CN103146722B

CN103146722B - Gene sequence of I-type tonoplast pyrophosphatase from ammopiptanthus nanus and cloning method of gene sequence

Info

Publication number: CN103146722B
Application number: CN201310100235.3A
Authority: CN
Inventors: 李晚忱; 雍太明; 付凤玲; 刘艳萍; 于好强; 邓龙群; 佘跃辉; 周树峰
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2012-05-15
Filing date: 2013-03-26
Publication date: 2014-12-10
Anticipated expiration: 2033-03-26
Also published as: CN103146722A; CN102676556A

Abstract

The invention discloses a gene sequence of I-type tonoplast pyrophosphatase from ammopiptanthus nanus. A gene has a nucleotide sequence as shown in SEQIDNO.1. The I-type tonoplast pyrophosphatase encoded by the gene has an amino acid sequence as shown in SEQIDNO.2. The nucleotide sequence is a new gene sequence. The invention also discloses a cloning method of the gene sequence of the I-type tonoplast pyrophosphatase from the ammopiptanthus nanus.

Description

A kind of gene order and cloning process thereof that derives from the I type vacuole skin Pyrophosphate phosphohydrolase of short Stem and leaf of Mongolian Ammopiptanthus

Technical field

The present invention relates to derive from short Stem and leaf of Mongolian Ammopiptanthus the amino acid of the gene of type vacuole skin Pyrophosphate phosphohydrolase and corresponding coding thereof, the present invention also relates to the cloning process of these genes in addition.

Background technology

Short Stem and leaf of Mongolian Ammopiptanthus (Ammopiptanthus nanus Cheng f.) has another name called Ammopiptanthus nanus, little Stem and leaf of Mongolian Ammopiptanthus, short Semen piptanthi concoloris; belong to pulse family (Leguminosae), yellow Chinese (Thermopsideae), Ammopiptanthus Genus (Ammopiptanthus Cheng f.); for Relict Plant in the tertiary period, be listed in national secondary endangered protective plant.Mainly be distributed in the drought barren mountain of height above sea level 1800～2800m and the West Inner Mongolia of stone matter Gobi desert type and Ningxia, Gansu, short part desert, desert belt, the evergreen broadleaved shrub that Shi Gai district is unique, drought in range of distribution, quantity of precipitation is much smaller than steam output, 6.8 ℃ of average temperatures of the whole year, temperature Change extreme value can reach more than 70 ℃.Stem and leaf of Mongolian Ammopiptanthus has very strong resistance, still can be low to moderate in the surface sand gentleness up to 70 ℃ of left and right normal growth in the environment of subzero 20 ℃ ~ 30 ℃ and grow under relatively barren edaphic condition.There are the adverse-resistant characteristics such as very strong cold-resistant, drought resisting and Salt And Alkali Tolerance.Both at home and abroad about the report of Ammopiptanthus Genus plant, comprise the research of physio-biochemical characteristics, cold-resistant, drought resistance mechanism and relevant ultrastructure; Chromosome number and caryogram, meiophase chromosome behavior, Flowering Phenology and introduction and cultivation etc.These researchs have all confirmed the resistance to characteristic of freezing of Stem and leaf of Mongolian Ammopiptanthus drought resisting, so it is the precious resistance to genetic resources that freezes of drought resisting.

being positioned on vacuole skin that type vacuole skin Pyrophosphate phosphohydrolase is comprised of single subunit utilizes pyrophosphate salt (PPi) potential energy as energy, at each chamber of cell interior, to form the albumen of proton gradient. the expression of type vacuole skin pyrophosphatase gene is relevant with abiotic stress, can improve the tolerance of plant salt tolerance and drought stress; type vacuole skin Pyrophosphate phosphohydrolase can regulating plant hormone transhipment, and then regulate the growth and development process being mediated by these plant hormones, and be subject to the plant hormone regulation and control of (as, dormin).

Short Stem and leaf of Mongolian Ammopiptanthus is as outstanding adversity resistant plant, clones above adversity gene significant to basic and applied research.

Summary of the invention

Main purpose of the present invention is exactly the limitation for the adversity gene development research of the short Stem and leaf of Mongolian Ammopiptanthus of desert adversity resistant plant, provides to derive from plant short Stem and leaf of Mongolian Ammopiptanthus and have drought resisting and salt resistant function the gene order of type vacuole skin Pyrophosphate phosphohydrolase, makes it to have corresponding good anti-adversity to being applied in other genetically modified crops.

Another object of the present invention is to provide a kind of cloning process of said gene sequence.

In order to realize foregoing invention object, the technical solution used in the present invention is as follows:

A kind ofly derive from short Stem and leaf of Mongolian Ammopiptanthus the gene order of type vacuole skin Pyrophosphate phosphohydrolase, this sequence has aminoacid sequence that nucleotide sequence as described in SEQ ID NO.1 and this gene pairs answer as described in SEQ ID NO.2.

Above-mentioned nucleotide sequence can extract total RNA by the method comprising the steps, designs primer, carry out the clones such as pcr amplification, order-checking and obtain from the short Ammopiptanthus mongolicus Leaves of plant:

(1) extraction and the purifying of total RNA:

Can adopt various general RNA extracting method and purification process, from the short Ammopiptanthus mongolicus Leaves of plant, extract the total RNA of short Ammopiptanthus mongolicus Leaves that obtains purifying; Conventional RNA extracting method is a lot, as test kit method, hot borate method, guanidine isothiocyanate method, phynol method, dodecyl thiosulfonic acid sodium method, cetyl trimethylammonium bromide method and various improve one's methods etc., all can be used for the extraction of the total RNA of short Ammopiptanthus mongolicus Leaves; Can preferred reagent box method (the pillar plant RNA of sky, Beijing bounties Gene Tech. Company Limited in the present invention _oUT2.0 extract test kit, CAT#90404-50), carry out the total RNA of short Ammopiptanthus mongolicus Leaves and extract.

Purifying is mainly that the DNA in order to remove in total RNA pollutes, and obtains the total RNA of short Ammopiptanthus mongolicus Leaves of purifying, to meet the follow-up needs such as detection by quantitative that the expression of goal gene is carried out.Conventional RNA purification process comprises: dnase digestion method (being called for short D method), sour phenol degeneration methods (being called for short S method), EDTA method (being called for short E method) etc.; Preferred DNA enzyme (the pillar plant RNA of sky, Beijing bounties Gene Tech. Company Limited in the present invention _oUT2.0 extract test kit, CAT#90404-50) digestion method.

(2) clone of intermediate segment:

Synthesizing of A, intermediate segment cDNA the first chain

Using the total RNA of short Ammopiptanthus mongolicus Leaves of above-mentioned steps (1) purifying as template, use the preferably 3 '-Full RACE of TaKaRa company Core Set Ver.2.0(Code:D314 of 3 ' RACE Adaptor() test kit) carry out reverse transcription, cDNA the first chain obtaining, as the template of pcr amplification in following step B.

B, pcr amplification

Using cDNA first chain of aforementioned steps A gained intermediate segment as template, utilize following merger upstream primer (jf3) and annex downstream primer (jx3), carry out pcr amplification.

Described I type vacuole skin pyrophosphatase gene intermediate segment amplimer can be preferably:

jf3: 5’-GGTCTTCTATGGCTTTGTTYGG-3’，

jx3: 5’-TRGCAGARAACCAGTAAGGRAG-3’；

Amplification obtains the I type vacuole skin pyrophosphatase gene cDNA intermediate segment of short Stem and leaf of Mongolian Ammopiptanthus, by cloning and sequencing, obtains intermediate segment sequence.

In this step, amplification system can be preferably:

TaqPlusPCR Master Mix 20 μL ，

CDNA template 2 μ L,

2 * primer (jx3/jf3), 1 μ L,

ddH ₂O 16 μL 。

Amplification program can be preferably:

95℃，3min；

95 ℃, 30 s, 58 ℃, 30 s, 72 ℃, 1 min(35 circulation);

72 ℃, 8 min; 4 ℃ of insulations.

The clone of (3) 3 ' ends:

C, 3 '-outer pcr amplification

The intermediate segment sequence obtaining according to above-mentioned steps (2), design and synthesize specificity upstream primer GSP3-3 '-outer, cDNA first chain of abovementioned steps (2) A gained of take is template, utilize the preferably 3 '-Full RACE of TaKaRa company Core Set Ver.2.0(Code:D314 of specificity upstream primer GSP3-3 '-outer and 3 ' end downstream primer 3 '-RACE outer() test kit), carry out 3 ' end outer pcr amplification:

The specificity upstream outer primer of I type vacuole skin pyrophosphatase gene 3 ' end can be preferably:

GSP3-3’-outer: 5’- TCGCTGTTGGTCTCTGGGCAGGGCTTAT -3’；

3 ' end downstream primer 3 '-RACE outer can be preferably:

3’-RACE outer: 5’- TACCGTCGTTCCACTAGTGATTT -3’；

The product that amplification obtains is cDNA 3 ' end.

In this step, amplification system can be preferably:

1×cDNA Dilution Buffer II 8 μL ，

CDNA template 2 μ L,

2 * primer (GSP3-3 '-outer/3 '-RACE-outer) 1 μ L,

10×LA PCR Buffer II（Mg ²⁺ Free） 4 μL ，

MgCl ₂（25 mM） 3 μL ，

TaKaRa LA Taq（5 U/μl） 0.25 μL ，

ddH ₂O 28.75 μL 。

Amplification program can be preferably:

95℃，3 min；

95 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1 min 30 s(35 circulations);

72 ℃, 8 min; 4 ℃ of insulations.

D, 3 '-inner pcr amplification

According to abovementioned steps (2) gained intermediate segment terminal sequence, design and synthesize specificity upstream primer GSP3-3 '-inner, outer PCR product template with abovementioned steps C gained 3 ' end, utilize the preferably 3 '-Full RACE of TaKaRa company Core Set Ver.2.0(Code:D314 of specificity upstream primer GSP3-3 '-inner and 3 ' end downstream primer 3 '-RACE inner() test kit), carry out 3 ' end inner pcr amplification:

The specificity upstream inner primer of I type vacuole skin pyrophosphatase gene 3 ' end can be preferably:

GSP3-3’- inner: 5’- CCATTGGTTCTGCCGCCCTTGTGTCTTT -3’；

3 ' end downstream primer 3 '-RACE inner can be preferably:

3’-RACE inner: 5’- CGCGGATCCTCCACTAGTGATTTCACTATAGG -3’；

The product that amplification obtains is cDNA 3 ' end inner PCR product, by cloning and sequencing, obtains 3 ' end complete sequence;

In this step, amplification system can be preferably:

dNTP Mixture（2.5 mM each） 8 μL ，

3 '-outer PCR product, 2 μ L,

2 * primer (GSP3-3 '-inner/3 '-RACE-inner) 1 μ L,

10×LA PCR Buffer II（Mg ²⁺ Free） 4 μL ，

MgCl ₂（25 mM） 3 μL ，

TaKaRa LA Taq（5 U/μl） 0.25 μL ，

ddH ₂O 28.75 μL 。

Amplification program can be preferably:

95℃，3 min；

95 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1 min 30 s(35 circulations)

72 ℃, 8 min; 4 ℃ of insulations.

The clone of (4) 5 ' ends:

CDNA first chain of E, synthetic 5 ' end:

Using the total RNA of short Ammopiptanthus mongolicus Leaves of above-mentioned steps (1) purifying as template, through RNA being carried out to the pre-treatment (preferred FirstChoice ' RLM-RACE of Ambion company Kit, SKU #:AM1700 test kit), add 5 ' RACE Adapter to carry out reverse transcription, (by described pre-treatment, realize the dephosphorylation of incomplete mRNA and the processing of raising one's hat to complete mRNA, get rid of incomplete mRNA and disturb, complete mRNA can be connected with 5 ' RACE Adapter efficiently.）

Described 5 ' RACE Adapter can be preferably:

5’ RACE Adapter: 5’-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA -3’；

Synthetic cDNA the first chain that obtains reverse transcription product 5 ' end.

F, 5 '-outer pcr amplification

The intermediate segment sequence obtaining according to above-mentioned steps (2), design and synthesize specificity downstream primer GSP3-5 '-outer, cDNA first chain of aforementioned step e gained reverse transcription product of take is template, utilize preferably FirstChoice ' RLM-RACE Kit test kit of specificity downstream primer GSP3-5 '-outer and 5 ' end upstream primer 5 '-RACE outer(), carry out 5 ' end outer pcr amplification:

The specificity downstream outer primer of I type vacuole skin pyrophosphatase gene 5 ' end can be preferably:

GSP3-5’-outer: 5’- TAAGCAAGCAAACAAGGATACCCACAG -3’；

5 ' end upstream primer 5 '-RACE outer can be preferably:

5’-RACE outer: 5’- GCTGATGGCGATGAATGAACACTG -3’；

The product that amplification obtains is cDNA 5 ' end.

In this step, amplification system can be preferably:

CDNA template 1 μ L,

10X PCR Buffer 5 μL ，

dNTP Mix 4 μL ，

2 * primer (GSP3-5 '-outer/5 '-RACE outer) 2 μ L,

ThermostabLe DNA poLymerase（0.25 μL of 5U/μL） 1.25 μL ，

ddH ₂O 34.75 μL 。

Amplification program can be preferably:

95℃，3 min；

95 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 1 min/kbp(35 circulation);

72 ℃, 8 min; 12 ℃ of insulations.

G, 5 '-inner pcr amplification

According to abovementioned steps (2) gained intermediate segment sequence, design and synthesize specificity downstream primer GSP3-5 '-inner, outer PCR product template with aforementioned step F gained 5 ' end, utilize preferably FirstChoice ' RLM-RACE Kit test kit of specificity downstream primer GSP3-5 '-inner and 5 ' end upstream primer 5 '-RACE inner(), carry out 5 ' end inner pcr amplification:

The specificity downstream inner primer of I type vacuole skin pyrophosphatase gene 5 ' end can be preferably:

GSP3-5’- inner: 5’- GGAAGCAACAACGAGAGCGGCACAGGA -3’；

5 ' end upstream primer 5 '-RACE inner can be preferably:

5’-RACE inner: 5’- CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG -3’；

The product that amplification obtains is cDNA 5 ' end inner PCR product, by cloning and sequencing, obtains 5 ' end complete sequence;

In this step, amplification system can be preferably:

5 '-outer PCR product, 1 μ L,

10X PCR Buffer 5 μL ，

dNTP Mix 4 μL ，

2 * primer (GSP3-5 '-inner/5 '-RACE inner) 2 μ L,

ThermostabLe DNA poLymerase（0.25 μL of 5U/μL)） 1.25 μL ，

ddH ₂O 34.75 μL 。

Amplification program can be preferably:

95℃，3 min；

95 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 1 min/kbp (35 circulations);

72 ℃, 8 min, 12 ℃ of insulations.

(5) full length sequence splicing and genetic analysis:

Above-mentioned steps (2) gained intermediate segment, step (3) gained 3 ' are held to inner pcr amplification sequence and state step (4) gained 5 ' end inner pcr amplification sequence and with DNAman software, carry out the splicing of complete sequence, then by ORF finder tool analysis open reading frame, i.e. complete gene order in NCBI.

(6) clone of I type vacuole skin pyrophosphatase gene:

The complete genome sequence that above-mentioned steps (5) is analyzed, as template, designs upstream primer ORF3-S and downstream primer ORF3-A, the performing PCR of going forward side by side amplification:

I type vacuole skin pyrophosphatase gene amplimer can be preferably:

ORF3-S: 5’- ATGGGTGCAGCCATTCTCCC -3’，

ORF3-A: 5’- TTAGATCTTGAAGAGTAAGCCACCATG-3’；

The product that obtains of amplification is the I type vacuole skin pyrophosphatase gene of complete short Stem and leaf of Mongolian Ammopiptanthus, by cloning and sequencing, obtains its gene order.

In this step, amplification system can be preferably:

dNTP Mixture（2.5 mM each） 4 μL ，

2 * primer (ORF3-S/ORF3-A), 1 μ L,

CDNA template 1 μ L,

5×PrimeSTAR Buffer（Mg ²⁺ plus） 10 μL ，

PrimeSTAR HS DNA PLoymerase（2. 5 U/μL） 0.5 μL ，

ddH ₂O 32.5 μL 。

I type vacuole skin pyrophosphatase gene amplification program can be preferably:

98 ℃, 30 s; 62 ℃, 30 s; 72 ℃, 2 min 30 s (35 circulations);

compared with prior art, the invention has the beneficial effects as follows:

The present invention a kind ofly derives from the gene order that the short Stem and leaf of Mongolian Ammopiptanthus of plant has the I type vacuole skin Pyrophosphate phosphohydrolase of drought resisting and salt resistant function, and uses first RACE method in these species, to clone this gene, obtains the complete full length sequence of this gene.The present invention clone's I type vacuole skin pyrophosphatase gene makes people from bacterium and other plant, further expand to short Stem and leaf of Mongolian Ammopiptanthus to the research object of this gene.

And, the performances such as the good drought resisting possessing in yeast functional verification test according to the gene of short Stem and leaf of Mongolian Ammopiptanthus I type vacuole skin Pyrophosphate phosphohydrolase, salt tolerant can be expected: if it is imported by transgenic technology in the gene of the other plants such as corn, can cultivate the new variety of plant of performances such as having corresponding good drought resisting, salt tolerant.

Accompanying drawing explanation

Fig. 1 is AnVP1 gene electrophoresis detected result figure,

Fig. 2 is AnVP1 gene intermediate segment electrophoresis detection result figure,

Fig. 3 is AnVP1 gene 3 ' end inner PCR electrophoresis detection result figure,

Fig. 4 is AnVP1 gene 5 ' end inner PCR electrophoresis detection result figure,

Fig. 5 is the electrophoresis detection result figure that expression vector pRS6-AnVP1 double digestion is identified.

Fig. 6 is the bacterial plaque growing state photo in yeast salt stress controlled trial, in figure, A, B, C, D, E represent that respectively the NaCl concentration of adding in substratum is 0 mol/L, 0.2 mol/L, 0.5 mol/L, 0.7 mol/L, 1.0 mol/L, under same NaCl concentration 3 row, are respectively the stoste of corresponding bacterial strain, 5 times of diluents and 25 times of diluents from left to right.

Fig. 7 is the bacterial plaque growing state photo of yeast high temperature stress controlled trial, A:30 ° of contrast bacterium liquid, B:53 ° C pyroprocessing 2 min, C:53 ° C pyroprocessing 4 min, D:53 ° C pyroprocessing 6 min, E:53 ° C pyroprocessing 8 min, F:53 ° C pyroprocessing 10 min that C cultivates in figure, under the same treatment time 3 row, are respectively the stoste of corresponding bacterial strain, 5 times of diluents and 25 times of diluents from left to right.

Fig. 8 is the bacterial plaque growing state photo of yeast drought stress controlled trial, and the row of 3 in figure under same sorbyl alcohol addition, are respectively the stoste of corresponding bacterial strain, 5 times of diluents and 25 times of diluents from left to right.

Embodiment

Below in conjunction with embodiment, foregoing invention content of the present invention is described in further detail.

But this should be interpreted as to the scope of the above-mentioned theme of the present invention only limits to following embodiment.Without departing from the idea case in the present invention described above, according to ordinary skill knowledge and customary means, make various replacements and change, all should comprise within the scope of the invention.

In each of the embodiments described below, by the I type vacuole skin Pyrophosphate phosphohydrolase of short Stem and leaf of Mongolian Ammopiptanthus referred to as anVP1.By each embodiment, finally obtain deriving from I type vacuole skin Pyrophosphate phosphohydrolase nucleotide sequence (as described in SEQ ID NO.1) and the corresponding aminoacid sequence (as described in SEQ ID NO.2) thereof of short Stem and leaf of Mongolian Ammopiptanthus.

embodiment 1

The present embodiment is extraction and the purifying of the total RNA of short Ammopiptanthus mongolicus Leaves, and total RNA extracts the pillar plant RNA OUT that uses sky, Beijing bounties Gene Tech. Company Limited _2.0extract test kit, CAT#90404-50, comprises the steps:

(1) estimate histiocytic consumption.Each trace extracts and generally needs 100-200 mg plant leaf or 50-100 mg plant seed or 200-500 mg fruit.

(2) (be kept at after plant tissue in RNALOCKER needs paper using to suck RNALOCKER liquid and cut into fritter again) is first cut into small pieces fresh plant tissue shear, put into 10-15 mL plastic centrifuge tube, add the solution A (rock and mix with front needs) of 65 ℃ of preheatings of 1 mL, then use homogenizer homogenate 5-20 second.During homogenate, can produce foam, but not affect extraction effect.Also can use the broken plant tissue of liquid nitrogen inkstone mill method, after inkstone has ground, add 1 mL solution A, but effect be poor, because mortar essence is silicon-dioxide, when solution A exists, can adsorb RNA.

(3) homogenate or inkstone mill thing are transferred in 1.5 clean mL plastic centrifuge tubes (can shift aneroid cell debris).Some plant tissues (such as fruit) contain a large amount of moisture content, and homogenate can, more than 1 mL, also only be got 1 mL during transfer.

(4) in centrifuge tube, add the solution B of 0.3 mL and 0.2 mL to provide chloroform for oneself, vibrate and mix for 30 seconds on vibrator, now solution is uniform milkiness shape.During vibrator vibration, must make to manage end solution shakes.

(5) the centrifugal 3-5 minute of room temperature 12000 rpm, the thick cytoclasis thing of the two alternate 5mm that has an appointment.

(6) supernatant liquor (approximately 0.6 mL) is transferred in another 1.5 clean mL plastic centrifuge tubes, DNA, protein and other impurity are contained in lower floor's organic phase and middle layer, avoid touching or drawing.Preferably leaving 100 μ L supernatant liquors does not get.

(7) add isopyknic solution C, fully put upside down and mix.

(8) half solution is transferred in centrifugal adsorbing column (60911B), 12000 centrifugal half a minute of rpm room temperature, abandoned and penetrate liquid.Note not following the adsorption column (60911D) extracting for RNA mixed.

(9) half remaining solution is transferred in same centrifugal adsorbing column, 12000 centrifugal half a minute of rpm room temperature, abandoned and penetrate liquid.

(10) the general post liquid of washing of 0.7 mL is joined in centrifugal adsorbing column, the centrifugal 10-30 of 12000 rpm room temperature second, abandon and penetrate liquid.

Centrifugal 10 seconds of (11) 12000 rpm room temperatures are to remove residual liquid.

(12) by 10 μ L(10 U) RNase-free DNase join in the DNA film reaction liquid of 37 ℃ of preheatings of 50 μ L, piping and druming mixes and is mixed with DNase working fluid.

(13) by DNase working fluid 37 ℃ of preheatings 1 minute, then all join in centrifugal adsorbing column, room temperature is placed 5 minutes.Attention: general enough degradeds in 5 minutes DNA in most cases pollutes.If DNA does not have thoroughly to degrade (activity that may suppress due to impurity residual in sample DNase), the soaking time of this step can proper extension to 10 minute or 15 minutes.

(14) directly in centrifugal adsorbing column, add the general post liquid of washing of 0.7 mL, after closing the lid, put upside down and mix for several times.

(15) 12000 centrifugal half a minute of rpm room temperature, abandon and penetrate liquid.

(16) add again the general post liquid of washing of 0.3 mL to centrifugal adsorbing column, 12000 centrifugal half a minute of rpm room temperature, abandon and penetrate liquid.

(17) 12000 centrifugal half a minute of rpm room temperature.This step is very important, otherwise residual ethanol can affect the use of RNA.

(18) centrifugal adsorbing column is transferred in RNase-free collection tube, added 30-50 μ L RNA elutriant, room temperature is placed 1-2 minute.

(19) 12000 centrifugal half a minute of rpm room temperature, in centrifuge tube, solution is RNA sample.The centrifugal adsorbing column adsorptive power that this product provides is stronger, and one time wash-out can not all be washed down RNA on film, if necessary, can add 30-50 μ L RNA elutriant once again.

embodiment 2

The present embodiment is the reverse transcription of the total RNA of short Stem and leaf of Mongolian Ammopiptanthus, cDNA the first chain that its reverse transcription obtains is for the template of gene intermediate segment and 3 ' end amplification, according to 3 '-Full RACE Core Set Ver.2.0 of Takara company, it is synthetic that Code:D314 test kit specification sheets carries out cDNA the first chain.

embodiment 3

The present embodiment is anVP1the clone of gene intermediate segment, method is as follows:

The puncture vine clover (FJ176929.1) of take is inquiry sequence, with reference to Root or stem of Littleleaf Indianmulberry (EF440187.1), mung bean (AB009077.1), soybean (AK285283.1) and cowpea (U31467.1) sequences Design degenerate primer jf3/jx3:

jf3: 5’- GCCCAAARGAGCTTTCACTY -3；

jx3: 5’- GAAGMARGTGACCRGGAAGG -3’。

CDNA the first chain of embodiment 2 of take is template, with degenerate primer jf3 and the jx3 designing, carries out anVP1the amplification of gene cDNA intermediate segment.

Amplification system is: TaqPlusPCR Master Mix 20 μ L,

CDNA template 2 μ L,

2 * primer (jx3/jf3), 1 μ L,

ddH ₂O 16 μL 。

Amplification program is: 95 ℃, and 5min;

95 ℃, 30 s, 58 ℃, 30 s, 72 ℃, 1 min(35 circulation);

72 ℃, 8 min; 4 ℃ of insulations.

Get gained amplified production 20 μ L through 1% non-sex change sepharose 100 V electrophoresis 30 min, UV detection amplified fragments after GoLdenView dyeing, result is as shown in Figure 2.

The product that amplification obtains is anVP1gene cDNA intermediate segment, by the method cloning and sequencing comprising the steps, the intermediate segment sequence obtaining is as described in SEQ ID NO.3:

1. the retrieve and purification of object fragment:

Amplification specific band is out dug out under UV-light soon and accurately with clean blade from agarose, be placed in 1.5 mL centrifuge tubes, with gel, reclaim test kit (the E.Z.N.A.TM GeL Extraction Kit of OMEGA company) and reclaim the DNA fragmentation in glue;

2. ligation:

The DNA fragmentation of recovery is cloned in the pMD19-T carrier of TaKaRa company.Ligation adopts and connects test kit (Takara company), amplification system cumulative volume 10 μ L, and 16 ℃ of connections are spent the night;

3. the preparation of competent cell:

I, picking new activation from LB flat board e. coLiDH5 αsingle bacterium colony, is inoculated in 3-5 mL LB liquid nutrient medium, and 37 ℃, 225 r/min shaking culture 12 h left and right, until the logarithmic growth later stage.Ratio by this bacteria suspension with 1:100-1:50 is inoculated in 100 mL LB liquid nutrient mediums, 37 ℃ of shaking culture 2-3 h to OD600=0.35-0.5 left and right;

II, nutrient solution is proceeded to centrifuge tube, place 10 min on ice, then centrifugal 10 min of 3000 r/min at 4 ℃;

III, supernatant discarded, the CaCL of 0.05 moL/L of use precooling ₂solution 10 mL are suspension cell gently, places after 15-30 min centrifugal 10 min of 3000 r/min at 4 ℃ on ice;

IV, supernatant discarded, add 4 mL precoolings containing the CaCL of 0.05 moL/L of 15% glycerine ₂solution, suspension cell, places several minutes on ice gently, competent cell suspension;

V, competent cell are distributed into the aliquot of 100 μ L, and being stored in-70 ℃ can preserve half a year;

4. the conversion of plasmid DNA:

I, from-80 ℃ of refrigerators, take out a pipe competent escherichia coli cell dH5 α, be placed on ice and melt;

II, under aseptic condition, add 10 μ L ligation liquid, after jolting gently and mixing, on ice, place 30 min;

III, 42 ℃ of water-bath thermal shock 90 s, do not shake, and puts into rapidly afterwards the cooling 2-3 min of ice bath;

IV, add 890 μ L without the LB liquid nutrient medium of Amp, after mixing, 37 ℃, 150 r/min shaking table joltings are cultivated, incubation 1 h;

V, get the bacterium liquid that 100 μ L have transformed and be applied on the culture plate of a LB/Amp, face up and place 30 min, after bacterium liquid is absorbed by substratum completely, with sealed membrane, seal, then reverse culture dish, 37 ℃ of lucifuges are cultivated 12-16 h; Screen subsequently positive bacterium colony;

5. recombinate evaluation and the preservation of bacterium colony:

From the appearance, the bacterium colony of general white and circle is positive, and by bacterium liquid, PCR further identifies:

Several white colonies are got in I, the lancet choicest with sterilizing on the flat board of incubated overnight, and dibbling is in 1.5 mL centrifuge tubes of the LB liquid nutrient medium containing 0.1 g/L Amp respectively, and 37 ℃, 4-6h is cultivated in 150 r/min joltings;

II, get 1 μ L bacteria suspension as template, with primer jf1/jx1, carry out pcr amplification, in PCR reaction conditions, pyrolysis time extends to 5min, with 1% non-sex change agarose gel electrophoresis, detects amplified production.When if product is object band, the positive clone of this bacterium colony, otherwise negative.Establish the negative control that does not add bacteria suspension simultaneously;

III, get the bacterium colony suspension 750 μ L of the positive colony of having identified, add the sterile glycerol of 250 μ L, after mixing, with liquid nitrogen flash freezer, be placed in-80 ℃ of refrigerators and save backup;

IV, finally send the order-checking of handsome biotech company, institute's calling sequence compares at the BLastn of NCBI, and whether checking cloned sequence is correct.

embodiment 4

The present embodiment is anVP1the clone of gene 3 ' end, method is as follows:

(1) 3 '-outer pcr amplification:

The intermediate segment sequence obtaining according to embodiment 3, design and synthesize specificity upstream primer GSP3-3 '-outer, cDNA first chain of embodiment 2 gained reverse transcription products of take is template, utilize specificity upstream primer GSP3-3 '-outer and the 3 '-Full RACE Core Set Ver.2.0(Code:D314 of TaKaRa company) 3 ' end downstream primer 3 '-RACE outer in test kit, carries out 3 ' end outer pcr amplification:

GSP3-3’-outer: 5’- TCGCTGTTGGTCTCTGGGCAGGGCTTAT -3’；

3’-RACE outer: 5’- TACCGTCGTTCCACTAGTGATTT -3’；

Amplification system is:

1×cDNA Dilution Buffer II 8 μL ，

CDNA template 2 μ L,

2 * primer (GSP3-3 '-outer/3 '-RACE-outer) 1 μ L,

10×LA PCR Buffer II（Mg ²⁺ Free） 4 μL ，

MgCl ₂（25 mM） 3 μL ，

TaKaRa LA Taq（5 U/μl） 0.25 μL，

ddH ₂O 28.75 μL 。

Amplification program is:

95℃，3 min；

95 ℃, 30 s; 55 ℃, 30 s; 72 ℃, 1 min 30 s(35 circulations)

72 ℃, 8 min; 4 ℃ of insulations.

(2) 3 '-inner pcr amplifications:

The intermediate segment sequence obtaining according to embodiment 3, design and synthesize specificity upstream primer GSP3-3 '-inner, above-mentioned (1) gained outer PCR product of take is template, utilize specificity upstream primer GSP3-3 '-inner and the 3 '-Full RACE Core Set Ver.2.0(Code:D314 of TaKaRa company) 3 ' end downstream primer 3 '-RACE inner in test kit, carries out 3 ' end inner pcr amplification:

GSP3-3’-inner: 5’- CCATTGGTTCTGCCGCCCTTGTGTCTTT -3’；

3’-RACE inner: 5’- CGCGGATCCTCCACTAGTGATTTCACTATAGG -3；

Amplification system is:

dNTP Mixture（2.5 mM each） 8 μL ，

CDNA template 2 μ L,

2 * primer (GSP3-3 '-inner/3 '-RACE-inner) 1 μ L,

10×LA PCR Buffer II（Mg ²⁺ Free） 4 μL，

MgCl ₂（25 mM） 3 μL，

TaKaRa LA Taq（5 U/μl） 0.25 μL，

ddH ₂O 28.75 μL 。

Amplification program is:

95℃，3 min；

95 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 1 min 30 s(35 circulations);

72 ℃, 8 min; 4 ℃ of insulations.

Get gained amplified production and detect through 1% agarose gel electrophoresis, result as shown in Figure 3.

The product that amplification obtains is anVP1gene 3 ' end cDNA complete sequence inner PCR product, by cloning and sequencing (with embodiment 3), 3 ' the end cDNA complete sequence obtaining is as described in SEQ ID NO.4.

embodiment 5

The present embodiment is that cDNA first chain of 5 ' end amplification is synthetic:

Using the total RNA of short Ammopiptanthus mongolicus Leaves of embodiment 1 purifying as template, through the FirstChoice RLM-RACE Kit of Ambion company, SKU #:AM1700 test kit is processed RNA, adds after following 5 ' RACE Adapter, with Random Decamers, carries out reverse transcription:

5’ RACE Adapter: 5’-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA -3’；

embodiment 6

The present embodiment is anVP1the clone of gene 5 ' end, comprises the steps:

(1) 5 '-outer pcr amplification:

The intermediate segment sequence obtaining according to embodiment 3, design and synthesize specificity downstream primer GSP3-5 '-outer, cDNA first chain of embodiment 5 gained reverse transcription products of take is template, utilize specificity downstream primer GSP3-5 '-outer and test kit FirstChoice ' RLM-RACE Kit, SKU #:AM1700 middle and upper reaches primer 5 '-RACE outer, carries out 5 ' end outer pcr amplification:

GSP3-5’-outer: 5’- TAAGCAAGCAAACAAGGATACCCACAG -3’；

5’-RACE outer: 5’- GCTGATGGCGATGAATGAACACTG -3’；

Amplification system is:

CDNA template 1 μ L,

10X PCR Buffer 5 μL ，

dNTP Mix 4 μL ，

2 * primer (GSP3-5 '-outer/5 '-RACE outer) 2 μ L,

ThermostabLe DNA polymerase（0.25 μL of 5U/μL） 1.25 μL ，

ddH ₂O 34.75 μL 。

Amplification program is:

95℃，3 min；

95 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 2 min 30 s(35 circulations);

72 ℃, 8 min; 12 ℃ of insulations.

(2) 5 '-inner pcr amplifications:

The intermediate segment sequence obtaining according to embodiment 3, design and synthesize specificity downstream primer GSP3-5 '-inner, above-mentioned (1) gained outer PCR product of take is template, utilize specificity downstream primer GSP3-5 '-inner and test kit FirstChoice ' RLM-RACE Kit, SKU #:AM1700 middle and upper reaches primer 5 '-RACE inner, carries out 5 ' end inner pcr amplification:

GSP3-5’-inner: 5’- GGAAGCAACAACGAGAGCGGCACAGGA -3’；

5’-RACE inner: 5’- CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG -3；

Amplification system is:

5 '-outer PCR product, 1 μ L,

10X PCR Buffer 5 μL ，

dNTP Mix 4 μL ，

2 * primer (GSP3-5 '-inner/5 '-RACE inner) 2 μ L,

ThermostabLe DNA poLymerase（0.25 μL of 5U/μL） 1.25 μL ，

ddH ₂O 34.75 μL 。

Amplification program is:

95℃，3 min；

95 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 2 min 30 s(35 circulations);

72 ℃, 8 min; 12 ℃ of insulations.

Get gained amplified production and detect through 1% agarose gel electrophoresis, result as shown in Figure 4.

The product that amplification obtains is anVP1gene 5 ' end cDNA complete sequence inner PCR product, by cloning and sequencing (with embodiment 3), 5 ' the end cDNA complete sequence obtaining is as described in SEQ ID NO.5.

embodiment 7

The present embodiment is anVP1the splicing of full length gene sequence nucleotide sequence and genetic analysis, comprise the steps:

Above-described embodiment 3 gained intermediate segment, embodiment 4 gained 3 ' end inner pcr amplification sequences and embodiment 6 gained 5 ' end inner pcr amplification sequences are carried out to the splicing of complete sequence with DNAman software, then by ORF finder tool analysis open reading frame, i.e. complete gene order in NCBI.

embodiment 8

The present embodiment is AnVP1 gene clone, and method is as follows:

With genetic analysis design upstream primer ORF3-S and the downstream primer ORF3-A of embodiment 7, cDNA first chain of embodiment 5 gained reverse transcription products of take carries out pcr amplification as template:

ORF3-S: 5’- ATGGGTGCAGCCATTCTCCC -3’，

ORF3-A: 5’- TTAGATCTTGAAGAGTAAGCCACCATG-3’；

Amplification system is:

dNTP Mixture（2.5 mM each） 4 μL ，

2 * primer (ORF3-S/ORF3-A), 1 μ L,

CDNA template 1 μ L,

5×PrimeSTAR Buffer（Mg ²⁺ plus） 10 μL ，

PrimeSTAR HS DNA PLoymerase（2. 5 U/μL） 0.5 μL ，

ddH ₂O 32.5 μL 。

Amplification program is:

98 ℃, 30 s; 62 ℃, 30 s; 72 ℃, 2 min 30 s (35 circulations);

Get gained amplified production and detect through 1% agarose gel electrophoresis, result as shown in Figure 1.

The product that amplification obtains is complete AnVP1 gene order, as described in SEQ ID NO.1; Its corresponding aminoacid sequence is as described in SEQ ID NO.2.

embodiment 9

The present embodiment is anVP1restriction enzyme site is added at gene two ends, and method is as follows:

The gene fragment obtaining according to embodiment 8, designs and synthesizes band Xho the upstream primer vpU of restriction enzyme site and band BamH the downstream primer vpD of restriction enzyme site, carries out anVP1the pcr amplification of gene:

vpU: 5’- AAC CTCGAG(Xho )ATGGGTGCAGCCATTCTCC -3’；

vpD: 5’- CT GGATCC(BamH )TTTTAGATCTTGAAGAGTAAGCCACC -3’；

Amplification system is:

dNTP Mixture（2.5 mM each） 4 μL ，

2 * primer (vpU/vpD), 1 μ L,

CDNA template 1 μ L,

5×PrimeSTAR Buffer（Mg ²⁺ plus） 10 μL ，

PrimeSTAR HS DNA Polymerase（2. 5 U/μL） 0.5 μL ，

ddH ₂O 32.5 μL 。

Amplification program is:

94℃，2 min；

98 ℃, 10 s; 68 ℃, 2 min 30 s(30 circulations);

Getting gained amplified production detects through 1% agarose gel electrophoresis.The product that obtains of amplification is two ends with restriction enzyme site anVP1gene, by cloning and sequencing (with embodiment 3), checking amplified fragments is correct.

embodiment 10

The present embodiment is for building the expression vector pRS6-AnVP1 of transformed yeast mutant strain ena1 (being so kind as to give by Fudan University's wool grass undergraduate course teach problem group), and method is as follows:

(1) embodiment 9 increases anVP1the preparation of fragment and expression vector pRS6 (being preserved by this laboratory) skeleton:

Use restriction enzyme Xho and BamH by following system double digestion embodiment 9, increase anVP1fragment and expression vector pRS6.

Double digestion system:

BamH 1.0 μL

Xho 1.0 μL

10×K Buffer 2.0 μL

DNA 4.0 μL

ddH ₂O 12 μL

30 ° of C enzymes were cut after 8 hours, retrieve and purification (with embodiment 3) after 1% agarose gel electrophoresis detects.

(2) structure of expression vector pRS6-AnVP1:

Will be through Xho with T4 DNA ligase and BamH double digestion reclaims and by following system, is connected with pRS6 linear expression vector skeleton with the AnVP1 fragment after purifying.

Linked system:

Target DNA 0.03 pmol

Carrier DNA 0.01 pmol

10 * ligase enzyme damping fluid, 2.0 μ L

T4 DNA ligase 1.0 μ L

16 ° of C connect 8 hours, retrieve and purification (with embodiment 3) after 1% agarose gel electrophoresis detects.

embodiment 11

The present embodiment is that clone, evaluation and the double digestion of expression vector pRS6-AnVP1 detects, and method is as follows:

(1) cloning and identification of expression vector pRS6-AnVP1: (with embodiment 3)

(2) double digestion of expression vector pRS6-AnVP1 detects:

The positive bacteria liquid that (1) is identified is inoculated into the fresh LB liquid nutrient medium that contains Amp by the ratio row of 0.1:50,37 ° of C shaking culture are spent the night, extract plasmid (the plasmid extraction kit explanation by OMEGA company is carried out) and with XhoI and BamHI, do double digestion and identify (double digestion system is with embodiment 10), result as shown in Figure 5.

(3) enzyme is cut to the correct corresponding bacterium liquid of plasmid and sent the order-checking of handsome biotech company.

embodiment 12

The present embodiment is the competence preparation of yeast mutation bacterial strain ena1, and step is as follows:

(1) yeast strain ena1 is incubated on YPD solid medium, and 30 ° of C are inverted and cultivate.

(2) the mono-clonal thalline of a 2-3 mm of picking is in 3 mL YPD liquid nutrient mediums, 30 ° of C, and 200 r/min shaking tables are cultivated 8-12 h.

(3) get in the YPD liquid nutrient medium that 5 μ L culture to 50 mL are fresh, shaking table is cultured to the light absorption value (OD of bacterium liquid under 600nm wavelength ₆₀₀) be 0.15-0.3.

(4) 700 r/min, 5min, the centrifugal thalline of room temperature, abandons supernatant, and precipitation is resuspended in 100 mL YPD liquid nutrient mediums.

(5) 30 ° of C are cultured to OD ₆₀₀=0.4-0.5.

(6) by the centrifuge tube of culture evenly distribute to two 50 mL, 700 r/min, centrifugal 5 min of room temperature.Abandon supernatant, precipitation is suspended in 30 mL deionized waters.

(7) 700 r/min, centrifugal 5 min of room temperature.Abandon supernatant, precipitation is resuspended in 1.5 mL 1.1 * TE/LiAc.

(8) the resuspended thing of thalline is transferred in the centrifuge tube of 1.5 mL to high speed centrifugation 15 s.

(9) abandon supernatant, precipitation is resuspended in 1.1 * TE/LiAC of 600 μ L, prepares to transform.

embodiment 13

The present embodiment is expression vector pRS6-AnVP1 transformed yeast mutant strain ena1 competence, and step is as follows:

(1) preparation single-stranded vector DNA(10 mg/mL): claim that 1 g salmon sperm dna is dissolved in 100 mL TE damping fluids.With 10 mL transfer pipets, repeatedly twitch DNA is uniformly dispersed up and down, be then placed in magnetic stirring apparatus vigorous stirring 2-3 h until dissolve completely, or by solution sealing, put in freezer and stir and spend the night.Packing DNA sample, puts under-20 ° of C conditions and preserves.Before use, put at least 5 min in boiling water bath, be placed in afterwards ice bath cooling fast.

(2) get 2 μ L target plasmid pRS6-AnVP1, with 5 μ L single-stranded vector DNA, in the centrifuge tube of 1.5 mL, then add 50 μ L yeast competent cells, mix gently.

(2) add inside again 0.5 mL PEG/LiAC, mix gently.

(3) 30 ° of C cultivate 30 min, every 10 min, mix once.

(4) add again 20 μ L DMSO, mix gently.

(5) 42 ° of C, water-bath 20 min, mix once every 5 min.

(6) high speed centrifugation 15 s, abandon supernatant.

(7) precipitation is resuspended in 1 mL YPD liquid nutrient medium, 30 ° of C, and shaking table is cultivated 90 min.

(8) high speed centrifugation 15 s, abandon supernatant, and re-suspended cell is in 1 mL 0.9%( w/ v) in NaCl.

(9) get on the YNB substratum that the dilution mixed solution of 100 μ L 1/10 or 1/100 is coated in Histidine disappearance, be placed in 30 ° of C, cultivate 2-4 d, and select transformant.

embodiment 14

The present embodiment is yeast salt stress controlled trial, and step is as follows:

(1) mono-clonal of picking wild-type yeast bacterial strain WT, mutant strain ena1 and transgenosis bacterial strain ena1-AnVP1, yeast strain WT, mutant strain ena1 are seeded to YPD liquid nutrient medium, and transgenosis bacterial strain ena1-AnVP1 is seeded in the YNB liquid nutrient medium of HIS disappearance; In 30 ° of C, 200rpm carries out incubated overnight;

(2) next day in 1:100 ratio enlarged culturing to OD ₆₀₀during=1.2-1.5, with aqua sterilisa, be diluted to the OD of each bacterium liquid ₆₀₀be about 1.0; Then with aqua sterilisa, do 5 times of gradient dilutions, respectively obtain three dilution bacterium liquid of difference;

(3) from each dilution bacterium liquid, get 3 μ L, point to the YPD solid salt that adds respectively 0 mol/L, 0.2 mol/L, 0.5 mol/L, 0.7 mol/L, 1.0 mol/L NaCl is coerced on substratum, transgenosis bacterial strain ena1-AnVP1 arranges 3 Duplicate Samples, is designated as respectively ena1-AnVP1-1, ena1-AnVP1-2 and ena1-AnVP1-3;

(4) 30 ° of C are inverted and cultivate 2-3d, observe bacterial plaque growing state, and take a picture and preserve, result is as shown in Figure 6: along with the increase of salt concn in substratum, all variation gradually of each bacterial classification, but the growing state of ena1-AnVP1 bacterial strain is all better than ena1 bacterial strain under same salt concn, illustrate that AnVP1 gene inoculation of the present invention is to can normal expression after in yeast thalline and be that bacterial strain demonstrates salt resistant function.

embodiment 15

The present embodiment is yeast high temperature stress controlled trial, and step is as follows:

(1) mono-clonal of picking wild-type yeast bacterial strain WT, mutant strain ena1 and transgenosis bacterial strain ena1-AnVP1, yeast strain WT and mutant strain ena1 are seeded to YPD liquid nutrient medium, and transgenosis bacterial strain ena1-AnVP1 is seeded in the YNB liquid nutrient medium of HIS disappearance; In 30 ° of C, 200rpm carries out incubated overnight;

(2) next day in 1:100 ratio enlarged culturing to OD ₆₀₀during=1.2-1.5, with aqua sterilisa, be diluted to the OD of each bacterium liquid ₆₀₀be about 1.0; Then by 100 μ L/ pipes minute, be filled to the EP pipe of 1.5ml, in 53 ° of C water-baths, carry out pyroprocessing 2min, 4min, 6min, 8min, 10min; The bacterium liquid of cultivating with 30 ° of C contrasts;

(3) by the bacterium liquid after processing in 4 ° of cooling 3 min of C refrigerator, doing 5 times of gradients dilutes, respectively obtain three dilution bacterium liquid of difference, from each dilution bacterium liquid, get 3 μ L, point is to YPD solid medium, transgenosis bacterial strain ena1-AnVP1 arranges 3 Duplicate Samples, is designated as respectively ena1-AnVP1-1, ena1-AnVP1-2 and ena1-AnVP1-3;

(4) 30 ° of C are inverted and cultivate 2-3d, observe bacterial plaque growing state, and take a picture and preserve, and result as shown in Figure 7.Increase along with the water-bath time, the growing state of each bacterial classification is variation gradually all, but the growing state of ena1-AnVP1 bacterial strain is all better than ena1 bacterial strain and WT bacterial strain under the same water-bath time, illustrate that AnVP1 gene inoculation of the present invention is to can normal expression after in yeast thalline and make bacterial strain demonstrate high temperature resistant function.

embodiment 16

The present embodiment is yeast drought stress controlled trial, and step is as follows:

(2) next day in 1:100 ratio enlarged culturing to OD ₆₀₀during=1.2-1.5, with aqua sterilisa, be diluted to the OD of bacterium liquid ₆₀₀be about 1.0; Then with aqua sterilisa, do 5 times of gradient dilutions, respectively obtain three dilution bacterium liquid of difference;

(3) from each dilution bacterium liquid, get 3 μ L, point is to adding on the YPD solid osmotic stress substratum of 0 mol/L, 2.0 mol/L, 3.0 mol/L D-glucitols (Sorbitolum) respectively, transgenosis bacterial strain ena1-AnVP1 arranges 3 Duplicate Samples, is designated as respectively ena1-AnVP1-1, ena1-AnVP1-2 and ena1-AnVP1-3;

(4) 30 ° of C are inverted and cultivate 2-3d, observe bacterial plaque growing state, and take a picture and preserve, and result as shown in Figure 8.Increase along with sorbitol concentration in substratum, the growing state of each bacterial classification is variation gradually all, but the growing state of ena1-AnVP1 bacterial strain is all better than ena1 bacterial strain and WT bacterial strain under same sorbitol concentration, illustrate that AnVP1 gene inoculation of the present invention is to can normal expression after in yeast thalline and make bacterial strain demonstrate drought-enduring function.

Claims

1. an application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus, it is characterized in that, use it for the yeast strain that preparation has salt tolerant, drought-enduring, high temperature resistant function, described gene is AnVP1 gene, nucleotide sequence is as shown in SEQ ID NO.1, and the method that described preparation has the yeast strain of salt tolerant, drought-enduring, high temperature resistant function specifically comprises the following steps:

1) at described AnVP1 gene two ends, add restriction enzyme site: design and synthesize with the upstream primer vpU of XhoI restriction enzyme site with the downstream primer vpD of BamHI restriction enzyme site, carry out the pcr amplification of AnVP1 gene,

vpU:5’-AACCTCGAGATGGGTGCAGCCATTCTCC-3’，

vpD:5’-CTGGATCCTTTTAGATCTTGAAGAGTAAGCCACC-3’；

2) build the expression vector pRS6-AnVP1 of transformed yeast mutant strain ena1: with T4DNA ligase enzyme, the AnVP1 fragment through XhoI and BamHI double digestion is connected with pRS6 linear expression vector skeleton;

3) expression vector pRS6-AnVP1 is identified with double digestion and detected;

4) prepare the competence of yeast mutation bacterial strain ena1;

5) by expression vector pRS6-AnVP1 transformed yeast mutant strain ena1 competence, obtain there is salt tolerant, the yeast strain of drought-enduring, high temperature resistant function.

2. the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus according to claim 1, is characterized in that: aminoacid sequence corresponding to the described nucleotide sequence of this gene is as described in SEQ ID NO.2.

3. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 1, it is characterized in that, the cloning process of described gene order comprises following key step:

(1) extraction and the purifying of total RNA:

Adopt general RNA extracting method and purification process, from the short Ammopiptanthus mongolicus Leaves of plant, extract the total RNA of short Ammopiptanthus mongolicus Leaves that obtains purifying;

(2) clone of intermediate segment:

Synthesizing of A, intermediate segment cDNA the first chain

Using the total RNA of short Ammopiptanthus mongolicus Leaves of above-mentioned steps (1) purifying as template, with 3 ' RACE Adaptor primer, carry out reverse transcription, cDNA the first chain obtaining, template as pcr amplification in following step B, described 3 ' RACE Adaptor primer is from the 3 '-Full RACE Core Set Ver.2.0 of TaKaRa company, Code:D314 test kit;

B, pcr amplification

Using cDNA first chain of aforementioned steps A gained intermediate segment as template, utilize following upstream primer jf3 and downstream primer jx3, carry out pcr amplification:

jf3:5’-GGTCTTCTATGGCTTTGTTYGG-3’，

jx3:5’-TRGCAGARAACCAGTAAGGRAG-3’；

Amplification obtains the I type vacuole skin pyrophosphatase gene cDNA intermediate segment of short Stem and leaf of Mongolian Ammopiptanthus, by cloning and sequencing, obtains intermediate segment sequence;

The clone of (3) 3 ' ends:

C, 3 '-outer pcr amplification

The intermediate segment sequence obtaining according to above-mentioned steps (2), design and synthesize specificity upstream primer GSP3-3 '-outer, cDNA first chain of abovementioned steps (2) A gained of take is template, utilize following specificity upstream primer GSP3-3 '-outer and 3 ' end downstream primer 3 '-RACE outer, carry out 3 ' end outer pcr amplification:

GSP3-3’-outer:5’-TCGCTGTTGGTCTCTGGGCAGGGCTTAT-3’，

3’-RACE outer:5’-TACCGTCGTTCCACTAGTGATTT-3’；

The product that amplification obtains is cDNA 3 ' end;

D, 3 '-inner pcr amplification

According to abovementioned steps (2) gained intermediate segment terminal sequence, design and synthesize specificity upstream primer GSP3-3 '-inner, the outer PCR product that the abovementioned steps C gained 3 ' of take is held is template, utilize following specificity upstream primer GSP3-3 '-inner and 3 ' end downstream primer 3 '-RACE inner, carry out 3 ' end inner pcr amplification:

GSP3-3’-inner:5’-CCATTGGTTCTGCCGCCCTTGTGTCTTT-3’，

3’-RACE inner:5’-CGCGGATCCTCCACTAGTGATTTCACTATAGG-3’；

The clone of (4) 5 ' ends:

CDNA first chain of E, synthetic 5 ' end:

Using the total RNA of short Ammopiptanthus mongolicus Leaves of above-mentioned steps (1) purifying as template, RNA is carried out to pre-treatment, add 5 ' RACE Adapter primer to carry out reverse transcription, the concrete sequence of described 5 ' RACE Adapter is:

5’-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA-3’；

Synthetic cDNA the first chain that obtains reverse transcription product 5 ' end;

F, 5 '-outer pcr amplification

The intermediate segment sequence obtaining according to above-mentioned steps (2), design and synthesize specificity downstream primer GSP3-5 '-outer, cDNA first chain of aforementioned step e gained reverse transcription product of take is template, utilize following specificity downstream primer GSP3-5 '-outer and 5 ' end upstream primer 5 '-RACE outer, carry out 5 ' end outer pcr amplification:

GSP3-5’-outer:5’-TAAGCAAGCAAACAAGGATACCCACAG-3’，

5’-RACE outer:5’-GCTGATGGCGATGAATGAACACTG-3’；

The product that amplification obtains is cDNA 5 ' end;

G, 5 '-inner pcr amplification

According to abovementioned steps (2) gained intermediate segment sequence, design and synthesize specificity downstream primer GSP3-5 '-inner, the outer PCR product that the aforementioned step F gained 5 ' of take is held is template, utilize following specificity downstream primer GSP3-5 '-inner and 5 ' end upstream primer 5 '-RACE inner, carry out 5 ' end inner pcr amplification:

GSP3-5’-inner:5’-GGAAGCAACAACGAGAGCGGCACAGGA-3’，

5’-RACE inner:5’-CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3’；

(5) splicing of cDNA full length sequence and clone

Above-mentioned steps (2) gained intermediate segment, step (3) gained 3 ' end inner pcr amplification sequence and step (4) gained 5 ' end inner pcr amplification sequence are carried out to the splicing of complete sequence, obtain complete gene order;

(6) clone of I type vacuole skin pyrophosphatase gene:

Using cDNA first chain of the synthetic 5 ' end of above-mentioned steps (4) as template, according to gene sequencing design upstream primer ORF3-S and the downstream primer ORF3-A of above-mentioned steps (5), the performing PCR of going forward side by side amplification, the concrete sequence of described upstream primer ORF3-S and downstream primer ORF3-A is respectively:

ORF3-S:5’-ATGGGTGCAGCCATTCTCCC-3’，

ORF3-A:5’-TTAGATCTTGAAGAGTAAGCCACCATG-3’；

4. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, in the step of the cloning process of described gene order (1), the RNA extracting method of employing is test kit method; Purification process is dnase digestion method.

5. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, while carrying out pcr amplification in the step of the cloning process of described gene order (2),

Amplification system is:

I type vacuole skin pyrophosphatase gene intermediate segment amplification program is:

95℃，3min；

95 ℃, 30s, 58 ℃, 30s, 72 ℃, 1min; 35 circulations;

72 ℃, 8min; 4 ℃ of insulations.

6. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, while carrying out 3 '-outer pcr amplification in the step of the cloning process of described gene order (3),

Amplification system is:

Amplification program is:

95℃，3min；

95 ℃, 30s; 55 ℃, 30s; 72 ℃, 1min 30s; 35 circulations;

72 ℃, 8min; 4 ℃ of insulations.

7. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, while carrying out 3 '-inner pcr amplification in the step of the cloning process of described gene order (3),

Amplification system is:

Amplification program is:

95℃，3min；

95 ℃, 30s; 55 ℃, 30s; 72 ℃, 1min 30s; 35 circulations;

72 ℃, 8min; 4 ℃ of insulations.

8. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, while carrying out 5 '-outer pcr amplification in the step of the cloning process of described gene order (4),

Amplification system is:

Amplification program is:

95℃，3min；

95 ℃, 30s; 60 ℃, 30s; 72 ℃, 2min 30s; 35 circulations;

72 ℃, 8min; 12 ℃ of insulations.

9. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, while carrying out 5 '-inner pcr amplification in the step of the cloning process of described gene order (4),

Amplification system is:

Amplification program is:

95℃，3min；

95 ℃, 30s; 60 ℃, 30s; 72 ℃, 2min 30s; 35 circulations;

72 ℃, 8min, 12 ℃ of insulations.

10. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 3, it is characterized in that, while carrying out pcr amplification in the step of the cloning process of described gene order (6),

Amplification system is:

I type vacuole skin pyrophosphatase gene amplification program is:

98 ℃, 30s; 62 ℃, 30s; 72 ℃, 2min 30s; 35 circulations.

11. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 1, it is characterized in that, described preparation has the method steps 1 of the yeast strain of salt tolerant, drought-enduring, high temperature resistant function) at described AnVP1 gene two ends, add restriction enzyme site, method is as follows:

According to AnVP1 gene fragment, design and synthesize with the upstream primer vpU of XhoI restriction enzyme site with the downstream primer vpD of BamHI restriction enzyme site, carry out the pcr amplification of AnVP1 gene:

vpU:5’-AACCTCGAGATGGGTGCAGCCATTCTCC-3’；

vpD:5’-CTGGATCCTTTTAGATCTTGAAGAGTAAGCCACC-3’；

Amplification system is:

Amplification program is:

94℃，2min；

98 ℃, 10s; 68 ℃, 2min 30s, 30 circulations;

Getting gained amplified production detects through 1% agarose gel electrophoresis; The product that obtains of amplification be two ends with the AnVP1 gene of restriction enzyme site, by cloning and sequencing, checking amplified fragments is correct.

12. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 1, it is characterized in that, described preparation has the method steps 2 of the yeast strain of salt tolerant, drought-enduring, high temperature resistant function) in to build the method for expression vector pRS6-AnVP1 of transformed yeast mutant strain ena1 as follows:

(1) the AnVP1 fragment of amplification and the preparation of expression vector pRS6 skeleton step 1):

With restriction enzyme XhoI and BamHI, press following system double digestion step 1) middle AnVP1 fragment and the expression vector pRS6 increasing;

Double digestion system:

30 ℃ of enzymes were cut after 8 hours, retrieve and purification after 1% agarose gel electrophoresis detects;

(2) structure of expression vector pRS6-AnVP1:

With T4DNA ligase enzyme, will by following system, be connected with pRS6 linear expression vector skeleton with the AnVP1 fragment that BamHI double digestion reclaims after purifying through XhoI;

Linked system:

16 ℃ connect 8 hours, retrieve and purification after 1% agarose gel electrophoresis detects.

13. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 1, it is characterized in that, described preparation has the method steps 3 of the yeast strain of salt tolerant, drought-enduring, high temperature resistant function) in the evaluation of expression vector pRS6-AnVP1 as follows with the concrete grammar of double digestion detection:

(1) PCR of expression vector pRS6-AnVP1 identifies;

(2) double digestion of expression vector pRS6-AnVP1 detects:

The positive bacteria liquid that (1) is identified is inoculated into the fresh LB liquid nutrient medium that contains Amp by the ratio row of 0.1:50, and 37 ℃ of shaking culture are spent the night, and extracts plasmid and with XhoI and BamHI, does double digestion and identify;

(3) enzyme being cut to the correct corresponding bacterium liquid of plasmid checks order.

14. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 1, it is characterized in that, described preparation has the method steps 4 of the yeast strain of salt tolerant, drought-enduring, high temperature resistant function) in the competent preparation process of yeast mutation bacterial strain ena1 as follows:

(1) yeast strain ena1 is incubated on YPD solid medium, is inverted for 30 ℃ and cultivates;

(2) the mono-clonal thalline of a 2-3mm of picking is in 3mL YPD liquid nutrient medium, and 30 ℃, 200r/min shaking table is cultivated 8-12h;

(3) get 5 μ L cultures to the fresh YPD liquid nutrient medium of 50mL, shaking table is cultured to the light absorption value OD of bacterium liquid under 600nm wavelength ₆₀₀for 0.15-0.3;

(4) 700r/min, 5min, the centrifugal thalline of room temperature, abandons supernatant, and precipitation is resuspended in 100mL YPD liquid nutrient medium;

(5) 30 ℃ are cultured to OD ₆₀₀=0.4-0.5;

(6) by the centrifuge tube of culture evenly distribute to two 50mL, 700r/min, the centrifugal 5min of room temperature; Abandon supernatant, precipitation is suspended in 30mL deionized water;

(7) 700r/min, the centrifugal 5min of room temperature; Abandon supernatant, precipitation is resuspended in 1.5mL 1.1 * TE/LiAc;

(8) the resuspended thing of thalline is transferred in the centrifuge tube of 1.5mL to high speed centrifugation 15s;

15. according to the application that derives from the I type vacuole skin pyrophosphatase gene of short Stem and leaf of Mongolian Ammopiptanthus claimed in claim 1, it is characterized in that, described preparation has the method steps 5 of the yeast strain of salt tolerant, drought-enduring, high temperature resistant function) in the competent concrete steps of expression vector pRS6-AnVP1 transformed yeast mutant strain ena1 as follows:

(1) preparation of single-stranded vector DNA: claim 1g salmon sperm dna to be dissolved in 100mL TE damping fluid, with 10mL transfer pipet, repeatedly twitch DNA is uniformly dispersed up and down, then be placed in magnetic stirring apparatus vigorous stirring 2-3h until dissolve completely, or by solution sealing, put in freezer and stir and spend the night, packing DNA sample, put under-20 ℃ of conditions and preserve, before use, put in boiling water bath at least 5min, be placed in afterwards ice bath cooling fast;

(2) get 2 μ L target plasmid pRS6-AnVP1, with 5 μ L single-stranded vector DNA, in the centrifuge tube of 1.5mL, then add 50 μ L yeast competent cells, mix gently;

(3) add inside again 0.5mL PEG/LiAC, mix gently;

Cultivate 30min, every 10min, mix once for (4) 30 ℃;

(5) add again 20 μ L DMSO, mix gently;

(6) 42 ℃, water-bath 20min, mixes once every 5min;

(7) high speed centrifugation 15s, abandons supernatant;

(8) precipitation is resuspended in 1mL YPD liquid nutrient medium, and 30 ℃, shaking table is cultivated 90min;

(9) high speed centrifugation 15s, abandons supernatant, in the NaCl that re-suspended cell is 0.9% in 1mL w/v concentration;

(10) get on the YNB substratum that the dilution mixed solution of 100 μ L 1/10 or 1/100 is coated in Histidine disappearance, be placed in 30 ℃, cultivate 2-4d, and select transformant.