS of chromosome 9 NLP5a gene, respectively, and the coordinates of the chromosomes are 34817746-34817724 and 34816595-34816573, respectively; the invalid gene editing sites are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are shown as SEQ ID NO: 7. SEQ ID NO: 8 is shown in the specification;

the gene editing sites of the NLP5b gene are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are respectively shown as SEQ ID NO: 5. SEQ ID NO: 6, the accurate locations of the soybean genome are 184-206 and 675-697 of CDS of No. 16 chromosome NLP5b gene, and the coordinates of the chromosome are 34544795-34544773 and 34543570-34543548; the invalid gene editing sites are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are shown as SEQ ID NO: 7. SEQ ID NO: shown in fig. 8.

The 3' end of the editing site of the soybean NLP gene contains NGG, and through base complementary pairing of sgRNA and DNA near a genome PAM site, Cas9 endonuclease is mediated to recognize a genome in a targeted manner, double strand break of the genome DNA is realized, a DNA damage repair mechanism is induced, nucleotide pairs are introduced or deleted randomly in the repair process, so that deletion or insertion of the target nucleotide pairs is caused, and mutation near the target is caused.

The method for applying the editing sites of the soybean NLP gene to the creation of soybean mutants specifically comprises the following steps:

(1) according to SEQ ID NO: 1 to SEQ ID NO: 8, synthesizing sgRNA from the sequences of the soybean NLP4a/b and NLP5a/b gene editing sites;

(2) in SEQ ID NO: 1sgRNA 5' end added base linker to obtain SEQ ID NO: 9, carrying out reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base joint at the 5' end of the sgRNA to obtain a primer sequence shown in SEQ ID NO: 10, and a reverse nucleotide sequence primer; converting SEQ ID NO: 9 and SEQ ID NO: 10 annealing to form double-stranded DNA;

converting SEQ ID NO: adding a base linker at the 5' end after the 2sgRNA is inverted to obtain SEQ ID NO: 11, carrying out reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base joint at the 5' end of the sgRNA to obtain a nucleotide sequence shown in SEQ ID NO: 12; converting SEQ ID NO: 11 and SEQ ID NO: 12 annealing to form double-stranded DNA;

converting SEQ ID NO: 3sgRNA was inverted and a base linker was added at the 5' end to obtain SEQ ID NO: 13, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a forward nucleotide sequence primer shown in SEQ ID NO: 14, a reverse nucleotide sequence primer; converting SEQ ID NO: 13 and SEQ ID NO: 14 annealing to form double-stranded DNA;

converting SEQ ID NO: adding a base linker at the 5' end after reversing 4sgRNA to obtain SEQ ID NO: 15, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 16; converting SEQ ID NO: 15 and SEQ ID NO: 16 annealing to form double-stranded DNA;

converting SEQ ID NO: 5sgRNA was inverted and a base linker was added at the 5' end to obtain SEQ ID NO: 17, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 18, and a reverse nucleotide sequence primer; converting SEQ ID NO: 17 and SEQ ID NO: 18 annealing to form double-stranded DNA;

in SEQ ID NO: adding a base joint to the 5' end of the 6sgRNA to obtain the nucleotide sequence shown in SEQ ID NO: 19, and performing reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base joint at the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 20, and a reverse nucleotide sequence primer; converting SEQ ID NO: 19 and SEQ ID NO: 20 annealing to form double-stranded DNA;

in SEQ ID NO: adding a base joint to the 5' end of the 7sgRNA to obtain the nucleotide sequence shown in SEQ ID NO: 21, and performing reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse sequence of the sgRNA shown in SEQ ID NO: 22; converting SEQ ID NO: 21 and SEQ ID NO: 22 annealing to form double-stranded DNA;

in SEQ ID NO: adding a base joint to the 5' end of 8sgRNA to obtain the nucleotide sequence shown in SEQ ID NO: 23, and performing reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 24, and a reverse nucleotide sequence primer; converting SEQ ID NO: 23 and SEQ ID NO: 24 annealing to form double-stranded DNA;

(3) constructing an sgRNA expression cassette: connecting the double-stranded DNA formed in the step (2) to a sgRNA vector;

(4) connecting a pLYCRISPR/Cas9 vector with the sgRNA expression cassette in the step (3) to obtain a Cas9 sgRNA expression vector;

(5) transforming the Cas9 sgRNA expression vector in the step (4) into agrobacterium rhizogenes and infecting soybean cotyledons.

The specific steps for constructing the sgRNA expression cassette in the step (3) are as follows: and carrying out double enzyme digestion on the sgRNA vector and the double-stranded DNA by Bsa I, connecting the two strands of DNA by T4 ligase, carrying out first round PCR to amplify the gRNA expression cassette, and carrying out second round PCR by taking the first round PCR product as a template to amplify to obtain a complete sgRNA expression cassette which is provided with a specific joint and contains a target point and sgRNA.

The sgRNA vector is pYLgRNA-AtU 3-3 d, pYLgRNA-AtU3b, pYLgRNA-AtU6-1 and pYLgRNA-AtU 6-29.

The editing sites of the soybean NLP gene can be also applied to the preparation of recombinant expression vectors, recombinant gene cell lines or recombinant bacteria containing the NLP4a/b and NLP5a/b gene editing sites.

The recombinant expression vector is obtained by connecting a sgRNA vector with soybean NLP4a/b and NLP5a/b gene editing sites of claim 1 after being subjected to enzyme digestion by Bsa I, and connecting an obtained sgRNA expression cassette with a pYLCRISPR/Cas9 vector after being subjected to enzyme digestion by Bsa I.

The invention has the beneficial effects that:

the editing sites of the GmNLP4a/b and GmNLP5a/b genes provided by the invention are effective targets for editing the genes, can edit the GmNLP4a/b and GmNLP5a/b genes, and perform double-strand break under the mediation of endonuclease Cas9, thereby obtaining allele mutants with different GmNLP4a/b and GmNLP5 a/b. The invention provides a new strategy for creating mutants of GmNLP4a/b and GmNLP5a/b to research the nodulation character of soybean, also provides a reliable means and material for cultivating new varieties of soybean, and has very important effect on crop research and production.

Drawings

The invention is further illustrated by means of the attached drawings, but the embodiments in the drawings do not constitute any limitation to the invention, and for a person skilled in the art, other drawings can be obtained on the basis of the following drawings without inventive effort.

FIG. 1 is a schematic diagram of Cas9 sgRNA expression vectors with the GmNLP4a/b and GmNLP5a/b genes inserted with editing sites T1-T4; the Cas9 sgRNA expression vector takes a pLYCRISPR/Cas9 vector as a framework, and is an expression vector with AtU3d, AtU3b, AtU6-1 and AtU6-29 promoters, target points T1-T4 and sgRNAs; a is target points GmNLP4a/b T1 and GmNLP5a/b T1; b is target GmNLP4a/b T2, GmNLP5a/b T2; c is target GmNLP4a/b T3, GmNLP5a/b T3; d is target GmNLP4a/b T4, GmNLP5a/b T4;

fig. 2 is an electrophoretogram during construction of a knock-out vector, wherein a is an electrophoretogram of a first round PCR product of sgRNA expression cassette amplification; b is a second round PCR product of sgRNA expression cassette amplification; c is a colony PCR product electrophoretogram of Escherichia coli DH5 alpha in the construction process of the knockout vector; m is 2kb DNAsader;

FIG. 3 is a diagram showing the editing effect of the detection target of transgenic hairy roots; wherein, A is an electrophoretogram of a PCR product of a colony of agrobacterium K599; B. c is a hairy root grown after agrobacterium infection of soybean cotyledon and 15 days of culture;

FIG. 4 is a sequence diagram of the target site for detection of transgenic hairy roots.

Detailed Description

The present invention is described in further detail below with reference to the accompanying drawings, examples and sequence listing.

the gene editing sites of the NLP4a gene are as follows: three DNA sequences of 23 deoxyribonucleotides are respectively SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 4, the accurate locations of the soybean genome are 118-140, 170-192 and 235-257 of CDS of NLP4a chromosome 10, and the coordinates of the chromosome are 46384350-46384328, 46384298-46384276 and 46384233-46384211; the invalid gene editing site is a DNA sequence of 23 deoxyribonucleotides, and the nucleotide sequence is shown as SEQ ID NO: 3 is shown in the specification;

the gene editing sites of the NLP4b gene are as follows: two DNA sequences of 23 deoxyribonucleotides are respectively SEQ ID NO: 1. SEQ ID NO: 2, the accurate location of the soybean genome is 112-;

the gene editing sites of the NLP5a gene are as follows: two DNA sequences of 23 deoxyribonucleotides are respectively SEQ ID NO: 5. SEQ ID NO: 6, the accurate location of the soybean genome is 184-206 and 678-700 of CDS of chromosome 9 NLP5a gene, and the coordinates of the chromosome are 34817746-34817724 and 34816595-34816573; the invalid gene editing sites are two DNA sequences of 23 deoxyribonucleotides, and the nucleotide sequences are shown as SEQ ID NO: 7. SEQ ID NO: 8 is shown in the specification;

the gene editing sites of the NLP5b gene are as follows: two DNA sequences of 23 deoxyribonucleotides are shown as SEQ ID NO: 5. SEQ ID NO: 6, the accurate location of the soybean genome is 184-206 and 675-697 of CDS of the 16 chromosome NLP5b gene, and the coordinates of the chromosome are 34544795-34544773 and 34543570-34543548.

According to the application of the editing site of the soybean NLP gene, the 3' end of the editing site of the soybean NLP gene contains NGG, the Cas9 endonuclease is mediated to target and recognize a genome and realize double-strand break of the genome DNA through base complementary pairing of sgRNA and DNA near a genome PAM site, a DNA damage repair mechanism is induced, nucleotide pairs are randomly introduced or deleted in the repair process, so that the deletion or insertion of the target nucleotide pair is caused, and mutation near the target is caused.

The editing site of the soybean NLP gene is particularly applied to breeding of soybean mutants with changed nodulation characters and/or yield, and the method comprises the following steps:

(1) according to SEQ ID NO: 1 to SEQ ID NO: 8, synthesizing sgRNA by using the sequences of the soybean NLP4a/b and NLP5a/b gene editing sites;

(2) in SEQ ID NO: 1sgRNA 5' end added base linker to obtain SEQ ID NO: 9, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a forward nucleotide sequence primer of SEQ ID NO: 10, a reverse nucleotide sequence primer; converting SEQ ID NO: 9 and SEQ ID NO: 10 annealing to form double-stranded DNA;

converting SEQ ID NO: adding a base linker at the 5' end after the 2sgRNA is inverted to obtain SEQ ID NO: 11, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a forward nucleotide sequence primer of SEQ ID NO: 12 with a reverse nucleotide sequence primer; converting SEQ ID NO: 11 and SEQ ID NO: 12 annealing to form double-stranded DNA;

converting SEQ ID NO: 3sgRNA was inverted and a base linker was added at the 5' end to obtain SEQ ID NO: 13, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a forward nucleotide sequence primer of SEQ ID NO: 14, a reverse nucleotide sequence primer; converting SEQ ID NO: 13 and SEQ ID NO: 14 annealing to form double-stranded DNA;

converting SEQ ID NO: adding a base linker at the 5' end after reversing 4sgRNA to obtain SEQ ID NO: 15, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 16; converting the amino acid sequence of SEQ ID NO: 15 and SEQ ID NO: 16 annealing to form double-stranded DNA;

converting SEQ ID NO: 5sgRNA was inverted and a base linker was added at the 5' end to obtain SEQ ID NO: 17, reverse complementing the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse sequence of the sgRNA shown in SEQ ID NO: 18, a reverse nucleotide sequence primer; converting SEQ ID NO: 17 and SEQ ID NO: 18 annealing to form double-stranded DNA;

in SEQ ID NO: adding a base joint to the 5' end of the 6sgRNA to obtain the nucleotide sequence shown in SEQ ID NO: 19, and performing reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base joint at the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 20, a reverse nucleotide sequence primer; converting SEQ ID NO: 19 and SEQ ID NO: 20 annealing to form double-stranded DNA;

in SEQ ID NO: adding a base joint to the 5' end of 8sgRNA to obtain the nucleotide sequence shown in SEQ ID NO: 23, and performing reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 24, a reverse nucleotide sequence primer; converting SEQ ID NO: 23 and SEQ ID NO: 24 annealing to form double-stranded DNA;

The application of the other editing site of soybean NLP gene in claim 1, which is applied to the preparation of recombinant expression vector, recombinant gene cell line or recombinant bacterium containing the editing sites of the NLP4a/b and NLP5a/b genes.

The expression vector is pYLCRISPR/Cas 9; the recombinant strain adopts agrobacterium rhizogenes.

The recombinant expression vector is obtained by connecting a sgRNA vector with soybean NLP4a/b and NLP5a/b gene editing sites of claim 1 after being subjected to enzyme digestion by Bsa I, and connecting an obtained sgRNA expression cassette and a pYLCRISPR/Cas9 vector after being subjected to enzyme digestion by Bsa I.

Detailed description of the preferred embodiment 1

The specific scheme of the editing site of soybean NLP gene and the application thereof provided by the embodiment is as follows:

construction of Cas9 sgRNA expression vectors GmNLP4 and GmNLP5 inserted with GmNLP4a/b and GmNLP5a/b gene editing target sites

(1) Major reagents and sources

The recipient soybean variety for hairy root transformation is Williams 82(W82), the agrobacterium rhizogenes strain is K599, and the materials are stored in laboratories of the molecular genetics and evolution innovation research center of Guangzhou university. AtU3d, AtU3b, AtU6-1, AtU6-29 and CRISPR/Cas9 plasmids for gene knockout vector construction are all provided by Liu flare light laboratories of southern agriculture university. Escherichia coli competence DH5 α was purchased from Shenzhen Kangsheng Life technologies, Inc. BsAI enzyme and T4 ligase were purchased from New England Biolabs. The DNA extraction kit was purchased from Beijing kang, a century Biotechnology Co., Ltd. The gel recovery kit and the high-purity small-amount plasmid kit are purchased from Beijing Quanyujin Biotechnology Co. Other chemical reagents such as tryptone, agar powder, sodium chloride, spectinomycin (Spec, 100. mu.g/mL) and the like are all domestic analytical pure reagents, and primer synthesis and sequencing are completed by Tianyihuiyuan company.

Target primers are shown in table 1;

TABLE 1 Gene target primer List

The primers for the first round of PCR were:

U-F：5’-CTCCGTTTTACCTGTGGAATCG-3’(SEQ ID NO：25)；

gRNA-R：5’-CGGAGGAAAATTCCATCCAC-3’(SEQ ID NO：26)；

the primers for the second round of PCR were:

B1F:5’-TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG-3’(SEQ ID NO：27)；

B2R:5’-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3’(SEQ ID NO：28)；

B2F:5’-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3’(SEQ ID NO：29)；

B3R:5’-AGCGTGggtctcGtcttGGTCCATCCACTCCAAGCTC-3’(SEQ ID NO：30)；

B3F:5’-TTCAGAggtctcTaagaCACTGGAATCGGCAGCAAAGG-3’(SEQ ID NO：31)；

B4R:5’-AGCGTGggtctcGagtcGGTCCATCCACTCCAAGCTC-3’(SEQ ID NO：32)；

B4F:5’-TTCAGAggtctcTgactCACTGGAATCGGCAGCAAAGG-3’(SEQ ID NO：33)；

BLR:5’-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3’(SEQ ID NO：34)；

the vector sequencing primers were:

SP3F:5’-TGCAATAACTTCGTATAGGCT-3’(SEQ ID NO：35)；

SP1R:5’-GTCGTGCTCCACATGTTGACC-3’(SEQ ID NO：36)；

(2) procedure for the preparation of the

The first step is as follows: connection and amplification of target joint and gRNA expression cassette

Firstly, amplifying a target double-chain joint, adding a joint forward primer and a joint reverse primer into 0.5 × TE to mix into 10 μmol/L, respectively adding 10 μ L of the forward primer and the reverse primer into a PCR tube, and supplementing 80 μ L of ddH₂O to 100 mu L, setting the PCR program to be 90 ℃ for 30s, and cooling and annealing at room temperature;

secondly, performing enzyme digestion connection of the double-chain linker and a gRNA expression cassette; 10 uL enzyme digestion ligation reaction system, 1 uL gRNA vector 10 ng/. mu.L, 1 uL target double-chain joint 10. mu.mol/L, 0.5. mu.LBsa I (10U/. mu.L), 0.1. mu. L T4 DNA ligase,1 uL 10 XNEB T4 DNAlagase buffer, 6.4. mu.L ddH₂O; the PCR program was set up as follows: 5cycles of 5min at 37 ℃ and 5min at 20 ℃;

the second step is that: including 2 rounds of PCR

First round PCR, amplification of gRNA expression cassette, 15 μ LPCR reaction: 2 μ L of the PCR product of the second step, 0.3 μ L of the high fidelity enzyme KOD Plus Neo, 1.5 μ L of LKOD Plus Neo Buffer, 0.6 μ L of MgSO₄,1.5μL dNTPs，10μmol/L U-F 0.2μL，10μmol/L gRNA-R 0.2μL，ddH₂O to 15 μ L; the PCR program is set to 95 ℃ for 1 min; 10 cycles-95 ℃ for 15s, 55 ℃ for 15s, and 68 ℃ for 10 s; 20 cycles-95 ℃ for 15s, 60 ℃ for 15s,68 ℃ for 10s, and 16 ℃ for heat preservation; adding 3 mu of LPCR product into a sterile centrifuge tube, preparing 1% agarose gel for electrophoresis by 4 mu of 1X loading buffer, and checking whether a gel electrophoresis image has a target band of about 500bp (figure 2A);

second round PCR, connecting gRNA with target (namely the product of last round PCR) with a specific joint, and constructing a complete expression cassette containing a promoter, the target and the gRNA; the synthesized universal primers (B1F/B2R, B2F/B3R, B3F/B4R and B4F/BLR) of 4 pairs of gRNAs at specific positions can amplify corresponding U # -T1-gRNA, U # T2-gRNA, U # T3-gRNA and U # T4-gRNA and connect 4 complete gRNA expression cassettes in a certain sequence; taking 1. mu.L of the first round PCR product and adding to 19. mu.L of ddH₂Mixing and diluting the mixture in O by 20 times, and taking 1 mu L of the mixture as a template of a second round of PCR; because 4 targets are selected in target design, each gRNA expression cassette in the round of PCR adopts a 20-mu-L reaction system: KOD Plus Neo Buffermu.L, dNTPs Mix 2. mu.L, KOD Plus Neo 0.4. mu.L, universal primers 0.15. mu.L each, first round PCR product dilution 1. mu.L, MgSO₄0.8 μ L of sterile water 13.5 μ L; the PCR reaction program was set up as follows: 1min at 95 ℃,25 cycles-10 s at 95 ℃, 15s at 60 ℃, 30s at 68 ℃ and heat preservation at 16 ℃; taking 3 mu LPCR product to carry out 1% agarose gel electrophoresis, checking whether a strip of 500bp exists by using a gel imager (figure 2B, comparing the brightness of the strip of the sample with the brightness of a strip of a DNAmarker, and estimating the approximate concentration of a DNA sample, approximately mixing all products in equal quantity according to the concentration of product fragments of each expression cassette obtained by the second round of PCR, carrying out gel recovery according to the steps on a gel recovery kit, and detecting the concentration of the recovered DNA fragments by using a DNA concentration detector;

the third step: the gRNA expression cassette is linked to the pYLCRISPR/Cas9 vector

Amplifying a 15 mu L reaction system by a PCR side-cutting and side-linking method, namely, 1.5 mu L of Cut Smart Buffer, 0.5 mu L of CRISPR/Cas9 plasmid and 1 mu L of BsaI, adding the purified product of the previous step to ensure that the concentration of the purified product is 60-70 ng/mu L, and adding ddH₂O to 15 μ L; the PCR program was set up as follows: 10min at 37 ℃;

adding the product of the above step into 0.1. mu. L T4 DNA ligase, 1.5. mu.L 10 XNEB T4 DNaligase buffer; the PCR program was set up as follows: 5min at 37 ℃, 5min at 10 ℃, 5min at 20 ℃, 5min at 37 ℃ and 15 cycles;

the fourth step: coli transformation of ligation products

Thawing the coli DH5 alpha competent cells on ice, adding all the ligation reaction solution, and slightly flicking and mixing uniformly; after ice-bath for 30min, putting the mixture into a 42 ℃ water bath kettle for heat shock for 1min, and immediately carrying out ice-bath for 2 min; adding 500 mu L of LB culture solution without antibiotics into a clean bench, culturing for 40min at 37 ℃ and 220rpm in a shaking way, centrifuging for 1min at 10000g, pouring out part of supernatant, sucking out heavy suspension liquid, inoculating the heavy suspension liquid to the center of an LB solid culture medium containing spe, uniformly coating, and putting the culture medium in a 37 ℃ incubator overnight;

the fifth step: screening of Escherichia coli positive clone and colony PCR

Picking E.coli DH5 alpha monoclonal with sterile toothpick on an ultraclean bench, and carrying out colony PCR with pYLCISPR/Cas 9 vector detection primers SP3F/SP 1R; a single clone was picked up with a sterilized toothpick as a template and added to 50. mu.L of an LB liquid medium containing spe or inoculated to an LB solid medium containing spe, and then added to a reaction system of 10. mu.L as follows: 5 mu L of LMaster Taq mix, 0.2 mu L of each of the primers SP1R and SP3F, and 4.6 mu L of sterile water; the PCR program was set up as follows: 2min at 95 ℃; 35 cycles-95 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 90 s; 2min at 72 ℃; carrying out 1% agarose gel electrophoresis on the colony PCR product, and checking whether a target band of about 2000bp appears (figure 2C); selecting a plurality of PCR products, sending the PCR products to Tianyihuiyuan company for sequencing, checking sequencing data by using BioEdit software, and checking the editing effect of the target point according to the sequencing result of the target point; and sequencing the positive clones, detecting whether all target spots are connected to the vector and the transformation is successful, finally carrying out plasmid extraction on the positive clones with correct sequencing, and storing the plasmids and bacterial liquid.

Specific example 2

soybean transgenic hairy root target editing effect detection

(1) Major reagents and sources

In this example, the extracted hair root DNA is derived from cultivated soybean W82(Glycine max Wm82.a2.v 1). Agrobacterium rhizogenes competent cell K599 was purchased from holo-type gold; the plasmid extraction kit is purchased from holo-type gold company; the totipotent plant genome DNA extraction kit is purchased from Kangjieki, a century company; germination culture medium: agave nutrient solution (Coolaber), 0.8% agar, 2% sucrose, pH 5.8; hairy root induction culture medium: hoagland nutrient solution (Coolaber), 2% of sucrose, 0.8% of agar, 0.6g of MES, 500mg/L of carbenicillin, 5mg/L of herbicide Basta, and pH of 5.8. Other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50. mu.g/mL), spectinomycin (Spec, 100. mu.g/mL), rifampicin (Rif, 50. mu.g/mL) and the like are all domestic analytical pure reagents, and primer synthesis and sequencing are completed by Tianyihuiyuan company.

Primers for detecting the Cas9 backbone were:

SP3F:5’-TGCAATAACTTCGTATAGGCT-3’(SEQ ID NO：35)；

SP1R:5’-GTCGTGCTCCACATGTTGACC-3’(SEQ ID NO：36)。

primers for target detection are shown in table 2;

TABLE 2 primer List for target detection

Target detection primer	Serial number	Primer sequence (5 '-3')
			NLP4a-F	SEQ ID NO：37	TATTCTACGCTGTCCTCCTCA
NLP4a-R	SEQ ID NO：38	TAATACGAAAAGAACATACAC
			NLP4b-F	SEQ ID NO：39	ATGCATTATTCTCCAGAGTTT
NLP4b-R	SEQ ID NO：40	CAAATTCGGCAGCATCTATTC
			NLP5a-F1	SEQ ID NO：41	TCAGAGTCCAAGGATGAAAAT
NLP5a-R1	SEQ ID NO：42	ACAATCAACAGTGGTTACTAT
			NLP5a-F2	SEQ ID NO：43	GTAGCCATCCCAACTTCAGAAA
NLP5a-R2	SEQ ID NO：44	ACATCGAACTCACCAAATATGA
			NLP5b-F1	SEQ ID NO：45	ACAGGAGGAACATGGGTTTGT
NLP5b-R1	SEQ ID NO：46	CAACAGTGGCTGCTATTCAAG
			NLP5b-F2	SEQ ID NO：47	CAGGTTTGGGCACCTGTGAGG
NLP5b-R2	SEQ ID NO：48	TTAATAGTAGTACATATGATA

(2) Procedure for the preparation of the

The first step is as follows: k599 Agrobacterium transformation

Adding 0.1 μ g of positive plasmid sequenced correctly in example 1 into 50 μ L of Agrobacterium infected cells K599, mixing gently, ice-bathing for 30min, freezing in liquid nitrogen for 5min, heat-shocking in water bath at 37 deg.C for 5min, and cooling on ice for 2 min; inoculating the bacterial liquid into 500 μ LYEP culture medium, shake culturing at 28 deg.C and 220rpm for 3 hr, centrifuging for 1min, uniformly coating suspension cells on YEP culture medium containing kanamycin, spectinomycin, and rifampicin antibiotics, and performing inversion culture at 28 deg.C for 36 hr; colony PCR was performed with primers SP3F, SP1R, 10 μ L reaction: 5 mu L of LMaster Taq mix, 0.2 mu L of each primer, 3.6 mu L of sterile water and 1 mu L of bacterial liquid; the PCR program was set up as follows: 2min at 95 ℃; 35 cycles: 30s at 95 ℃, 30s at 58 ℃ and 90s at 72 ℃; 2min at 72 ℃; performing 1% agarose gel electrophoresis, and checking whether a target band of about 2000bp appears by using a gel imaging system (FIG. 3A);

the second step is that: infesting soybean cotyledon

Selecting full and uniform soybean Willam82 seeds with no seed coat crack, and adding 10% H₂O₂Sterilizing the surface of the seeds for 1min, and then washing the seeds clean by sterile deionized water; sowing the sterilized seeds in a germination culture medium, and culturing for 5 days in a soybean artificial climate chamber until cotyledons are erected and form a right-angle state with the hypocotyls; putting the agrobacterium rhizogenes K599 containing the target plasmid obtained in the first step into an incubator, and culturing at 28 ℃ until OD is about 0.6; using a scalpel to dip bacteria liquid to scratch the front side of the soybean cotyledon into a grid shape, placing the treated cotyledon on a root induction culture medium, and culturing for about 15 days at 25 ℃ under illumination, wherein hairy roots grow out (figures 3B and 3C);

the third step: target editing effect detection

According to the steps of the DNA extraction kit, mixing the transgenic hairy roots obtained in every 3 second steps into a sample for DNA extraction; taking the extracted hairy root DNA as a template, respectively amplifying fragments of the region of the target by using a primer SP3F/SP1R and a target detection primer, and carrying out PCR reaction: 5 μ L Master Taq mix, 0.2 μ L each of forward and reverse primers, 0.5 μ L DNA template, ddH₂O to 10 μ L; the PCR procedure was: 94 ℃ for 2 min; 35 cycles: 30s at 94 ℃, 30s at 58 ℃ and 1min at 72 ℃; finally 5min at 72 ℃; the product amplified by the target point detection primer corresponding to the hairy root with CAS9 PCR is sent to Tianyihui company for sequencing, sequencing data is checked by using BioEdit software, the editing effect of the target point is checked according to the sequencing result of the target point (figure 4), and the sequencing result shows that the target points are bimodal from the target point to the back, which indicates that the target points can be divided into two partsThe GmNLP4a/b and GmNLP5a/b genes were edited effectively.

The gene editing site provided by the invention is an effective target for editing NLP4a/b and NLP5a/b genes, and double-strand breakage can be carried out under the mediation of endonuclease Cas9, so that allele mutants with different NLP4a/b and NLP5a/b genes can be obtained. The invention provides a new strategy for creating mutants of GmNLP4a/b and GmNLP5a/b genes to research the nodulation character of soybean and also provides a reliable means for breeding new soybean varieties. In the scope of the present invention, the editing site of the soybean NLP gene and its application provided by the present invention are within the scope of the present invention in other ways.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the protection scope of the present invention, although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Guangzhou university

<120> editing site of soybean NLP gene and application thereof

<160> 48

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 1

cctttggatc acatggcctt tgg 23

<210> 2

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 2

ccacttcctc tgaccaacct tac 23

<210> 3

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 3

cctctttggg ctttctctga tgg 23

<210> 4

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 4

cctgcttctg ccttctctga ttg 23

<210> 5

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 5

cctgtctggg ctttttctga tgc 23

<210> 6

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 6

ttacaatgtc cgcggaacct tgg 23

<210> 7

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 7

ctgcctgtgt ttgagcttgc agg 23

<210> 8

<211> 23

<212> DNA

<213> Soybean (Glycine maxL. Merr.)

<400> 8

acagtcatgt gtggctgtag tgg 23

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtcacctttg gatcacatgg cctt 24

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aaacaaggcc atgtgatcca aagg 24

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtcagtaagg ttggtcagag gaag 24

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aaaccttcct ctgaccaacc ttac 24

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

attgccatca gagaaagccc aaag 24

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaacctttgg gctttctctg atgg 24

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

attgcaatca gagaaggcag aagc 24

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aaacgcttct gccttctctg attg 24

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtcagcatca gaaaaagccc agac 24

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaacgtctgg gctttttctg atgc 24

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gtcattacaa tgtccgcgga acct 24

<210> 20

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaacaggttc cgcggacatt gtaa 24

<210> 21

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

attgctgcct gtgtttgagc ttgc 24

<210> 22

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aaacgcaagc tcaaacacag gcag 24

<210> 23

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

attgacagtc atgtgtggct gtag 24

<210> 24

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

aaacctacag ccacacatga ctgt 24

<210> 25

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ctccgtttta cctgtggaat cg 22

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cggaggaaaa ttccatccac 20

<210> 27

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ttcagaggtc tctctcgact agtggaatcg gcagcaaagg 40

<210> 28

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

agcgtgggtc tcgtcagggt ccatccactc caagctc 37

<210> 29

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ttcagaggtc tctctgacac tggaatcggc agcaaagg 38

<210> 30

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

agcgtgggtc tcgtcttggt ccatccactc caagctc 37

<210> 31

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ttcagaggtc tctaagacac tggaatcggc agcaaagg 38

<210> 32

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

agcgtgggtc tcgagtcggt ccatccactc caagctc 37

<210> 33

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ttcagaggtc tctgactcac tggaatcggc agcaaagg 38

<210> 34

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

agcgtgggtc tcgaccgacg cgtccatcca ctccaagctc 40

<210> 35

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tgcaataact tcgtataggc t 21

<210> 36

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

gtcgtgctcc acatgttgac c 21

<210> 37

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

tattctacgc tgtcctcctc a 21

<210> 38

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

taatacgaaa agaacataca c 21

<210> 39

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

atgcattatt ctccagagtt t 21

<210> 40

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

caaattcggc agcatctatt c 21

<210> 41

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tcagagtcca aggatgaaaa t 21

<210> 42

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

acaatcaaca gtggttacta t 21

<210> 43

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

gtagccatcc caacttcaga aa 22

<210> 44

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

acatcgaact caccaaatat ga 22

<210> 45

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

acaggaggaa catgggtttg t 21

<210> 46

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

caacagtggc tgctattcaa g 21

<210> 47

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

caggtttggg cacctgtgag g 21

<210> 48

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

ttaatagtag tacatatgat a 21

Claims

1. An editing site of a soybean NLP gene, wherein the NLP gene comprises: NLP4a, NLP4b, NLP5a, and NLP5 b;

the gene editing sites of the NLP4b gene are as follows: two DNA sequences of 23 deoxyribonucleotides are respectively SEQ ID NO: 1. SEQ ID NO: 2, the accurate location of the soybean genome is 112-19,164-186 of CDS of 20 chromosome NLP4b gene, the coordinates of the chromosome are 39832266-39832288, 39832318-39832340;

2. The application of the editing site of the soybean NLP gene of claim 1, wherein the 3' end of the editing site of the soybean NLP gene contains NGG, and through base complementary pairing of sgRNA and DNA near a PAM site of a genome, Cas9 endonuclease is mediated to target and recognize the genome and realize double strand break of the genome DNA, a DNA damage repair mechanism is induced, nucleotide pairs are randomly introduced or deleted in the repair process, so that deletion or insertion of the target nucleotide pairs is caused, and mutation near the target is caused.

3. Use according to claim 2, for breeding soybean mutants with altered nodulation traits and/or yield.

4. The use according to claim 3, characterized in that it comprises in particular the following steps:

converting SEQ ID NO: 5sgRNA was inverted and a base linker was added at the 5' end to obtain SEQ ID NO: 17, and performing reverse complementation to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 18, a reverse nucleotide sequence primer; converting SEQ ID NO: 17 and SEQ ID NO: 18 annealing to form double-stranded DNA;

in SEQ ID NO: adding a base joint to the 5' end of 8sgRNA to obtain the nucleotide sequence shown in SEQ ID NO: 23, and performing reverse complementation on the forward nucleotide sequence primer to obtain a reverse sequence of the sgRNA, and adding a base linker to the 5' end of the sgRNA to obtain a reverse nucleotide sequence shown in SEQ ID NO: 24, a reverse nucleotide sequence primer; converting the amino acid sequence of SEQ ID NO: 23 and SEQ ID NO: 24 annealing to form double-stranded DNA;

(3) constructing an sgRNA expression cassette: ligating the double-stranded DNA formed in step (2) to a sgRNA vector;

5. The use according to claim 4, wherein the specific steps of constructing the sgRNA expression cassette in step (3) are: and carrying out double enzyme digestion on the sgRNA vector and the double-stranded DNA by Bsa I, connecting the two strands of DNA by T4 ligase, carrying out first round PCR to amplify the gRNA expression cassette, and carrying out second round PCR by taking the first round PCR product as a template to amplify to obtain a complete sgRNA expression cassette which is provided with a specific joint and contains a target point and sgRNA.

6. The use of the editing sites of the soybean NLP gene of claim 1, which is characterized in that a recombinant expression vector, a recombinant gene cell line or a recombinant bacterium containing the editing sites of the NLP4a/b and NLP5a/b genes of claim 1 is prepared.

7. The use of claim 6, wherein the expression vector is pYLCISPR/Cas 9; the recombinant strain adopts agrobacterium rhizogenes.

8. The use of claim 7, wherein the recombinant expression vector is obtained by digesting sgRNA vector and soybean NLP4a/b and NLP5a/b gene editing sites of claim 1 with Bsa I, and then connecting the obtained sgRNA expression cassette and pYLCRISPR/Cas9 vector with Bsa I.

9. The use of claim 8, wherein the sgRNA vectors are pYLgRNA-AtU3d, pYLgRNA-AtU3b, pYLgRNA-AtU6-1, and pYLgRNA-AtU 6-29.