CN109022299A

CN109022299A - A kind of ERG1 gene defect Yeast engineering bacteria, its construction method and its utilization

Info

Publication number: CN109022299A
Application number: CN201810896549.1A
Authority: CN
Inventors: 高伟; 周家伟; 胡添源
Original assignee: Capital Medical University
Current assignee: Capital Medical University
Priority date: 2018-08-08
Filing date: 2018-08-08
Publication date: 2018-12-18
Anticipated expiration: 2038-08-08
Also published as: CN109022299B

Abstract

The present invention relates to a kind of ERG1 gene defect Yeast engineering bacteria and its construction methods, the ERG1 gene defection type Yeast engineering bacteria is transformed yeast by CRISPR/Cas9 gene editing technology, realize the complete deletion of Erg1 gene order, it avoids yeast itself and repairs the back mutation phenomenon generated, obtaining one kind can be suitble to verify the engineering bacteria of other source squalene epoxidase enzymes genes.

Description

A kind of ERG1 gene defect Yeast engineering bacteria, its construction method and its utilization

Technical field

The present invention relates to ERG1 genes in a kind of ERG1 gene defection type Yeast engineering bacteria and a kind of knockout saccharomycete Method is transformed saccharomyces cerevisiae by CRISPR/Cas9 gene editing technology, by the squalene epoxidase in yeast chromosomal Enzyme (Squalene epoxidase, ERG1) gene is knocked out, and the squalene ring for being suitble to the other sources of verifying is made The defect bacterium of oxidase gene function, and the squalene ring cloned from tripterygium wilfordii is successfully authenticated by the yeast defect bacterium Oxidase gene (Twse), belongs to genetic engineering field.

Background technique

The acquisition of Chinese medicine or the bioactive natural product in other sources depends on the extraction to original species, but this method Acquired natural products is much unable to satisfy demand, is also easy to damage environment and resource.Pass through the structure in microorganism The biosynthesis pathway of important secondary metabolites is built, realizes the production of natural products low cost, high yield, this will promote natural produce The application of object and the research and development of new drug and the sustainable development of resource.The premise that this mode can be carried out is obtaining for genetic elements It takes and the parsing of route of synthesis.

ERG1 is squalene epoxidase enzymes, because being the gene on endoplasmic reticulum Endoplasmic Reticulum, It is named with Erg.Squalene epoxidase enzymes are the key genes on triterpene and sterol biosynthesis approach, its activity and function shadow Ring the biosynthesis of triterpene and sterol.Squalene is in squalene epoxidase enzymes and its coenzyme cytochrome P450 reductase Epoxy squalene (Fig. 1) is generated under the action of (Cytochrome P450 Reductase, CPR), epoxy squalene further converts For triterpene or sterol substance.In plant, squalene epoxidase enzymes pass through the sterol and triterpene active component for influencing plant Synthesis further influences the growth and development of plant and copes with biology and abiotic pressure.Research shows that being sent out in arabidopsis Existing epoxy squalene enzyme SE1 gene affects the development of the root and seed of arabidopsis and SE3 gene influences the development of plumule and big It is small.

Since squalene epoxidase enzymes belong to endoplasmic reticulum binding protein, function can be played by being difficult to give expression in Escherichia coli Can squalene epoxidase enzymes, thus be difficult through prokaryotic expression, the method for external enzymatic verifies the shark of plant or other sources The function of alkene Cycloxygenase.Yeast belongs to eucaryote, can be good at the squalene epoxidase enzymes for expressing plant or other sources, But yeast itself also has squalene epoxidase enzymes gene, thus to the squalene epoxidase enzymes gene function of plant and other sources Identification interferes.Early stage ERG1 gene in research yeast passes through the side of homologous recombination at the position on yeast chromosomal Method is knocked out (bacterium is named as KLN1:MATa, ERG1::URA3, Ieu2, ura3, trp1) to the ERG1 gene in yeast. Although yeast is facultative anaerobic bacteria, it require that oxygen is for synthesizing two class essential components: first is that sterol, another kind of is insatiable hunger And fatty acid.Early period, people had found when studying yeast, and under aerobic conditions, yeast will not absorb etembonate in culture medium Alcohol, and yeast can absorb ergosterol in culture medium in the absence of oxygen.Squalene epoxidase enzymes of the later period in verifying plant Gene is typically all to be done by this bacterium of KLN1, this bacterium is right by the code area that selection markers are inserted into ERG1 gene Building in yeast chromosomal is integrated by the method for homologous recombination afterwards, has the drawback that ERG1 gene does not strike completely It removes, when verifying the function of external source se gene, there may be false positives.Also there are individual bacterium RXY6 (MATa using another transformation erg7::HIS3 erg1::KanMX4 hem1::TRP1 ura3-52 trp1-△63 leu2–3,112 his3-△200 ade2 Gal⁺), the main advantage of this bacterium is that Hem1 has also been knocked out under the premise of having knocked out ERG1, and ferment can be made by knocking out Hem1 Mother absorbs ergosterol under conditions of aerobic in culture medium, but it is larger to knock out ERG1 and Hem1 difficulty simultaneously, and Hem1 synthesizes particularly significant, the internal a variety of metabolic responses of hemin participation to hemin, therefore has knocked out the yeast of Hem1 gene It needs to supplement hemin in culture medium.

The gene editing method that this research uses realizes the complete deletion of ERG1 gene order, avoids yeast itself and repairs Raw back mutation phenomenon is reproduced, the engineering bacteria for being suitble to the other source squalene epoxidase enzymes genes of verifying is made.In addition, should Plasmid used in method knockout process can be removed by high-temperature process, remain the selection markers of opportunistic pathogen strain, the scope of application It is wider, and experimental implementation is simpler more quick than previous methods of homologous recombination.

Summary of the invention

One aspect of the present invention provides a kind of method for knocking out the ERG1 gene of itself in yeast, and the method is to pass through CRISPR/Cas9 gene editing technology is transformed yeast, and the squalene epoxidase enzymes gene of itself, obtains one in knockout yeast Kind can be suitble to verify the engineering bacteria of other source squalene epoxidase enzymes genes.It can construct in the following way and carry out gene The verifying of function:

Website http://yeastriction.tnw.tudelft.nl/# is designed using yeast CRISPR/Cas9gRNA！/ The screening of the site gRNA is carried out to ERG1 gene, the site gRNA that screening obtains is building up in gRNA carrier, yeast is prepared The gRNA carrier built and Cas9 carrier and homologous fragment are transferred to BY4741 yeast sense by BY4741 competent cell together By state cell, 30 DEG C of anaerobic cultures in solid screening and culturing medium.PCR verifying and sequence verification are carried out to the single colonie grown. Erg1 yeast defect bacterium 30 DEG C of anaerobic cultures in liquid screening medium that success constructs, preparation erg1 competent yeast are thin Born of the same parents.

When being verified to the squalene epoxidase enzymes gene function in plant cell, such as the squalene in verifying tripterygium wilfordii Cycloxygenase gene function can clone from thunder god vine suspending cell and obtain tripterygium wilfordii squalene epoxidase enzymes gene, by Twse It is gene constructed into pESC-his carrier for expression of eukaryon, be transformed into erg1 yeast defect bacterium, verified by way of having complementary functions Twse gene function.

Specifically, the method for knocking out the ERG1 gene of itself in yeast, comprising:

(1) site gRNA of ERG1 gene is screened；

(2) building knocks out the expression vector of ERG1 gene；

(3) Cas9 carrier is transformed, the selection markers TRP of p414-TEF1p-Cas9-CYC1t is replaced with into LEU；

(4) double-stranded DNA (dsOligo) of ERG1 gene is obtained

(5) yeast Competent cell is prepared；

(6) by the gRNA carrier containing yeast ERG1 gene specific recognition site, the Cas9 carrier being transformed and conjunction At ERG1 double-stranded DNA convert in the competent cell into rapid (5), the anaerobic culture on screening and culturing medium SC-Leu-Ura, Obtain the saccharomycete for being mutated successful ERG1 gene defect.

One more specifically scheme be:

(1) site gRNA of ERG1 gene, the gene order in the site gRNA are screened are as follows:

TATCTTTTCACGTTTCAGAA；

(2) it using EGR1-F and EGR1-R as primer, is cloned using p426-SNR52p-gRNA carrier for expression of eukaryon as template Blunt end cloning is carried out to linear carrier, and with T4 ligase, building obtains knocking out the gRNA expression vector of ERG1 gene,

The primer sequence are as follows:

ERG1-F:TATCTTTTCACGTTTCAGAAGTTTTAGAGCTAGAA,

ERG1-R:GATCATTTATCTTTCACTGCGGAGAAG；

(4) design knocks out the dsOligo of ERG1 gene, is knocked out by homologous recombination repair to target gene, institute The sequence of ERG1-Oligo-F and ERG1-Oligo-R are as follows:

ERG1-Oligo-F:

CAGGTTATTTCGAACAATTGAAAAAAAAAAATCACAGAAAAACATATCGAGAAAAGGGTCCTACAGCTTATAAGGGA GAGAGGATAGGAACCGTCAAACATTAAGCTGCACCTTTTTTTT,

ERG1-Oligo-R:

AAAAAAAAGGTGCAGCTTAATGTTTGACGGTTCCTATCCTCTCTCCCTTATAAGCTGTAGGACCCTTTTCTCGATAT GTTTTTCTGTGATTTTTTTTTTTCAATTGTTCGAAATAACCTG,

The dsOligo of the ERG1 gene is obtained by annealing ERG1-Oligo-F and ROX1-Oligo-R to form DNA Double-strand, and recovery purifying both obtains；

(5) according to Frozen-EZ Yeast Transformation II^TMKit specification prepares yeast chemoreception State cell；

PCR verifying and sequence verification are carried out to the saccharomycete of ERG1 gene defect, to confirm that obtain is correct gene Defective yeast.Erg1 yeast defect bacterium 30 DEG C of anaerobic cultures in liquid screening medium that success constructs prepare erg1 ferment Female competent cell.

The squalene epoxidase enzymes gene in the plant to be verified is cloned, then by gene constructed into carrier for expression of eukaryon, It is transformed into erg1 yeast defect bacterium again, squalene epoxidase enzymes gene function is verified by way of having complementary functions.

In the present invention, the Yeast engineering bacteria can be selected from GEN.PK system S. cervisiae or BY system S. cervisiae, Preferably BY system saccharomyces cerevisiae, such as BY4741 saccharomyces cerevisiae.

A further object of the present invention is to provide a kind of ERG1 gene defection type Yeast engineering bacteria, the yeast can be selected From GEN.PK system S. cervisiae or BY system S. cervisiae, preferably BY system saccharomyces cerevisiae, such as BY4741 saccharomyces cerevisiae.

In one more particular embodiment, the present invention provides a kind of BY4741 yeast engineerings of ERG1 gene defection type Bacterium, the gene defection type Yeast engineering bacteria can be used for verifying the squalene epoxidase enzymes gene function in plant cell, be such as used for Verify tripterygium wilfordii squalene epoxidase enzymes gene (Twse) function.

ERG1 gene defection type Yeast engineering bacteria of the present invention can such as ERG1 deficiency BY4741 Yeast engineering bacteria To construct to obtain by the above method.

A further object of the present invention is to provide ERG1 gene defection type Yeast engineering bacterias of the present invention, such as ERG1 gene Deficiency BY4741 saccharomycete, the utilization in verifying squalene epoxidase enzymes gene function, as verified squalene ring in plant cell Oxidase gene function demonstrates squalene epoxidase enzymes gene function in plant tripterygium wilfordii in a more specifically embodiment.

Another object of the present invention is to provide squalene epoxidase enzymes gene in a kind of verifying plant cell (such as tripterygium wilfordii) The method of function, which comprises respectively by expression vector (such as pESC-his- containing plant squalene epoxidase enzymes gene Twse carrier) and accordingly the empty carrier (pESC-his empty carrier) without plant squalene epoxidase enzymes gene is transformed into ERG1 gene In defective yeast engineering bacteria (such as ERG1 gene defection type BY4741 saccharomycete) competent cell, then in screening and culturing medium On, it is cultivated under 30 DEG C aerobic and oxygen free condition, if being transferred to the erg1 yeast defect of the genophore containing squalene epoxidase enzymes Bacterium can grow under aerobic and oxygen free condition, and confirmation has biological function, and the screening and culturing medium is that SC-his adds ergot Sterol culture medium.

Detailed description of the invention

Fig. 1 squalene is cyclized enzymatic response diagram.

Fig. 2 Erg1 knocks out schematic diagram and gel electrophoresis figure.

Fig. 3 Erg1 yeast defect bacterium proof diagram, wherein 1 is erg1 defect yeast growth situation under aerobic conditions, 2 be anaerobic Under the conditions of Erg1 defect yeast growth situation.

Fig. 4 tripterygium wilfordii Total RNAs extraction result figure.

Fig. 5 tripterygium wilfordii Twse gene gel electrophoresis figure.

Fig. 6 tripterygium wilfordii Twse functional complementation figure, wherein 1 and 2 be respectively inhomogeneity under oxygen free condition and aerobic conditions Type erg1 Yeast Growth situation, 1 (a) and 2 (a) is the erg1 yeast defect bacterium for not being transferred to any carrier, and 1 (b) and 2 (b) is It is transferred to the erg1 yeast defect bacterium of empty carrier pESC-his, 1 (c) and 2 (c) is to be transferred to the erg1 yeast of pESC-his-Twse to lack Fall into bacterium.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

High fidelity enzymeHigh-Fidelity DNA Polymerase, restriction enzyme and T4 ligase It is all from (NEB company), Trans-T1 competent escherichia coli cell, EasyTaq DNA Polymerase, pEASY-Blunt Zero Cloning Kit, seamless spliced kit UniSeamLess Cloning and Assembly Kit (the full formula in Beijing Golden Bioisystech Co., Ltd), AraI restriction endonuclease and Ago-Gel DNA QIAquick Gel Extraction Kit Gene JET Gel Extraction Kit (Thermo Scientific company of the U.S.), the small extraction reagent kit of rapid plasmid (Beijing Tiangeng biochemical technology Co., Ltd), Annealing Buffer (Origene company of the U.S.), T4DNA Ligase (HC) and Super Total RNA extraction reagent box (Promega (Beijing) Bioisystech Co., Ltd), SC-His yeast culture medium and SC-Ura-Leu ferment Female culture medium (the general Jino Science and Technology Ltd. in Beijing), the yeast culture medium laboratory saccharomyces cerevisiae BY4741 save, p426- SNR52p-gRNA carrier for expression of eukaryon and p414-TEF1p-Cas9-CYC1t carrier for expression of eukaryon are purchased from Addgene, and primer closes It is completed at sequencing by Beijing Rui Bo company.

The building of embodiment 1, Erg1 yeast defect bacterium

One, website http is designed using yeast CRISPR/Cas9gRNA: // yeastriction.tnw.tudelft.nl/#！/ screening of the site gRNA is carried out to ERG1 gene, ERG1 gene gRNA sequence is such as Following table.

1 ERG1 gene gRNA sequence of table

Two, gRNA vector construction

GRNA sequence is added to gRNA skeleton front end by the method for design of primers, the method for using RF to clone is with p426- SNR52p-gRNA carrier for expression of eukaryon (purchase of the official website Addgene) is that template clones to obtain linear carrier sequence, and is connected by T4 It connects enzyme and carries out blunt end cloning, the gRNA carrier in the site of the gene specific of ERG1 containing yeast identification can be obtained.Primer information It is as follows:

2 gRNA vector construction primer of table

1, RF is cloned

System:

Reaction condition:

* Tm value is the annealing temperature of primer, and extension of time is set according to the length of primer

2, linear carrier purifies

Above-mentioned PCR product is taken out, respectively takes 5uL to add 6 × Loading Buffer of 2 μ L, is compareed with 8k Marker, Run 1.0% Ago-Gel (180V, 10min).After seeing purpose amplified band, the DMT of 1uL is added in resultant product Enzyme mixes, and digests at 37 DEG C one hour (purpose is removal template plasmid DNA, to reduce false positive).It will be in reacted product Be added 10uL 6 × Loading Buffer, compareed with 8k Marker, run 1.5% Ago-Gel (120V, 30min).Under ultraviolet bale cutting instrument, purpose band is cut, recycles segment with Ago-Gel DNA QIAquick Gel Extraction Kit, step is such as Under:

(1) equimultiple volume solution B inding Buffer is added into blob of viscose, and (if gel weight is 0.1g, volume is visual For 100 μ L, then 100 μ L Binding Buffer solution are added), 55 DEG C of water-baths are placed, constantly leniently spin upside down therebetween from Heart pipe, to ensure that blob of viscose sufficiently dissolves.If can continue to place a few minutes or add some colloidal sols again there are also not molten blob of viscose Liquid, until blob of viscose is completely dissolved and (if the volume of blob of viscose is excessive, blob of viscose can be cut into fragment in advance).

(2) glue being completely dissolved being added in adsorption column (adsorption column is put into collecting pipe), 12000rpm is centrifuged 60s, The waste liquid in collecting pipe is outwelled, adsorption column is put into collecting pipe.

(4) 700 μ l rinsing liquid Wash Buffer are added into adsorption column and (anhydrous second have been added using preceding first check whether Alcohol), 12000rpm is centrifuged 60s, outwells the waste liquid in collecting pipe, adsorption column is put into collecting pipe.

(5) 12000rpm void column is centrifuged 1min, eliminates rinsing liquid as far as possible.Adsorption column is placed in new 1.5mL centrifuge tube, Wave alcohol.

(6) sterile water of 20 μ l preheating is added into adsorption column filter membrane, is placed at room temperature for 1min.12000rpm is centrifuged 1min and receives Set dna solution.

3, carrier connects

The carrier segments concentration obtained using NanoDrop measurement recycling, prepares coupled reaction system according to following ratio:

Condition: 25 DEG C of 2h

4, connection product converts

(1) above-mentioned connection product is all added in the DMT competent cell of 100 μ L, 30min is placed in ice；

After (2) 42 DEG C of heat shock 1min, then place 2min in ice；

(3) the addition not antibiotic LB culture medium of 1mL, 30 DEG C, 180rpm shaken cultivation 1h；

(4) it draws 200 μ L bacterium solutions to be coated on LB+Amp film solid media, 30 DEG C of * cultivate 14h, observe bacterium colony growing state.

* the plasmid is temperature-sensitive plasmid, therefore is cultivated using 30 DEG C of low temperature its host strain.

5, bacterium solution PCR verifies positive bacterium colony

In super-clean bench, with the single bacterium colony in the sterilized white pipette tips picking plate of 10 μ L, it is placed in LB+Amp culture medium In, 30 DEG C, after 250rpm constant-temperature shaking culture about 1-2h, 1 μ L bacterium solution is taken to carry out bacterium solution PCR, testing goal segment whether with load On body effectively connects.

PCR reaction system:

PCR reaction condition:

PCR product is observed in gel imager after the detection of 1% agarose gel electrophoresis.700bp or so mesh to occur The bacterium solution of segment band send sequencing company to be sequenced；The bacterial strain of the sequencing result positive is chosen, the glycerol for being added 20% is stored in -80 In DEG C refrigerator, and it is stand-by to draw LB+Amp plate.

Three, Cas9 vector modification

Since the selection markers TRP of p414-TEF1p-Cas9-CYC1t carrier is not suitable for BY4741 yeast, this reality Test it is middle TRP selection markers are replaced with into LEU by the way of seamless spliced, LEU sequence template deposits pESC-LEU by laboratory Plasmid.

3 Cas9 vector modification primer of table

(1) it is as template amplification LEU sequence, with p414-TEF1p-Cas9-CYC1t plasmid using pESC-LEU plasmid respectively Template amplification TRP upstream sequence, downstream sequence, primer are LEU-F/R, U-F/R, D-F/R respectively.

(2) p414-TEF1p-Cas9-CYC1t plasmid double digestion

The DraIII of the SnaBI restriction endonuclease sites and downstream 323bp of choosing TRP1 ORF upstream 148bp is restricted Restriction enzyme site.

Condition: 37 DEG C of 2h

(3) each segment of gel extraction, operation are same as above.

(4) In-Fusion reacts

Note: n (carrier): n (segment)=1:2

Condition: 50 DEG C of incubation 15min；It places on ice.

(5) 10 μ L splicing products are transformed into 50 μ L Trans1-T1 competent cells, it is solid to apply LB+Amp for 30 DEG C of recoveries Body culture medium, 30 DEG C of overnight incubations.

(6) picking single colonie, 30 DEG C of LB+Amp fluid nutrient medium, 250rpm shakes 4~6h of training, and bacterium solution PCR verifying, primer is such as Under, if PCR product the band near 1740bp occurs through agarose gel electrophoresis detection, send company to be sequenced corresponding bacterium solution.

8 Cas9 vector modification bacterium solution PCR primer of table

(7) correct bacterium solution will be sequenced and shake training, extract plasmid, and by the glycerol of addition 20% in bacterium solution, -80 DEG C are frozen.

Four, the acquisition of dsOligo

In order to obtain the mutant strain of specific genotype, double-stranded DNA (dsOligo) is needed to mediate homologous recombination repair.? In saccharomyces cerevisiae, homologous arm lengths can be obtained 80% or more the homologous recombination efficiency obtained when being 60bp, takes and deletes in this experiment Except the mode of whole gene achievees the purpose that gene knockout, i.e., the homology arm of 60bp is respectively designed (altogether in gene ORF upstream and downstream 120bp) target gene is knocked out by homologous recombination repair.The dsOligo of ERG1 gene is using the 120nt long-chain synthesized Oligo anneals to form DNA double chain, and recovery purifying obtains.

Oligo anneals to form double-strand:

(1) by one pipe of 4OD oligo synthesis, ddH is used₂O is diluted to 10pmol/ μ L, oligo sequence such as following table.

Table 3-9 dsOligo sequence

Condition: 95 DEG C of 5min

95~25 DEG C -1 DEG C/min 71cycles

10℃ hold

(2) dsOligo is purified

By annealed product according to Gene JET Gel Extraction Kit plastic recovery kit recovery purifying, step is such as Under:

1. according to volume ratio annealing system: isopropanol: the amount mixing of Binding Buffer=1:1:1；

2. mixed liquor is transferred in Gene JET gene recovery purifying column, 12000rpm is centrifuged 1min, discards efflux, Then column is put back into identical collecting pipe；

3. 700 μ LWash Buffer (being diluted with ethyl alcohol) are added to Gene JET purification column.12000rpm centrifugation 1min discards efflux, and column is then put back to identical collecting pipe；

4. being centrifuged sky GeneJET purification column 12000rpm is centrifuged 1min, remaining Wash Buffer is completely removed；

5. Gene JET purification column is transferred to a clean 1.5mL centrifuge tube, add 20 μ L ddH₂O (can 60 DEG C it is pre- Heat) in purification column film, 12000rpm is centrifuged 1min, abandons purification column, centrifugation gained liquid is the purpose dsOligo purified.

(3) concentration is surveyed, is tested for subsequent yeast conversion.

Five, prepared by BY4741 Competent cell

According to Frozen-EZ Yeast Transformation II^TMKit specification carries out yeast Competent The preparation of cell, steps are as follows:

(1) BY4741 bacterium solution is drawn into YPD solid culture plate, picking single bacterium falls within 10mL YPD fluid nutrient medium after 48h In 30 DEG C, 220rpm is incubated overnight, until OD₆₀₀=0.8-1.0.

(2) 500 × g are centrifuged 4min and precipitate thallus, abandon supernatant；

(3) 10mL EZ1 resuspension, washing thalline, 500 × g are centrifuged 4min, abandon supernatant；

(4) thallus is resuspended in 1mL EZ2, and every 50 μ L packing, one pipe is spare.

Note: the competent cell prepared can be converted directly or slow cooling freeze to -80 DEG C (4 DEG C, 1h；- 20 DEG C, 1h；-80℃).

Six, the conversion of Cas9 carrier, gRNA carrier and homologous fragment

(1) 1 μ g of 0.2-1 μ g (≤5 μ L) Cas9 plasmid pZJW01, gRNA about 500ng, Erg1dsOligo is taken, according to not Mixed system is made into knockout purpose to be added in 100 μ L BY4741 competent cells；

(2) 500 μ L EZ3 solution are added, thoroughly mix；

(3) 30 DEG C of incubation 45min, rock 2-3 times in the process；

(4) it takes 200 μ L of bacterium solution to be coated on screening and culturing medium SC-Leu-Ura and adds ergosterol (20ug/mL) solid medium On, 30 DEG C of 48~72h of anaerobic culture.

(5) single colonie that picking is grown is cultivated in YPD plus ergosterol (20ug/mL) fluid nutrient medium, until culture medium Muddiness, the bacterial strain not to be transformed carry out PCR with following primer pair bacterium solution, whether testing goal gene mutates as control.

11 abrupt climatic change primer of table

Agarose gel electrophoresis detection, send company to be sequenced positive PCR product, and it is to be mutated successfully that correct bacterial strain, which is sequenced, Bacterial strain.Gel electrophoresis and sequencing result are shown, successfully by the ERG1 gene knockout in yeast BY4741 (see Fig. 2).

(6) successful erg1 defect saccharomycete will be sequenced and expand 5mL culture by one thousandth, in 30 DEG C of anaerobic culture conditions Under (YPD adds ergosterol (20ug/mL) fluid nutrient medium) culture to muddiness.Bacterium solution is taken to add ergosterol solid culture in YPD Plank is drawn on base, respectively at aerobic or 30 DEG C of oxygen free condition cultures, further verifies whether ERG1 gene knocks out completely.

Since the biosynthesis of sterol in ERG1 gene pairs yeast plays an important role, the ferment of ERG1 gene is knocked out Mother can not survive in the case where lacking sterol.In addition, there is exclusiveness to exogenous sterol since yeast is under aerobic conditions, Therefore, under aerobic conditions, it can not be absorbed and utilized and grow ergosterol is added even if in culture medium.This experimental result is aobvious Show, knocks out the yeast defect bacterium of ERG1 gene under conditions of aerobic, even if ergosterol is added in culture medium, can not also grow (see Fig. 3).The results show, erg1 yeast defect bacterium construct successfully.

Embodiment 2, tripterygium wilfordii epoxy squalene cyclase gene full-length clone

One, thunder god vine suspending cell Total RNAs extraction

1, the culture and induction of thunder god vine suspending cell

(1) MS culture (containing hormone) is prepared: 4.43gL^-1MS, 0.5mg.L^-12,4-D, 0.1mgL^-1KT, 0.5mg.L^-1IBA, 30gL^-1Sucrose adjusts pH=5.8.Then 121 DEG C, high steam pot sterilizing 20min.

(2) elicitor methyl jasmonate (MeJA) solution is prepared: 115 μ L 95%MeJA being dissolved in 885 μ L DMSO, are matched 0.5M MeJA mother liquor is made.MeJA used in preparation and DMSO uses 0.22 μm of filtering with microporous membrane, and in gnotobasis Mixing.

(3) about 2g suspension cell, is aseptically inoculated in by the thunder god vine suspending cell for taking MS Liquid Culture to save Squamous subculture is carried out in 100mL triangular flask equipped with 25mL MS fluid nutrient medium, is used as test material after culture to 10d.Culture Condition is 25 ± 1 DEG C, 120rpm, and suspend culture under dark condition.

(4) MeJA is handled: being separately added into final concentration of 50 μ of MeJA into the thunder god vine suspending cell culture medium of culture 10d mol·L^-1Induction processing is carried out, same amount of solvent DMSO is added in control group.12,24 and 48h after treatment filters receipts respectively Suspension cell is obtained, 3 biology of each time point repeat, and -80 DEG C of preservations (are extracted total after liquid nitrogen flash freezer after being blotted with filter paper RNA)。

2、Super total RNA extraction reagent box extracts thunder god vine suspending cell:

(1) it takes about 50mg suspension cell in 2mL EP, is crushed under liquid nitrogen environment.

(2) 500 μ L RNA lysates are added in the sample crushed, overturn centrifuge tube 3~4 times, mixes.

(3) 500 μ L dilutions are added, liquid-transfering gun mixes, and 14000rpm is centrifuged 5min.

(4) dehydrated alcohol of 0.5 times of volume is added in the supernatant after being centrifuged, mixes.

(5) mixed liquor is transferred in centrifugal column, 12000~14000rpm is centrifuged 1min, abandons filtrate.

(6) 600 μ L washing lotions are added into centrifugal column, 12000~14000rpm is centrifuged 45s, abandons filtrate.

(7) 50 μ L DNA enzymatic I are added, are incubated for 15min.

μ L RNase-free water stands two minutes, and 12000~14000rpm is centrifuged 1min, collects RNA, -70 DEG C of preservations. (RNA mentions Total RNA

(8) 600 μ L washing lotions are added into centrifugal column, 12000~14000rpm is centrifuged 45s, abandons filtrate.It is repeated once.

(9) void column is centrifuged 2min.

(10) into centrifugal column be added 50~200 μ L RNase-free water, stand two minutes, 12000~14000rpm from Heart 1min collects RNA, -70 DEG C of preservations.(RNA extracts result and sees Fig. 4)

Two, reversion obtains the first chain cDNA

(1) genomic DNA is removed

42 DEG C, 3min.

(2) the first chain cDNA is inverted

42 DEG C, 15min；95 DEG C, 3min.

Three, Twse full length gene is cloned

According to transcript profile data, tripterygium wilfordii squalene epoxidase enzymes gene specific primer is designed:

3 Twse full-length clone primer of table

Full-length clone PCR reaction system:

* template DNA is the tripterygium wilfordii cDNA inverted in above-mentioned embodiment 2

Overall length PCR response procedures:

The 2k plus Marker of 6 × Loading Buffer (Tiangeng) that PCR product takes 5 μ L to add 2 μ L, 5 μ L are compareed, Run 1% Ago-Gel (180V, 10min), test strip size (Fig. 5).

After confirming stripe size, resultant product respectively adds the 2k plus Marker of the 6xLoading Buffer, 10 μ L of 9 μ L It compares, runs 1.5% Ago-Gel (120V, 30min).

Under ultraviolet bale cutting instrument, purpose band is cut, recycles segment with Ago-Gel DNA QIAquick Gel Extraction Kit:

(1) gel containing DNA fragmentation is cut with scalpel or slasher, is cut as far as possible close to DNA fragmentation, by glue Piece is placed on the 1.5mL centrifuge tube weighed in advance and weighs.The weight of recording film.

(2) plus the Binding Buffer of 1:1 amount (is measured by weight, such as every 100mg Ago-Gel adds into film The Binding Buffer of 100 μ L)；

(3) gel mixture 10min is incubated under conditions of 50-60 DEG C, is during which mixed by inversion 2-3 times, and glue is promoted to melt, Guarantee that glue all dissolves；

(4) most 800 μ L gel lysates are shifted to gene recovery purifying column, 12000rpm is centrifuged 1min, discards outflow Then column is put back to identical collecting pipe by liquid；

(5) 700 μ L Wash Buffer (being diluted with ethyl alcohol) are added and arrive Gene JET purification column.12000rpm centrifugation 1min discards efflux, and column is then put back to identical collecting pipe；

(6) centrifugation sky GeneJET purification column 12000rpm is centrifuged 1min, completely removes remaining Wash Buffer；

(7) Gene JET purification column is transferred to a clean 1.5mL centrifuge tube, adds 30-50 μ L ddH₂O (can be 60 DEG C Preheating) in purification column film, 12000rpm is centrifuged 1min；

(8) it loses Gene JET purification column and stores the DNA of purifying at -20 DEG C.

Four, carrier T connection, competence conversion and positive colony PCR identification

It is real using pEASY-T3Cloning Vector or pEASY-Blunt Vector (Beijing Quan Shijin biotech firm) Universal primer (M13Forward Primer:5 '-GTAAAACGACGGCCAGT-3 ' is synthesized before testing；M13Reverse Primer: 5'-CAGGAAACAGCTATGAC-3')；Or positive colony PCR identification is carried out using segment special primer.

(1) pEASY-T3Cloning Vector or pEASY Blunt Vector operation instructions are referred to, T is carried out and carries company It connects；

(2) whole T load connection product (5 μ L) is added in the DH5 α competent cell of 50 μ L, 30min is placed in ice；

(3) 42 DEG C of heating 60-90s, then place 2min in ice；

(4) the LB culture medium of 500 μ L is added, is placed in shaking table and cultivates 45-60min, condition of culture is 37 DEG C, 180rpm；

(5) after taking out, in super-clean bench, bacterium solution is spread evenly across on LB+AMP plate with spreader to (AMP is final concentration of 100mg·L^-1, subsequent LB+AMP used concentration thus), after bacterium solution absorbs completely, culture is inverted in 37 DEG C of insulating boxs 12-16h；

(6) after bacterium colony is grown, the picking monoclonal colonies in super-clean bench are gone to containing 1mL LB+AMP fluid nutrient medium EP pipe in；

(7) 3-6h is cultivated on shaking table, condition of culture is 37 DEG C, 250rpm；

(8) take 1 μ L bacterium solution as pcr template, whether testing goal segment connects carrier；

PCR reaction system:

PCR reaction condition:

(9) agarose gel electrophoresis detects PCR product, the bacterium solution of target fragment band will occurs, sequencing company is sent to be sequenced.

Five, escherichia coli plasmid extracts

(1) it takes positive colony and correct bacterium solution is sequenced, be transferred to the training of 20mL LB+AMP liquid in millesimal ratio It supports in base, 12-16h is cultivated on shaking table, condition of culture is 37 DEG C, 250rpm；

(2) plasmid in bacterium solution is extracted using Plasmid Mini Kit kit (OMEGA), knows the details step reference Book；

(3) plasmid concentration is measured with nucleic acid quantification instrument, deposits in -20 DEG C.

Five, construction of eukaryotic expression vector

(1) Twse gene open reading frame (ORF) expands:

3 Twse ORF cloning primer of table

PCR system, reaction condition and DNA fragmentation recycling step are same as above.

(2) pESC-his carrier double digestion

Double enzyme digestion reaction system:

* DNA is pESC-his carrier, and restriction endonuclease is each 1 μ L of NotI and PacI.

Condition: 37 DEG C, 2h.

Digestion products add the 2k plus Marker of the 6xloading Buffer, 10 μ L of 9 μ L to compare, and run 1.5% Ago-Gel (120V, 30min).Under ultraviolet bale cutting instrument, purpose band is cut, with Ago-Gel DNA reclaim reagent Box recycling segment step is same as above.

(3) carrier and segment are seamless spliced

Linked system:

* in 10 μ L reaction systems, carrier and each Insert Fragment additional amount are in 0.01-0.25pmols, carrier and each segment Optimum mole ratio be 1:2.Pmols=mass ng/ (fragment length bp × 0.65kDa)

Condition: 50 DEG C, 15min.

Five, it converts, verifying, upgrading grain

(1) it takes above-mentioned linked system to be added in the Trans1-T1 competent cell of 50 μ L, 30min is placed in ice；

After (2) 42 DEG C of heat shock 1min, then places and stand 2min in ice；

(3) the LB culture mediums without Amp of 42 DEG C of 500 μ L preheatings of addition, 37 DEG C, 180rpm shaken cultivation 60min；

(4) about 200 μ L bacterium solutions are drawn to be coated on LB+Amp culture plate, culture 12- is inverted under 37 DEG C of dark conditions 16h；

(5) operate in super-clean bench of the picking single colonie process after ultraviolet disinfection: the single colonie in picking plate is placed in In LB+Amp fluid nutrient medium, 37 DEG C, after 250rpm constant-temperature shaking culture about 1-2h, 1 μ L bacterium solution is taken to carry out PCR, testing goal Whether segment effectively connect with carrier.

PCR reaction system:

PCR reaction condition:

(remarks: * indicates segment > 3kb of PCR product, and often adds 1kb then extension of time extension 1min)

Product is observed in gel imager after the detection of 1% agarose gel electrophoresis.Target fragment band to occur Bacterium solution send company to be sequenced；

(6) according to sequencing result, the correct bacterium solution of sequencing result is chosen in millesimal ratio and expands culture, 250rpm, 37 DEG C of culture 10-12h.

(7) bacterium solution for taking 1-4mL to be incubated overnight is added in centrifuge tube, and 12,000rpm (~13,400 × g) are centrifuged 1min, Absorb supernatant (bacterial sediment can be collected into a centrifuge tube by being repeatedly centrifuged when bacterium solution is more) as far as possible.

(8) be added into the centrifuge tube there are bacterial sediment 150 μ L solution P1 (check whether be added RNase A and TIANRed), precipitated using pipettor or the thorough suspended bacterial of turbula shaker.

(9) 150 μ L solution P2 are added into centrifuge tube, leniently spinning upside down 6-8 times cracks thallus sufficiently.

(10) 350 μ L solution P5 are added into centrifuge tube, rapidly turns upside down mix 12-20 times immediately, mix well, To occur flocculent deposit at this time.12,000rpm(_~13,400 × g) centrifugation 2min.

(11) supernatant that previous step is collected is transferred in adsorption column CP3 with pipettor to (adsorption column is put into collecting pipe In), pay attention to trying not that precipitating is sucked out.12,000rpm (~13,400 × g) are centrifuged 30sec, outwell the waste liquid in collecting pipe, Adsorption column CP3 is put into collecting pipe.

(12) it is added 300 μ L rinsing liquid PWT (dehydrated alcohol has been added) into adsorption column CP3,12,000rpm (~13, 400 × g) centrifugation 30sec, outwells the waste liquid in collecting pipe, adsorption column CP3 is put into collecting pipe.

(13) adsorption column CP3 is put into collecting pipe, 12,000rpm (~13,400 × g) are centrifuged 1min.

(14) adsorption column CP3 is placed in a clean centrifuge tube, it is sterile that 30 μ L are added dropwise to the intermediate position of adsorbed film Plasmid solution is collected into centrifuge tube by water, 12,000rpm (~13,400 × g) centrifugation 1min.Three pipes unification pipe, -20 DEG C of guarantors It deposits.

Embodiment 3, the verifying of tripterygium wilfordii squalene epoxidase enzymes gene function

One, prepared by Erg1 defect competent yeast

(1) picking constructs successful erg1 single colonie, in 30 DEG C of oxygen free conditions of 20mL YPD+ ergosterol (20ug/mL) It is lower to cultivate to OD₆₀₀=0.8-1.0.

Two, function complementation experiment

(1) 0.2-1 μ g (≤5 μ L) pESC-his-Twse plasmid or pESC-his plasmid (as control) is taken to be separately added into Into 50 μ L erg1 competent cells；

(2) 500 μ L EZ3 solution are added, thoroughly mix；

(3) 30 DEG C of incubation 45min, rock 2-3 times in the process；

(4) 200 μ L of bacterium solution is taken to be coated on screening and culturing medium SC-his+ ergosterol (20ug/mL) solid medium, point 48~72h is not cultivated under 30 DEG C aerobic and oxygen free condition.

Experimental result is shown: (see the left side Fig. 6 1) under oxygen free condition, erg1 yeast defect bacterium can not add etembonate in SC-his (a) is grown in alcohol culture medium, be transferred to the erg1 yeast defect bacterium of pESC-his empty carrier and is transferred to pESC-his-Twse carrier Erg1 yeast defect bacterium can add in ergosterol culture medium in SC-his to be grown.Under conditions of aerobic (right side Fig. 6 2), only There is the erg1 yeast defect bacterium for being transferred to pESC-his-Twse carrier that can be transferred to unloaded and not be transferred to carrier in middle growth Erg1 defect saccharomycete can not all be grown.The results show: tripterygium wilfordii Twse gene has biological function.

Sequence table

<110>Capital University of Medical Sciences

<120>a kind of ERG1 gene defect Yeast engineering bacteria, its construction method and its utilization

<141> 2018-08-08

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1771

<212> DNA

<213>artificial sequence ()

<400> 1

ttcggtagag acaggggagc gagagagact gttattgtgt tccttgcttc tatctggatt 60

tgcatttcga aatggtggat cactgtttgc tcggctggat cctggcctcg gtgctcgggt 120

tcttcacttt gtattttttg gtgttgaagc ggacggatga cgagaagaga gcggttttgg 180

aggcgagaag agagggcatg gagagtctca acacgacaaa cggagaatgt agatctagtg 240

acggcgaaga cgtcgacgtc atcattgtag gagctggcgt cgccggagcc gctcttgctc 300

acactctcgg caaggatgga cgtagagtac gtgtaattga aagagacttg acagagcctg 360

accgcatagt tggtgaattg ctacaaccag ggggctacct caaattgatt gagttgggac 420

ttgaagattg tgttgaagaa attgatgctc aacgagtgtt tggctatgcc ttgtttaagg 480

atgggaaaaa tactcgactt tcttatccct tggaaaagtt tcattcagac gtctcaggga 540

gaagttttca caatggacgt ttcatacaga ggatgcgaca gaaatctgca tcgcttccaa 600

atgtacgatt ggagcaagga actgttactt ctctgctaga agcagatggg ataattaggg 660

gtgtgcagta caaaactaaa agtggggaag aacttaaagc atatgcttct ctgaccattg 720

tgtgtgatgg ctgtttctca aacttgcgac gctccctctg caaaccaaag gttgatgtac 780

cttcttgttt tgttggtttg attctcgaga attgcaacct tccacatgca aatcatggac 840

atgttatcct tggagatcct tcccctattt tgtgttatcc tatcagtagt actgaggttc 900

gctgtctagt tgatgtacct ggtcagaagg ttccctcaat ctcaaacggc gaaatggcaa 960

agtatttgaa gaccatggtg gctccacagc ttcctcctga agtccacgat tcctttgtgg 1020

ctgctgttga taagggaaac cttagaacaa tgccaaaccg aagcatgcca gcttctccct 1080

atcatactcc tggagctttg ttgatggggg atgcattcaa catgcgccac cctctaacag 1140

ggggaggaat gactgtggca ctcgctgata ttgtcgtgct gcggaatctt ctgagacctt 1200

tgcatgactt gaatgacgca cctacccttt gcaaatatct tgaatctttc tacacactgc 1260

gtaagcccgt ggcatccaca atcaacacac tggcaggtgc tttatacaag gtgttttgtg 1320

cctcacctga tcaagcaaga aaggaaatgc gtgaggcttg ctttgattat ttgagtcttg 1380

gaggggtttt cgctgcagga cctgtctctt tgctgtcggg tttaaaccca cgccccttaa 1440

gtttagtttg ccacttcttt gctgttgctg tattcggtgt tggacgttta ttattgccat 1500

tcccttcacc taaacgaatc tggatcggag ctagagtgat cacgagtgca tcaggaatca 1560

tcttccccat cattaaggct gaaggagtaa ggcaaatgtt ctttccggca acggttccag 1620

catactatcg agctcctccc accaagtgag atccaagtat taaggcaact gttaatccta 1680

gtccctagtt attatcatct acgttcccac ccttaaagtg aagggcaagg ttgaatgttt 1740

catcaaaaag ggtgtccctt accgcatcta a 1771

<210> 2

<211> 525

<212> PRT

<213>artificial sequence ()

<400> 2

Met Val Asp His Cys Leu Leu Gly Trp Ile Leu Ala Ser Val Leu Gly

1 5 10 15

Phe Phe Thr Leu Tyr Phe Leu Val Leu Lys Arg Thr Asp Asp Glu Lys

20 25 30

Arg Ala Val Leu Glu Ala Arg Arg Glu Gly Met Glu Ser Leu Asn Thr

35 40 45

Thr Asn Gly Glu Cys Arg Ser Ser Asp Gly Glu Asp Val Asp Val Ile

50 55 60

Ile Val Gly Ala Gly Val Ala Gly Ala Ala Leu Ala His Thr Leu Gly

65 70 75 80

Lys Asp Gly Arg Arg Val Arg Val Ile Glu Arg Asp Leu Thr Glu Pro

85 90 95

Asp Arg Ile Val Gly Glu Leu Leu Gln Pro Gly Gly Tyr Leu Lys Leu

100 105 110

Ile Glu Leu Gly Leu Glu Asp Cys Val Glu Glu Ile Asp Ala Gln Arg

115 120 125

Val Phe Gly Tyr Ala Leu Phe Lys Asp Gly Lys Asn Thr Arg Leu Ser

130 135 140

Tyr Pro Leu Glu Lys Phe His Ser Asp Val Ser Gly Arg Ser Phe His

145 150 155 160

Asn Gly Arg Phe Ile Gln Arg Met Arg Gln Lys Ser Ala Ser Leu Pro

165 170 175

Asn Val Arg Leu Glu Gln Gly Thr Val Thr Ser Leu Leu Glu Ala Asp

180 185 190

Gly Ile Ile Arg Gly Val Gln Tyr Lys Thr Lys Ser Gly Glu Glu Leu

195 200 205

Lys Ala Tyr Ala Ser Leu Thr Ile Val Cys Asp Gly Cys Phe Ser Asn

210 215 220

Leu Arg Arg Ser Leu Cys Lys Pro Lys Val Asp Val Pro Ser Cys Phe

225 230 235 240

Val Gly Leu Ile Leu Glu Asn Cys Asn Leu Pro His Ala Asn His Gly

245 250 255

His Val Ile Leu Gly Asp Pro Ser Pro Ile Leu Cys Tyr Pro Ile Ser

260 265 270

Ser Thr Glu Val Arg Cys Leu Val Asp Val Pro Gly Gln Lys Val Pro

275 280 285

Ser Ile Ser Asn Gly Glu Met Ala Lys Tyr Leu Lys Thr Met Val Ala

290 295 300

Pro Gln Leu Pro Pro Glu Val His Asp Ser Phe Val Ala Ala Val Asp

305 310 315 320

Lys Gly Asn Leu Arg Thr Met Pro Asn Arg Ser Met Pro Ala Ser Pro

325 330 335

Tyr His Thr Pro Gly Ala Leu Leu Met Gly Asp Ala Phe Asn Met Arg

340 345 350

His Pro Leu Thr Gly Gly Gly Met Thr Val Ala Leu Ala Asp Ile Val

355 360 365

Val Leu Arg Asn Leu Leu Arg Pro Leu His Asp Leu Asn Asp Ala Pro

370 375 380

Thr Leu Cys Lys Tyr Leu Glu Ser Phe Tyr Thr Leu Arg Lys Pro Val

385 390 395 400

Ala Ser Thr Ile Asn Thr Leu Ala Gly Ala Leu Tyr Lys Val Phe Cys

405 410 415

Ala Ser Pro Asp Gln Ala Arg Lys Glu Met Arg Glu Ala Cys Phe Asp

420 425 430

Tyr Leu Ser Leu Gly Gly Val Phe Ala Ala Gly Pro Val Ser Leu Leu

435 440 445

Ser Gly Leu Asn Pro Arg Pro Leu Ser Leu Val Cys His Phe Phe Ala

450 455 460

Val Ala Val Phe Gly Val Gly Arg Leu Leu Leu Pro Phe Pro Ser Pro

465 470 475 480

Lys Arg Ile Trp Ile Gly Ala Arg Val Ile Thr Ser Ala Ser Gly Ile

485 490 495

Ile Phe Pro Ile Ile Lys Ala Glu Gly Val Arg Gln Met Phe Phe Pro

500 505 510

Ala Thr Val Pro Ala Tyr Tyr Arg Ala Pro Pro Thr Lys

515 520 525

<210> 3

<211> 20

<212> DNA

<213>artificial sequence ()

<400> 3

tatcttttca cgtttcagaa 20

<210> 4

<211> 35

<212> DNA

<213>artificial sequence ()

<400> 4

tatcttttca cgtttcagaa gttttagagc tagaa 35

<210> 5

<211> 27

<212> DNA

<213>artificial sequence ()

<400> 5

gatcatttat ctttcactgc ggagaag 27

<210> 6

<211> 38

<212> DNA

<213>artificial sequence ()

<400> 6

atagcttgtc accttacgta caatcttgat ccggagct 38

<210> 7

<211> 35

<212> DNA

<213>artificial sequence ()

<400> 7

cttaggggca gacatactcc aagctgcctt tgtgt 35

<210> 8

<211> 35

<212> DNA

<213>artificial sequence ()

<400> 8

aaggcagctt ggagtatgtc tgcccctaag aagat 35

<210> 9

<211> 41

<212> DNA

<213>artificial sequence ()

<400> 9

tactactcag taataactta agcaaggatt ttcttaactt c 41

<210> 10

<211> 39

<212> DNA

<213>artificial sequence ()

<400> 10

agaaaatcct tgcttaagtt attactgagt agtatttat 39

<210> 11

<211> 35

<212> DNA

<213>artificial sequence ()

<400> 11

agggtgatgg ttcacgtagt gggccatcgc cctga 35

<210> 12

<211> 23

<212> DNA

<213>artificial sequence ()

<400> 12

gcaccataaa cgacattact ata 23

<210> 13

<211> 21

<212> DNA

<213>artificial sequence ()

<400> 13

accccaaaaa acttgattag g 21

<210> 14

<211> 120

<212> DNA

<213>artificial sequence ()

<400> 14

caggttattt cgaacaattg aaaaaaaaaa atcacagaaa aacatatcga gaaaagggtc 60

ctacagctta taagggagag aggataggaa ccgtcaaaca ttaagctgca cctttttttt 120

<210> 15

<211> 120

<212> DNA

<213>artificial sequence ()

<400> 15

aaaaaaaagg tgcagcttaa tgtttgacgg ttcctatcct ctctccctta taagctgtag 60

gacccttttc tcgatatgtt tttctgtgat tttttttttt caattgttcg aaataacctg 120

<210> 16

<211> 21

<212> DNA

<213>artificial sequence ()

<400> 16

cattacgcct atctaatctc c 21

<210> 17

<211> 19

<212> DNA

<213>artificial sequence ()

<400> 17

ttgacggttc ctatcctct 19

<210> 18

<211> 19

<212> DNA

<213>artificial sequence ()

<400> 18

ttcggtagag acaggggag 19

<210> 19

<211> 19

<212> DNA

<213>artificial sequence ()

<400> 19

ttagatgcgg taagggaca 19

<210> 20

<211> 37

<212> DNA

<213>artificial sequence ()

<400> 20

aaccctcact aaagggcatg gtggatcact gtttgct 37

<210> 21

<211> 37

<212> DNA

<213>artificial sequence ()

<400> 21

ctggcgaaga attgttaatt cacttggtgg gaggagc 37

Claims

1. a kind of method for knocking out saccharomycete ERG1 gene, which comprises

(1) site gRNA of ERG1 gene is screened；

(2) building knocks out the expression vector of ERG1 gene；

(4) double-stranded DNA (dsOligo) of ERG1 gene is obtained

(5) yeast Competent cell is prepared；

(6) by the ERG1 double-stranded DNA of the expression vector for having knocked out ERG1 gene, the Cas9 carrier being transformed and synthesis convert to Suddenly in the competent cell in (5), the saccharomycete for being mutated successful ERG1 gene defect is obtained.

2. according to the method described in claim 1, the method are as follows:

TATCTTTTCACGTTTCAGAA；

(2) it using EGR1-F and EGR1-R as primer, clones to obtain line as template using p426-SNR52p-gRNA carrier for expression of eukaryon Property carrier, and with T4 ligase carry out blunt end cloning, building obtain knock out ERG1 gene gRNA expression vector,

The primer sequence are as follows:

ERG1-F:TATCTTTTCACGTTTCAGAAGTTTTAGAGCTAGAA,

ERG1-R:GATCATTTATCTTTCACTGCGGAGAAG；

(4) design knocks out the dsOligo of ERG1 gene, is knocked out by homologous recombination repair to target gene, the ERG1- The sequence of Oligo-F and ROX1-Oligo-R are as follows:

ERG1-Oligo-F:

CAGGTTATTTCGAACAATTGAAAAAAAAAAATCACAGAAAAACATATCGAGAAAAGGGTCCTACAGCTTATAA GGGAGAGAGGATAGGAACCGTCAAACATTAAGCTGCACCTTTTTTTT,

ERG1-Oligo-R:

AAAAAAAAGGTGCAGCTTAATGTTTGACGGTTCCTATCCTCTCTCCCTTATAAGCTGTAGGACCCTTTTCTCG ATATGTTTTTCTGTGATTTTTTTTTTTCAATTGTTCGAAATAACCTG,

The dsOligo of the ERG1 gene is obtained by annealing ERG1-Oligo-F and ROX1-Oligo-R to form DNA double chain, And recovery purifying both obtains；

(5) according to Frozen-EZ Yeast Transformation II^TMKit specification prepares yeast Competent Cell；

(6) by the gRNA carrier of the specific recognition site containing yeast ERG1 gene, the Cas9 carrier being transformed and synthesis ERG1 double-stranded DNA convert in the competent cell into rapid (5), anaerobic culture, is obtained on screening and culturing medium SC-Leu-Ura The saccharomycete of successful ERG1 gene defect must be mutated.

3. method of any of claims 1 or 2, wherein the saccharomycete is GEN.PK system S. cervisiae or BY system saccharomyces cerevisiae Bacterium, preferably BY system saccharomyces cerevisiae, such as BY4741 saccharomyces cerevisiae.

4. a kind of gene defection type Yeast engineering bacteria, the gene defection type Yeast engineering bacteria is the yeast for having lacked ERG1 gene Engineering bacteria.

5. gene defection type Yeast engineering bacteria according to claim 4, wherein the Yeast engineering bacteria is GEN.PK system wine Brewer yeast bacterium or BY system S. cervisiae, preferably BY system saccharomyces cerevisiae, such as BY4741 saccharomyces cerevisiae.

6. the method for Yeast engineering bacteria described in claim 4 or 5, missing ERG1 gene is by side as claimed in claim 1 or 2 What method obtained.

7. utilization of the gene defection type Yeast engineering bacteria of claim 4 or 5 in verifying squalene epoxidase enzymes gene function.

8. the gene defection type Yeast engineering bacteria of claim 4 or 5 squalene epoxidase enzymes gene function in verifying plant cell Utilization in energy, such as squalene epoxidase enzymes in plant tripterygium wilfordii.

9. a kind of method of squalene epoxidase enzymes gene function in verifying plant cell (such as tripterygium wilfordii), which comprises point Plant squalene is not free of by the expression vector (such as pESC-his-Twse carrier) containing plant squalene epoxidase enzymes gene and accordingly The empty carrier (pESC-his empty carrier) of Cycloxygenase gene is transformed into ERG1 gene defection type yeast engineering bacterium competence cell In, it is then coated on screening and culturing medium, is cultivated under 30 DEG C aerobic and oxygen free condition, if being transferred to containing squalene epoxidase The Erg1 yeast defect bacterium of enzyme gene carrier can grow under conditions of aerobic and anaerobic, then confirmation has biological function, The screening and culturing medium is that SC-his adds ergosterol culture medium.

10. claim 9 the method, wherein the BY system that the ERG1 gene defection type saccharomycete is ERG1 gene defection type makes Brewer yeast bacterium, such as ERG1 gene defection type BY4741 bacterium.