CN110229818A - Wax plum CpSNAC1 gene promoter and its application - Google Patents

Abstract

The present invention relates to genetic engineering fields, and in particular to wax plum CpSNAC1 gene promoter and its application.It is an object of the invention to provide a kind of new selection to improve wax plum resistance.The present invention expands the promoter for obtaining wax plum CpSNAC1 gene for the first time, and it clones and obtains 3 CpSNAC1 promoter deletion segments, the expression characterization that CpSNAC1 gene is detected by Real-Time Fluorescent Quantitative PCR Technique, passes through the methods of transgenic technology, GUS histochemical stain, GUS enzymatic activity quantitative detection preliminary identification the expression regulation feature of CpSNAC1 gene promoter.The result can provide reference for research wax plum environment stress associated regulatory.

Description

Wax plum CpSNAC1 gene promoter and its application

Technical field

The present invention relates to genetic engineering fields, and in particular to wax plum CpSNAC1 gene promoter and its application.

Background technique

Wax plum (Chimonanthus praecox L.), bush of falling leaves warm up ground often half evergreen shape of performance, highly up to 3 ~4m, December at florescence, open before lamina, fruit about August was mature in March, the 2nd.Wax plum is one kind of Calycanthaceae wax-cakes bait The extremely strong tree species of ornamental value, element in severe winter proud snow to hold and name, and flower color is simple and elegant, and The scent of flowers assails the nostrils, refreshing, is Traditional famous flower and tree in China, other than ornamental value with higher, there are also precious cultureal value, medical value and economy Value.With the development of Modern Molecular Biotechnology, valence has been applied from traditional taxonomy research with some to the research of wax plum It is worth the research steering research of molecular level.

NAC (NAM, ATAF1, ATAF2 and CUC2) transcription factor family is maximum transcription factor man in Plant Genome One of race and the distinctive transcription factor of plant.The name of NAC family transcription factor, which is derived from 3 delivered earliest, has NAC knot The acronym of structure domain gene, be respectively the NAM gene found from petunia and the ATAF1/2 found from arabidopsis and CUC2 gene.Plant NAC transcription factor has multiple functions, to the Stress response of the growth and development of plant regulation, plant, Regulate and control the disease resistance of plant, participate in that there is important work in the physiology courses such as Plant Secondary Materials adjusting and controlling growth and hormone signal transduction With.

Currently, the research in relation to NAC gene transcription factor than it is wide with it is thorough, but to the correlation of its promoter It studies and few.Correlative study is found in NAC family gene promoter sequence in addition to containing promoter TATA-box, CAAT-box Except basic constituent element, also containing it is some it is distinctive with hormone, degeneration-resistant border, histoorgan the relevant cis- work such as develop With element, thus it is speculated that play regulating and controlling effect to the activation and induction of NAC transcription factor.

Summary of the invention

It is an object of the invention to provide a kind of new selection to improve wax plum resistance.

The present invention provides wax plum CpSNAC1 gene promoter, nucleotide sequence such as SEQ ID No.15 the 974th~ Shown in 1437.

Further, the wax plum CpSNAC1 gene promoter, nucleotide sequence such as SEQ ID No.15 the 727th Shown in~1437.

Further, the wax plum CpSNAC1 gene promoter, nucleotide sequence such as SEQ ID No.15 the 215th Shown in~1437.

Further, the wax plum CpSNAC1 gene promoter, nucleotide sequence is as shown in SEQ ID No.15.

The present invention also provides purposes of the wax plum CpSNAC1 gene promoter in regulation plant stress resistance.

Specifically, the plant is arabidopsis or wax plum.

Specifically, the adverse circumstance is hormone, with high salt, arid, high temperature or low temperature.

Specifically, the HORMONE TREATMENT is 50 μM of L of concentration^-1Abscisic acid processing.

Specifically, described is with high salt for concentration 150mML^-1NaCl processing.

Specifically, the PEG that the arid is 10% mass fraction of concentration is handled.

Specifically, the high temperature is 42 DEG C.

Specifically, the low temperature is 4 DEG C.

Beneficial effects of the present invention: the present invention clones the promoter for obtaining wax plum CpSNAC1 gene for the first time, and clones and obtain 3 CpSNAC1 promoter deletion segments pass through the side such as transgenic technology, GUS histochemical stain, GUS enzymatic activity quantitative detection The method preliminary identification expression regulation feature of CpSNAC1 gene promoter.By the study found that promoter and tune in the application The ability for controlling plant reply adverse circumstance (hormone, arid, with high salt, high temperature, low temperature) is closely related, which can be research wax plum adverse circumstance It coerces associated regulatory and reference is provided.

Detailed description of the invention

Fig. 1 CpSNAC1 gene promoter sequence.

The sequence that Fig. 2 is CpSNAC1pro is analyzed.5UTR Py-rich stretch: transcriptional level cis acting member is improved Part；AAGAA-motif: it is related to the cis-acting elements of abscisic acid reaction；ABRE: it is related to the cis acting member of abscisic acid reaction Part；ACE: cis acting element is related to optical Response；ARE: the necessary cis-regulating element of anaerobic induction；ATCT-motif: it relates to And a part of the conservative DNA module of optical Response；AuxRR-core: the cis-acting regulatory member of auxin response is participated in Part；Box 4: it is related to a part of the conservative DNA module of optical Response；Box I: light response element；Box-W1: fungi induces Agent response element；CAAT-box: common cis-acting elements in promoter and enhancer region；CAT-box: with separate living tissue Express relevant cis-acting regulatory element；CATT-motif: part light response element；CE3: the suitable of ABA and VP1 reaction is participated in Formula functional element；CGTCA-motif: the adjusting element of cis acting is related to MeJA reaction；G-Box: it is related to the suitable of photoreactivity Formula acting Regulatory Elements；G-box: it is related to the cis-acting regulatory element of photoreactivity；GA-motif: part light response element； GARE-motif: gibberellin response element；GCN4_motif: it is related to the cis regulatory elements of endosperm expression；I-box: part light Response element；MBS:MYB binding site is related to drought-inducible；O2-site: the cis- of zeins metabolic regulation is participated in Acting regulatory element；P-box: gibberellin response element；Skn-1_motif: cis-acting regulatory element needed for endosperm expression； Sp1: light response element；TATA-box: transcripting start point of the core promoter element -30 or so；TC-rich repeats: It is related to the cis-acting elements of defence and stress reaction；TCA-element: it is related to the cis acting element of salicylism reaction； TGA-element: auxin response element；TGACG-motif: the adjusting element of cis acting is related to MeJA reaction； Circadian: the cis-acting regulatory element of circadian rhythm control is participated in.

Fig. 3 is CpSNAC1 gene promoter structural schematic diagram, and red arrow indicates missing segment position.TCA: it is related to water The reactive cis acting element of poplar acid；ABRE: it is related to the cis-acting elements of abscisic acid reaction；Circadian: it participates in round the clock The cis-acting regulatory element of rhythm detection；P-BOX: gibberellin response element；TC-rich: it is related to defence and stress reaction Cis-acting elements；AuxRR-core: the cis-acting regulatory element of auxin response is participated in；MBS:MYB binding site； CGTCA: the adjusting element of cis acting is related to MeJA reaction；GARE: gibberellin response element；TGACG: the adjusting of cis acting Element is related to MeJA reaction；CAT-box: cis-acting regulatory element relevant to separate living tissue expression；CE3: participate in ABA and The cis-acting elements of VP1 reaction.

Fig. 4 is each missing segment schematic diagram of CpSNAC1 gene promoter.

Fig. 5 is the instantaneous Activity determination of CpSNAC1pro/CpSNAC1pro-D1/D2/D3.Agrobactertum GV3101 Blank: Agrobacterium GV3101 empty bacterium strain；35S promoter control pcambial1305: it is opened containing CaMV35S The pcambial carrier of mover；CpSNAC1 promoter CpSNAC1pro:CpSNAC1 promoter overall length；CpSNAC1-D1 Promoter CpSNAC1pro-D1:CpSNAC1 promoter deletion segment D1；CpSNAC1-D2 promoter CpSNAC1pro-D2:CpSNAC1 promoter deletion segment D2；CpSNAC1-D3 promoter CpSNAC1pro-D3: CpSNAC1 promoter deletion segment D3.

Fig. 6 is that CpSNAC1pro/CpSNAC1pro-D1/D2/D3 transgenic arabidopsis 1-10d sprouts chemical staining.WT: Wildtype Arabidopsis thaliana；1305: turning the arabidopsis of pcambia empty carrier.

Fig. 7 is to turn CpSNAC1 gene promoter and its each missing segment arabidopsis histochemical stain.Scheming A~D is respectively Each histochemistry's dye of CpSNAC1pro, CpSNAC1pro-D1, CpSNAC1pro-D2 and CpSNAC1pro-D3 transgenic arabidopsis Color；A~L is flowers, flower, petal, calyx, pistil, style, stem, fruit pod, lotus throne leaf and stem leaf respectively.

Fig. 8 is the expression analysis of gus gene after the processing of CpSNAC1pro transgenic arabidopsis abiotic stress.

Fig. 9 is BSA standard curve.

Figure 10 is 4-MUG standard curve.

Figure 11 be the good Stress treatment of not isogeneous induction after CpSNAC1pro, CpSNAC1pro-D1, CpSNAC1pro-D2 and CpSNAC1pro-D3 transgenic arabidopsis GUS enzyme assay.A:50μM·L^-1ABA；B:150mM·L^-1Nac；C:10% PEG；D:4 DEG C of low temperature；E:42 DEG C of high temperature.

Figure 12 is the quasi- south of CpSNAC1pro, CpSNAC1pro-D1, CpSNAC1pro-D2 and CpSNAC1pro-D3 transgenosis Mustard organizes GUS enzyme activity determination.

Figure 13 is the Multiple Sequence Alignment result of the albumen of CpSNAC1 coding and the NAC albumen of other species.Sequence derives from NCBI (https: //www.ncbi.nlm.nih.gov/): ZmNAC1 (GenBank ID:PWZ31933), GmNAC1 (GenBank ID:NP_001240958)、ANAC072(GenBank ID:OAO97067)、ATAF1(GenBank ID: CAA52771)、ATAF2(GenBank ID:AAM65967)、GmNAC4(GenBank ID:NP_001238424)、NnNAC2 (GenBank ID:XP_010268987)

Figure 14 is the albumen clustering that CpSNAC1 encodes albumen.

Specific embodiment

The separation of 1 wax plum CpSNAC1 gene of embodiment

Wintersweet leaf piece total serum IgE is extracted with Trizol method, cDNA is synthesized by reverse transcription.According to wintersweet immature flower transcript profile database Known sequence fragment in library designs special primer with software Primer primer 5.0 and carries out PCR amplification, and primer sequence is such as Under:

NAC1-ORF-F:5'-gttgtgaggcgcatttcttgcgt-3'(SEQ ID No.3)

NAC1-ORF-R:3'-gcttctgctctacatgctcttcctc-5'(SEQ ID No.4)

Using wax plum cDNA as template, wax plum CpSNAC1 gene is expanded, PCR reaction system and reaction condition are as follows: ddH₂II 2.5 1.5 μ L, SNAC1-ORF-F (10 μM) 1 of μ L, dNTP (10mM) of O17.8 μ L, 10 × HiFi Taq PCR Buffer 1 μ L of μ L, SNAC1-ORF-R (10 μM), wax plum cDNA1 μ L, TaKaRa Ex Taq^TM0.2μL.94 DEG C of initial denaturation 5min；94℃ It is denaturalized 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 1min, 28 recycle；72 DEG C of extension 10min.

It is connected to pMD19-T carrier after PCR product is recycled, converts competent escherichia coli cell Top10, picking recombination Son is sequenced, and wax plum CpSNAC1 gene cDNA sequence is as shown in SEQ ID No.1.

Note: this step Trizol reagent used,RT-PCR Kit reverse transcription reagent box, ExTaq enzyme, HiFi Taq enzyme, pMD19-T carrier are purchased from Japanese TaKaRa company (Dalian)；Plastic recovery kit, plasmid extraction kit, DNA molecular amount standard DL2000 is purchased from TIANGEN Biotech (Beijing) Co., Ltd.；E. coli competent Top10 is by southwestern big Learn the self-control of landscape flower research institute.

The cDNA overall length of CpSNAC1 gene is 1008bp, and the maximum open reading frame comprising 891bp encodes 297 amino Acid.Blastp comparison (Figure 13) is carried out in ncbi database, as the result is shown wax plum CpSNAC1 gene coded protein (SEQ ID No.2) with arabidopsis ATAF1, ATAF2, soybean GmNAC2, corn ZmNAC1 protein sequence homology with higher.Construct into Change tree analysis and finds (Figure 14) that CpSNAC1 belongs to SNAC subfamily, in heredity apart from upper, CpSNAC1 and soybean GmNAC2, The evolutionary distance of arabidopsis ATAF1 is closer, and the genes such as ATAF1, GmNAC2 and ZmNAC1 have been proved to possess stress response function Energy.

The clone of 2 wax plum CpSNAC1 promoter of embodiment

The extraction of 1 wax plum genomic DNA

Wax plum genome DNA is extracted using CTAB method.

(1) 0.1g wax plum young leaflet tablet is taken, the grind into powder in liquid nitrogen moves into 1.5mL centrifuge tube；

(2) 750 μ L, 65 DEG C of CTAB extracting solutions preheated are added, is vortexed mixes rapidly；

(3) 65 DEG C of water-baths crack 45min, gently shake once every 15min.

(4) it takes out, is added in draught cupboard isometric chloroform isoamyl alcohol (24:1) after cooling, gentle inversion mixes, static 10min；

(5) 12,000rpm, 4 DEG C of centrifugation 10min；

(6) supernatant is taken, the isopropanol of isometric -20 DEG C of pre-coolings is added, mixes, is placed in 30min on ice, white flock occur Precipitating；

(7) 12,000rpm, 4 DEG C of centrifugation 10min；

(8) supernatant is removed, is rinsed 2~3 times with 75% ethyl alcohol, then is rinsed once with 1mL dehydrated alcohol；

(9) precipitating is placed on superclean bench or 64 DEG C or less insulating boxs is dry, until translucent；

(10) it is dissolved with 50 μ L TE or the ultrapure water of sterilizing, the nucleic acid-protein for taking 1 μ L DNA German company to produce is surveyed Determine the concentration of instrument measurement, -20 DEG C of placements are spare.

2 chromosome walking methods expand CpSNAC1 gene upstream sequence

(1) design of primers

Wintersweet immature flower transcript profile database (SRA, http://www.ncbi.nlm.nih.gov/ of research on utilization room building Traces/sra. accession number SRA106143) CpSNAC1Unigene segment is obtained, passed through according to Unigene sequence obtained RACE PCR obtains 5 '-UTR and 3 '-UTR respectively, after sequence assembly, obtains global cDNA sequence.CpSNAC1 gene CDNA overall length is 1008bp, which contains the open reading frame that a 871bp encodes 297 amino acid.With the gene Based on the open reading frame of 871bp, unknown fragment principle is expanded using gene walking method, with software Primer Premier 5.0, it designs 2 downstream special primers and carries out PCR amplification, primer sequence is as follows:

NAC1-SP1:5'-gctcttcctccatctcattctccctgc-3'(SEQ ID No.5)

NAC1-SP2:5'-gaacagcaatcggttgtgaggcg-3'(SEQ ID No.6)

(2) building of genomic walking digestion template

Genomic DNA walker kit is referring to Genome Walker^TMSpecification in Universal Kit carries out.Take wax Each 1 μ g of plum genomic DNA is respectively adopted Dra I, EcoR V, Pvu II and I 4 kinds of Stu flat end enzymic digestions, then produces digestion Object carries out purification process, is then walked the upstream and downstream genome of product and kit with T4-DNA ligase (TaKaRa, Dalian) It moves adapter to carry out staying overnight connection in 16 DEG C of water-baths, constructs 4 genomic walking libraries, the Dra I of wax plum genomic DNA, EcoR V, Pvu II and I digestion template of Stu.

(3) PCR reacts

Using two-wheeled nido Touch-Down PCR, reaction system (25 μ L).

With NAC1-SP1 and for primer AP1 (the Universal Genome Walker of linking header sequence^TM 2.0User Manual kit) carry out first round PCR amplification: 10 × Buffer, 2.5 μ L, 2.5mM dNTP0.5 μ L, primer AP1 (10 μ Mol/L) 0.5 μ L, primer SP1 (10 μm of ol/L) 0.5 μ L, Taq archaeal dna polymerase 0.5 μ L, template 1.0 μ L, ddH₂O 19.5μL。

Template by 50 times of first round product dilution, as the second wheel reaction.

With NAC1-SP2 and for primer AP2 (the Universal Genome Walker of linking header sequence^TM 2.0User Manual kit) carry out the second wheel PCR amplification: 10 × Buffer, 2.5 μ L, 2.5mM dNTP0.5 μ L, primer AP2 (10 μ Mol/L) 0.5 μ L, primer SP2 (10 μm of ol/L) 0.5 μ L, Taq archaeal dna polymerase 0.5 μ L, template 1.0 μ L, ddH₂O 19.5μL。

PCR amplification condition: 94 DEG C of 25sec, 72 DEG C of 3min, the first round 7 circulations；94 DEG C of 25sec, 67 DEG C of 3min, first 32 circulation of wheel；67℃10min.94 DEG C of 25sec, 72 DEG C of 3min, the first round 5 circulations；94 DEG C of 25sec, 67 DEG C of 3min, the first round 20 circulations；67℃10min.

It is connected to carrier T after PCR product is recycled, converts competent escherichia coli cell, picking recon is sequenced, Sequencing result is analyzed with DNAstar software.

The online promoter sequence of resulting wax plum CpSNAC1 upstream region of gene promoter sequence is analyzed into software PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html) and PLACE (http://www.dna.affrc.go.jp/PLACE) is analyzed, and is found potentially to transcribe in the promoter conservative region and be adjusted Control element.

The results show that amplification is to CpSNAC1 upstream region of gene 1437bp's from wax plum genome by chromosome walking method Promoter sequence (SEQ ID No.15).It is basic that the promoter sequence contains the promoters such as a large amount of TATA-box, CAAT-box Element and the relevant light of plant gene promise element, and improve 5 ' UTR Py-rich stretch of transcriptional level, abscisic acid Response element ABRE, salicylic acid response element TCA-element, auxin response element AuxRR-core, gibberellin response element Part GARE-motif, be related to arid MYB binding site MBS and defence and stress response element TC-rich repeats Deng (Fig. 2).

The clone of 3 CpSNAC1 gene promoter deletion segments

It is analyzed according to the cis-acting elements of known CpSNAC1 gene promoter sequence, missing segment (figure is carried out to it 3).At the code area CpSNAC1 upstream from start codon about 1228bp, 742bp, 471bp design forward primer, reverse primer with Upper section CpSNAC1 gene promoter full length sequence reverse primer is identical, is named as CpSNAC1-D1-F, CpSNAC1-D2-F, CpSNAC1-D3-F, CpSNAC1-nco1-R.

The comparison signal of deletion sequence obtained and full length sequence is shown in that Fig. 4, CpSNAC1 gene promoter special primer are set It counts as follows:

CpSNAC1-D1-F:aactgcagcaagtagggctaaataacccatttacc (Pst Ι restriction enzyme site) (SEQ ID No.7)

CpSNAC1-D2-F:aactgcagatgttgttgcacgagcgatcaat (Pst Ι restriction enzyme site) (SEQ ID No.8)

CpSNAC1-D3-F:aactgcaggttttccaacacgagccctctct (Pst Ι restriction enzyme site) (SEQ ID No.9)

CpSNAC1-nco1-R:catgccatgggaacagcaatcggttgtgaggc (Nco Ι restriction enzyme site) (SEQ ID No.10)

Using pMD 19-T-CpSNAC1 plasmid as template, PCR amplification is carried out with Taq enzyme.

PCR reaction system reaction system is as follows: ddH₂18.6 μ L, 10 × Toq Taq Buffer of O 2.5 μ L, 2.5mM DNTP 1.5 μ L, CpNAC1-nco1-R (10 μm of ol/L) 1.0 μ L, CpNAC1-D1/D2/D3-F (10 μm of ol/L) 1.0 μ L, Toq 0.2 μ L of Taq archaeal dna polymerase, 0.2 μ L of plasmid.

PCR amplification condition: CpNAC1-D1:94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C extend 1min20s, 28 circulations；72 DEG C of extension 10min.CpNAC1-D2:94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min, 28 circulations；72 DEG C of extension 10min.CpNAC1-D3:94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 40s, 28 recycle；72 DEG C of extension 10min.

Note: the DNA extraction kit that this step uses is purchased from TIANGEN Biotech (Beijing) Co., Ltd.；The examination of gene walking method Agent box (Universal Genome Walker^TM2.0 User Manual), Dra I, EcoR V, Pvu II and I enzyme of Stu be purchased from Japanese TaKaRa company (Dalian).

It is connected to carrier T after PCR product is recycled, converts competent escherichia coli cell, picking recon is sequenced. CpSNAC1 gene promoter each fragment sequence sequence 1223bp, 711bp, 464bp are finally obtained after sequencing, are named as CpSNAC1pro-D1/D2/D3。

The building of 3 wax plum CpSNAC1 promoter plant expression vector of embodiment

The building and verifying of 1 expression vector

According to CpSNAC1 promoter sequence and plant expression vector characteristic, plant expression vector 1305 is selected, it is one Binary vector contains gus gene system and CaMV35S promoter.In order to study the function of CpSNAC1 gene promoter, it is used The 35S promoter in plant expression vector 1305 is replaced, is merged with gus reporter gene, plant expression vector is constructed.With PstI and NcoI distinguishes double digestion by the resulting CpSNAC1 gene promoter of PCR amplification and each deletion fragment and 1305 carriers, returns respectively It is attached reaction after receiving digestion products, connection product is converted into Escherichia coli TOP10, PCR and digestion are identified positive colony, sent Sequencing, and it is named as pcambial1305-CpSNAC1, pcambial1305-CpSNAC1-D1/D2/D3.Positive plasmid is used Electric robin is transferred to Agrobacterium GV3101, falls behind through PCR Preliminary Identification positive bacteria and extracts the progress digestion identification of its plasmid.

Double digestion and connection:

With PstI and NcoI restriction enzyme respectively to CpSNAC1, CpSNAC1-D1, CpSNAC1-D2, CpSNAC1- D3 intermediate vector and 1305 plasmid of plant vector carry out double digestion.Double digestion system: 10 × Green Buffer 2.5 μ L, PstI 0.5 μ L, NcoI 0.5 μ L, CpSNAC1/1305 5 μ L, ddH₂O 11.5μL.After 37 DEG C of digestion 4h, 80 DEG C of inactivation 5min.It carries out Agarose gel electrophoresis separates endonuclease bamhi, recycles target fragment with plastic recovery kit.Then 1305 tables recycling obtained Up to carrier and CpSNAC1, CpSNAC1-D1, CpSNAC1-D2, CpSNAC1-D3 segment, with the ratio of 1:8 or so, according to T4DNA ligase specification is attached reaction, 4 DEG C of connections overnight.Coupled reaction system: 1305 expression vector segment, 7.5 μ L, 1.2 μ L, 10 × T4DNA Ligase Buffer of CpSNAC1 promoter fragment, 1.0 μ L, T4DNA Ligase, 0.3 μ L.

Connection product is converted into Escherichia coli TOP10 competent cell, is coated on 37 on the LB plate of the Kan containing 50mg/L DEG C inversion is incubated overnight, and picking single colonie carries out PCR identification after shaking bacterium culture, is that mention after positive bacterium liquid activation by electrophoresis detection Plasmid is taken to carry out double digestion verifying.Correct positive plasmid finally is verified into PCR identification and double digestion again and send sequencing, determines nothing After base mutation, it is named as 1305-CpSNAC1,1305-CpSNAC1-D1,1305-CpSNAC1-D2,1305-CpSNAC1- D3, as CpSNAC1 gene plant express recombinant vector.

2 expression vectors convert Agrobacterium

Expression vector is transferred in Agrobacterium GV3101 with electric robin.

(1) first electric shock cup is placed in 75% alcohol and impregnates 2h, then used aseptic water washing 3 times, then use dehydrated alcohol Soaking flushing 3 times, then electric shock cup is placed in dry up to be placed on superclean bench and is pre-chilled on ice.

(2) Agrobacterium competent cell GV3101 is taken out from -80 DEG C of refrigerators, is placed in and thaws on ice.

(3) it takes 1 μ L plasmid to be added in the competent cell of 100 μ L defrosting, is softly lashed with pipette tips quiet on ice after mixing Set 30min.

(4) electric converter is assembled, and is placed it on superclean bench, power switch device is opened, voltage is adjusted to 2240V。

(5) mixture of competent cell and recombinant plasmid is fully transferred in electric shock cup groove with liquid-transfering gun, is dried Outer wall.

(6) electric shock cup is put into electric converter, is shocked by electricity, after hearing buzzer, taken out in electric shock cup, 800 μ are added The nonreactive YEB fluid nutrient medium of L pre-cooling, gently lashes mixing.It is transferred into the sterile centrifugation tube of 1.5mL with liquid-transfering gun.

(7) it is placed in 28 DEG C of shaking tables, 3~4h of 180rpm shading shaken cultivation.

(8) 10 μ L bacterium solutions are drawn, it is uniformly applied to YEB (Kan containing 50mg/L and 50mg/L Gen) with sterile painting stick On plating medium, 36~48h of culture is inverted under 28 DEG C of constant temperature, dark conditions.

(9) picking single colonie is placed in 28 DEG C of shaking table 24~36h of dark culturing, carries out PCR identification.Positive colony can be used for Perhaps arabidopsis or the glycerol of final concentration 20% is added in transformation of tobacco, is placed in -80 DEG C of ultra low temperature freezers and saves.

Note: Agrobacterium competence GV3101, the expression vector pcambia1305.1 that this step uses are spent by Southwest University gardens Grass research institute saves；T4DNA ligase, ExTaq enzyme, Top polymerase are purchased from Japanese TaKaRa company (Dalian).

4 wax plum CpSNAC1 promoter of embodiment and its deletion sequence development spatial and temporal expression characteristic and inducing expression characteristic point Analysis

1 inflorescence infestation method arabidopsis thaliana transformation

(1) sowing and culture of arabidopsis

It takes appropriate arabidopsis seed in 1.5mL centrifuge tube, and the sodium hypochlorite of 16.7% concentration is added into centrifuge tube (NaClO) 8~10min (period is sufficiently vibrated) is sterilized, with pipette tips by the NaClO solution washes away on upper layer, then sterile water will be planted Son rinses 4~6 times, then is sowed the seed of arabidopsis on MS culture medium with liquid-transfering gun, is placed in plate after 4 DEG C of vernalization 3d 16h illumination, 8h are dark, cultivate in the environment of 2000Lux lighting condition and 22 DEG C, 70% humidity, and about 12d or so is by quasi- south Mustard transplants into culture substrate (earthworm soil: vermiculite: turf=1:1:1), when arabidopsis grows into scape length about 5cm or so It is infected.

(2) inflorescence infestation method arabidopsis thaliana transformation

1. activating the agriculture containing plant overexpression vector plasmid on YEB+Kan50mg/L+Gen50mg/L culture medium flat plate Bacillus, 28 DEG C of 36~48h of dark culture.

2. picking single colonie is inoculated into 650 μ L YEB (Kan:50mg/L, Gen:50mg/L) fluid nutrient mediums, and 28 DEG C, 200rpm shaken cultivation is for 24 hours.

3. the Agrobacterium bacterium solution to culture carries out PCR identification with special primer, the 500 above-mentioned bacterium solutions of μ L are taken to connect after determining correctly Kind is on the YEB fluid nutrient medium of 25mL nonreactive, and 28 DEG C, 200rpm shaken cultivation to OD600 is spare between 0.8~1.0.

4. drawing the above-mentioned bacterium solution of 10mL in sterile centrifugation tube, 28 DEG C, 5000rpm is centrifuged 15min, outwells supernatant, and it is heavy to collect It forms sediment, then with being now resuspended with infected liquid (+0.5 ‰ L-77 of+5% sucrose of sterile water), being diluted to OD600 is about 0.8.

5. primary infection will cut off the flower opened above Arabidopsis plant, the bud just to have showed money or valuables one carries unintentionally is left behind, furthermore It can be also required to be squirted four wall of carton with watering can before infecting with the humidity to keep matrix of watering for one day before treatment.By scape Head about 0.5cm length, which is put into, to immerse in infected liquid 10 seconds or so, and taking-up is put into carton, is protected from light, after 22 DEG C of culture 20h It takes out, is then transferred into normal growing environment.

6. Secondary Infection can be carried out after infecting 1 week to improve transformation efficiency.

The hygromycin resistance screening and identification of 2 transgenic arabidopsis

2.1 transgenic hygromycin Hyg screening and PCR detection

(1) after arabidopsis thaliana transformation 1 month, mature T0 is collected for seed, is placed in 37 DEG C of constant temperature ovens after about 15d, 4 degree of refrigerator storages are put in, subsequent experimental is used for.

(2) it after T0 carrying out disinfection for transgenic seed, is seeded on the MS plate of the Hyg containing 25mg/L, in 4 after sealing DEG C refrigerator vernalization 3d, is then transferred under normal environment and cultivates, transgenic arabidopsis can normally give birth on the culture medium containing Hyg It is long.

(3) several different strains are obtained, and T1, T2 of each strain are continued to screen for seed, until all strains harvest Seed after planting all can carry out subsequent processing experiment for green resistance seedling.

Using the DNA of positive plant as template, PCR inspection is carried out, whether confirm has the purpose of insertion in transgenic plant Segment.

The detection of 2.2 transgenic arabidopsis GUS chemical stainings

GUS histochemical stain identification is carried out with wild to the transgenic Arabidopsis plants obtained through hygromycin resistance screening Type Arabidopsis plant is negative control, and the transgenic Arabidopsis plants for turning 1305 empty carriers are positive control.

(1) it dyes: taking the Arabidopsis thaliana Seedlings of sowing 12d size in 1.5mL centrifuge tube, prepared GUS dye liquor is added, It is allowed to flood material completely, is placed in 37 DEG C of insulating boxs and is protected from light overnight dyeing.

(2) it decolourizes: taking out sample, absorb dye liquor, 75% ethyl alcohol is added and decolourizes, decolourize 2~3 times, it is right to feminine gender According to be white.

(3) observation identification: with the GUS coloration result of entity microscope observing converting material, and film recording result.

3 CpSNAC1 gene promoters and each deletion fragment transient expression in tobacco leaf

Using the strain of GV3101 empty bacterium as negative control, 1305 bacterial strain of promoter containing CaMV35S is positive control, utilizes Agrobacterium Mediated method distinguishes transformation of tobacco, carries out the identification of GUS transient expression.

(1) preparation of Agrobacterium infected liquid

1. from the positive Agrobacterium bacterium solution of -80 DEG C of ultra low temperature freezers taking-up successful conversions, the strain of GV3101 empty bacterium and containing The bacterial strain of 1305 carriers picks a small amount of bacterium solution with the oese of calcination after sterilization and cooling after thawing, be inoculated in respectively containing In the YEB solid medium tablets of 50mg/L Kan and 50mg/L Gen, be placed in 28 DEG C, be inverted under dark condition culture 36~ 48h。

2. the sizeable single colonie of picking is inoculated in the YEB liquid training that 25mL contains 50mg/L Kan and 50mg/L Gen It supports in base, is placed in 24~36h of shaken cultivation under 28 DEG C of constant temperature dark conditions.

3. above-mentioned cultured bacterium solution is taken to be inoculated in YEB nonreactive liquid medium by 1:50,28 DEG C, 200rpm is protected from light vibration Culture is swung, re-activation is carried out.

4. stop oscillation culture as bacterium solution OD600=0.6~0.8, the cultured bacterium solution of 8mL and 30mL are taken respectively MS1 Liquid Culture is based in sterile culture flask, and mixing is spare, which is for infecting infected liquid used in tobacco.

(2) vegetable material prepares: the sterile tissue culture seedling leaf of tobacco of robust growth is chosen, with sharp aseptic operation blade It is cut into the leaf block of 1cm or so, and discards middle arteries.

(3) it infects: freshly prepd leaf block being respectively placed in the above-mentioned three kinds of Agrobacterium infected liquids being ready for, shading leaching 10min is steeped, should shake gently tissue culture bottle in the process comes into full contact with leaf block with infected liquid.

(4) it co-cultures: taking out leaf block, be placed on aseptic filter paper and suck extra bacterium solution.And the leaf block infected is shifted Onto MS2 culture medium, the back placed face down of leaf block, 25 DEG C of 2~3d of inversion dark culture.

(5) it takes off bacterium: the tobacco leaf after co-cultivation being transferred to MS3 liquid and is taken off in bacterium culture medium, de- bacterium 30min is protected from light, Period shakes gently culture bottle, contacts leaf block cmpletely with de- bacterium solution, and it is more that blade is placed in absorption on aseptic filter paper later Remaining liquid.

(6) step (5) are repeated.

(7) leaf block is placed in sterile water and is rinsed 3 times, each 10min, then blot surplus liquid with aseptic filter paper.

(8) GUS instantaneously dyes detection: randomly selecting the leaf block handled well and carries out GUS staining analysis, by plant tissue to be measured It is placed in 1.5mL centrifuge tube, GUS dyeing liquor is added, after being placed in 37 DEG C of oven overnights, carries out decolorization with 75% ethyl alcohol, Decolorization 2~3 times, each 10min, until negative control is observed when being white with stereomicroscope, and film recording knot Fruit.

The GUS histochemical stain of 4 transgenic arabidopsis is analyzed

(1) it takes the arabidopsis of after planting 1~10d germination process in 1.5mL centrifuge tube, prepared histochemistry is added GUS dye liquor is placed in 37 DEG C of insulating boxs and dyes overnight.With 75% ethanol decolorization 2~3 times, then observed under Stereo microscope It takes pictures, while using wildtype Arabidopsis thaliana as negative control, turns 1305 carriers as positive control.

(2) in order to study each tissue expression specificity of the CpSNAC1 promoter driving gus gene in Arabidopsis plant, Acquire the root, stem, leaf, flower grade fruit progress GUS histochemical stain analysis of adult transgenic Arabidopsis plant.(method is same as above). 5CpSNAC1pro transgenic arabidopsis abiotic stress gus gene quantitative fluorescence analysis

In order to study promoter in translation skill to the response condition of not isogeneous induction, need to handle in the sowing of MS culture medium Each strain, the substantially uniform healthy and strong transgenic arabidopsis of selection growing way, moves into contain 50 μM of L respectively when 10d^-1ABA, 150mM·L^-1The MS culture medium culture of NaCl, 10%PEG for 24 hours, are put choosing the substantially uniform healthy and strong transgenic arabidopsis of growing way Enter 42 DEG C of high temperature and 4 DEG C of low temperature growth cabinets processing 6h and for 24 hours, 3 repetitions of each group experimental setup.It samples and extracts after processing RNA is reversed to cDNA and carries out fluorescence quantitative PCR detection, whether analyzes CpSNAC1 promoter by hormone induction.

It selects arabidopsis Actin gene as reference gene, designs reference gene and gus gene, primer sequence are shown in Table 2.

2 primer sequence of table

Total serum IgE is extracted using Trizol reagent, reverse transcription obtains the first chain of cDNA.Using cDNA as template, use EvaGreen dye method carries out quantitative fluorescent PCR, and 3 times technology repeats.Experiment is according to SsoFast^TM Supermix Kit (Bio-Rad) specification carry out, to the expression in seedling leaves under transgenic plant difference abiotic stress into The analysis of row real-time fluorescence quantitative PCR.Test resulting data Bio-Rad Manager^TM Software(Versio n 1.1) Analysis is usedMethod calculates relative expression quantity of the CpSNAC1 promoter starting downstream gus gene in different materials.Reaction System is as follows: 2 × SsoFastEvaGreen Supermix 5 μ L, Primer-F (10 μM) 0.5 μ L, Primer-R (10 μM) 0.5 μ L, cDNA template, 0.5 μ L, RNase Free dH₂O 3.5μL。

6 transgenic arabidopsis respectively organize and abiotic stress under gus protein quantitative detection

Root, stem, leaf, flower and the fruit pod progress GUS Enzyme assay of acquisition adult transgenic Arabidopsis plant, while in order to Promoter is studied to the response condition of not isogeneous induction, selects growing way in MS culture medium sowing each strain to be treated, 10d Substantially uniform healthy and strong transgenic arabidopsis moves into contain 50 μM of L respectively^-1Abscisic acid (ABA), 150mML^-1Nacl、 The MS culture medium culture 48h of 10%PEG (simulating drought) is put into 42 choosing the substantially uniform healthy and strong transgenic arabidopsis of growing way DEG C high temperature and 4 DEG C of low temperature growth cabinets processing 6h and for 24 hours, carry out the quantitative detection of gus protein to it respectively after processing.

Using the Varioskan multi-functional readout instrument of Flash full wavelength scanner formula (multi-function microplate reader), according to Bradford (1976) method carries out the measurement of total protein content, and the method for Li et al. (2009) carries out the measurement of GUS enzymatic activity.

(1) preparation of protein standard curve

7 1.5mL centrifuge tubes are taken using modified form Bradford method determination of protein concentration kit, make BSA by table 3 Protein concentration gradient:

3 reaction system of table

Deionized water (μ L)	1000	995	990	985	980	975	970
								BSA protein standard liquid (μ L)	0	5	10	15	20	25	30
Final protein concentration (μ g/mL)	0	5	10	15	20	25	30

After mixing, the absorbance value at 595nm is measured on multi-function microplate reader, makes standard curve.

(2) production of 4-MU standard curve

4-MU gradient concentration liquid is prepared according to table 4 with 4-MU and reaction terminating liquid:

4 reaction system of table

1μM 4-MU(μL)	0	62.5	125	250	500	1000
							Reaction terminating liquid (μ L)	1000	937.5	875	750	500	0
Final concentration (nM)	0	62.5	125	250	500	1000

After mixing, with multi-function microplate reader under the conditions of exciting light 365nm, transmitting light 455nm, slit 10nm, measurement The fluorescent value of each sample draws standard curve.

(3) gus protein extracts

Take 100mg fresh plant sample, clayed into power by the way of liquid nitrogen grinding, be collected into immediately 1.5mL from In heart pipe, 600 μ LGUS Extraction buffers are added and take supernatant in 4 DEG C in 12,000rpm, 4 DEG C of centrifugation 10min after mixing well Refrigerator saves backup.

(4) measurement of sample protein content

Concrete operation step is referring to modified form Bradford method determination of protein concentration kit specification:

1. taking 10 μ L of each sample albumen supernatant in 1.5mL centrifuge tube respectively, mixed after adding water to 500 μ L.

2. take by table 3-3 0~30 μ g/mL prepared protein solution and 1. in sample diluting liquid each 150 μ L, in order It sequentially adds in ELISA Plate hole.

3. 150 μ L Bradford reagents are added into each hole again, oscillation is mixed immediately.

4. after mixing, in being stored at room temperature 10min, mixing 2 times during which need to be vibrated.

5. after 10min, the A595 value of each sample is measured in microplate reader.

2.~5. 2 time 6. repeating step, and the A595 average value of each sample is calculated.

7. corresponding protein concentration is horizontal seat using the A595 average value of the protein solution of 0~30 μ g/mL as ordinate Mark, utilizes Microsoft Excel Software on Drawing standard curve.

8. determining the protein compression of each sample dilution on standard curve according to sample diluting liquid A595 average value Degree.

9. according to formula: (the sample dilution times of sample protein matter concentration (μ g/mL)=sample diluting liquid protein concentration × 50 Number) calculate the protein concentration of each sample.

(5) measurement of GUS enzymatic activity

100 supernatants of the μ L containing GUS are taken, are added in MUG (2mmol/L) solution that 500 μ L are preheated at 37 DEG C, rapidly sufficiently 50 μ L mixed liquors are taken out after mixing immediately and are added to 950uL reaction terminating liquid (0.2mol/L Na₂CO₃) in, as enzymatic reaction 0 point.Hereafter 50 μ L reaction solutions are taken out respectively in 15min, 30min, 45min and 60min, are added to the terminate liquid of 950uL Middle termination reaction.With under excitation wavelength of the multi-function microplate reader at 365nm and the launch wavelength at 455nm, each sample is measured The fluorescent value of different time points.Using wildtype Arabidopsis thaliana as negative control, the transgenic arabidopsis of 1305 carriers of conversion is sun Property control, each sample is respectively provided with 3 repetitions, the 4-MU content of each sample found on 4-MU standard curve, final each sample Fluorescent value takes its average value.

(6) enzyme activity calculates

Find out the GUS enzymatic activity in the unit time according to the absorbance value of each sample and corresponding fluorescent value, GUS enzyme activity with Every milligram of prolease activity indicates (pmolmg per minute^-1·min^-1)。

Note: modified form Bradford method determination of protein concentration kit, X-Gluc (5-bromo-4- used in testing Chloro-3-indolyl- β-D-glucuronic acid) it is purchased from Shanghai bioengineering Co., Ltd；4-MU, 4-MUG come from Sigma Products；The Varioskan multi-functional readout instrument of Flash full wavelength scanner formula (multi-function microplate reader) comes from Thermo Scientific company.For tobacco (Nicotiana tabacum L) tissue-cultured seedling of transient expression conversion, intend south used in conversion The genotype of mustard is that Colombia is that (Columbia, Co1) is provided by landscape flower research institute, Southwest University.

Transient expression in tobacco leaf is the results show that turn CaMV35S promoter and conversion pcambia1305- CpSNAC1, pcambia1305-CpSNAC1-D1, pcambia1305-CpSNAC1-D2, pcambia1305-CpSNAC1-D3 Tobacco leaf GUS chemistry tissue staining after have blue spot presentation, and negative control does not have blue spot (Fig. 5), shows CpSNAC1 gene promoter and its deletion sequence CpSNAC1pro-D1, CpSNAC1pro-D2 and CpSNAC1pro-D3 can drive Dynamic Reporter gene GUS expression.

Period and mature plant each group are sprouted to CpSNAC1 gene promoter and its deletion sequence transgenic arabidopsis seed It knits and carries out the analysis of GUS chemical staining, as a result as schemed, seed sprouts period and respectively organizes catch color (Fig. 6), mature plant Root, stem, leaf and Hua Junneng catch color, and seed cannot catch color (Fig. 7).The result shows that CpSNAC1 promoter and its deletion sequence It all has driving arabidopsis and sprouts into the entire process of growth the ability that gus gene is expressed, inorganization specificity from seed.

Real-time fluorescence quantitative PCR detection sequence gus gene table is carried out to the seedling of CpSNAC1pro sequence respectively before and after the processing It reaches.Gus gene expression quantity raises after ABA, NaCl and PEG processing as the result is shown, GUS after 4 DEG C of low temperature and 42 DEG C of high-temperature process Gene expression amount reduces (Fig. 8).

According to the BSA protein standard liquid concentration gradient prepared in above-mentioned table 3, with modified form Bradford method protein compression Assay kit is spent, the absorbance value at 595nm is measured on multi-function microplate reader.With BSA protein standard liquid concentration for horizontal seat Mark is drawn protein concentration standard curve (Fig. 9) using A595 light absorption value as ordinate.The variance R of protein concentration standard curve² =0.9859, close to 1, illustrate that sample protein matter concentration has correlation with the absorbance value at 595nm, it can be according to the mark Formula on directrix curve calculates the protein concentration in the solution of certain absorbance value.

According to the fluorescence intensity under 4 slit 10nm of table.Using light absorption value as ordinate, 4-MU concentration (μM) is abscissa, is drawn Standard curve (Figure 10) processed.The R of fluorescence standard curve²=0.9924, close to 1, illustrating can be according to this standard curve Formula calculates the concentration of 4-MU corresponding to relative intensity of fluorescence.

After CpSNAC1 gene promoter and its each deletion sequence ABA, NaCl, PEG, 4 DEG C of low temperature and 42 DEG C of high-temperature process Seedling extract gus protein carry out Enzyme activity assay, CpSNAC1pro, CpSNAC1pro-D1 segment are in ABA, NaCl as the result is shown It is increased with GUS enzymatic activity after PEG processing, GUS enzymatic activity reduces after high temperature and low-temperature treatment；CpSNAC1pro-D2 segment is 5 GUS enzymatic activity increases after a Different stress processing；CpSNAC1pro-D3 segment GUS enzymatic activity after ABA processing increases, Enzyme activity does not almost change after NaCl processing, and enzymatic activity reduces (Figure 11) after PEG, high temperature and low-temperature treatment.

To CpSNAC1 gene promoter and its each deletion sequence adult plants, root, stem, leaf, flower, fruit progress GUS enzyme activity Property detection, the GUS enzymatic activity of each tissue of different fragments is different as the result is shown, but it is each tissue have GUS enzymatic activity, And the activity in root is highest.CpSNAC1pro-D2 segment GUS enzymatic activity in all segments is highest (Figure 12). CpSNAC1pro-D3 segment PEG stress under be suppressed probably with the segment in be free of and MYB arid binding site phase The cis-acting elements of pass is related, the less element relevant to stress of cis-acting elements in CpSNAC1pro-D3 segment Containing ABA response element without containing defence and response element TC-rich repeats, so the only GUS enzyme under ABA processing Activity increases and NaCl handles lower GUS enzymatic activity and do not change.There was only CpSNAC1pro-D2 segment GUS enzymatic activity under high/low temperature It is raised, and segment GUS dyed color is most deep, is the highest segment of all segment GUS enzymatic activitys, thus it is speculated that CpSNAC1pro-D2 segment has great influence to the activity of CpSNAC1 gene promoter.CpSNAC1 gene can be speculated as a result, Promoter can be influenced the expression of downstream gene by environment stress induction, and CpSNAC1pro-D2 segment is to CpSNAC1 gene The activity of promoter has great influence.

Sequence table

<110>Southwest University

<120>wax plum CpSNAC1 gene promoter and its application

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1007

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gcagtggcag actcacatag cagattatag aagaaagaag aagaagaaga agaagaagat 60

gagttgtaat ttgcagctgc ctcctggttt tagatttcac ccaacagatg aggaattggt 120

actgcactat ttatgcaaga aatgcgcctc acaaccgatt gctgttccta taattgcaga 180

gattgatctt tataaatatg atccttggca acttcctgga aaggctcttt atggagaaaa 240

ggaatggtac ttcttctctc cgagggaccg gaagtatccg aacgggtcaa ggcccaatcg 300

ggctgcagcg accggatatt ggaaggccac cggagccgat aagccaatta ggcccagtgg 360

aagtctaaag cctgttggaa tcaagaaggc cctggtcttt tatgctggaa aggccccaaa 420

gggtgaaaag tccaactgga tcatgcacga atacaggctt gcagatgttg atcgctctgc 480

taggaagaaa aatagtctaa ggctggacga ttgggtgttg tgtaggatct acaacaaaaa 540

atggggtttg gaaggaaagc aaccaaaatc cagcatcaaa tgcagggaga atgagatgga 600

ggaagagcat gtagagcaga agcctgaact tcttacaaat gcccatcaac ccatgactcc 660

cattctcaac gatttcacct acttcgactc ggccgattcc atacccaggc tacaactcac 720

cgattccagc tgctcggagc acgtggtttc ccccgagttc acctgcgaaa gggaggtcca 780

gagccagcca aagtggaaga gagactggaa caacaccctc cacatccctc ccattaacaa 840

catggatgcc accaatccct ttagtcagat ggacggtgtg gagctttctc cacttttccg 900

aattccgtca ttacaggaca tatccatgta cttgcagaag ccattctgat tgattctatg 960

ggccatccta tttctattct ttcatatgag ccaaccacac atatcac 1007

<210> 2

<211> 296

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 2

Met Ser Cys Asn Leu Gln Leu Pro Pro Gly Phe Arg Phe His Pro Thr

1 5 10 15

Asp Glu Glu Leu Val Leu His Tyr Leu Cys Lys Lys Cys Ala Ser Gln

20 25 30

Pro Ile Ala Val Pro Ile Ile Ala Glu Ile Asp Leu Tyr Lys Tyr Asp

35 40 45

Pro Trp Gln Leu Pro Gly Lys Ala Leu Tyr Gly Glu Lys Glu Trp Tyr

50 55 60

Phe Phe Ser Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ser Arg Pro Asn

65 70 75 80

Arg Ala Ala Ala Thr Gly Tyr Trp Lys Ala Thr Gly Ala Asp Lys Pro

85 90 95

Ile Arg Pro Ser Gly Ser Leu Lys Pro Val Gly Ile Lys Lys Ala Leu

100 105 110

Val Phe Tyr Ala Gly Lys Ala Pro Lys Gly Glu Lys Ser Asn Trp Ile

115 120 125

Met His Glu Tyr Arg Leu Ala Asp Val Asp Arg Ser Ala Arg Lys Lys

130 135 140

Asn Ser Leu Arg Leu Asp Asp Trp Val Leu Cys Arg Ile Tyr Asn Lys

145 150 155 160

Lys Trp Gly Leu Glu Gly Lys Gln Pro Lys Ser Ser Ile Lys Cys Arg

165 170 175

Glu Asn Glu Met Glu Glu Glu His Val Glu Gln Lys Pro Glu Leu Leu

180 185 190

Thr Asn Ala His Gln Pro Met Thr Pro Ile Leu Asn Asp Phe Thr Tyr

195 200 205

Phe Asp Ser Ala Asp Ser Ile Pro Arg Leu Gln Leu Thr Asp Ser Ser

210 215 220

Cys Ser Glu His Val Val Ser Pro Glu Phe Thr Cys Glu Arg Glu Val

225 230 235 240

Gln Ser Gln Pro Lys Trp Lys Arg Asp Trp Asn Asn Thr Leu His Ile

245 250 255

Pro Pro Ile Asn Asn Met Asp Ala Thr Asn Pro Phe Ser Gln Met Asp

260 265 270

Gly Val Glu Leu Ser Pro Leu Phe Arg Ile Pro Ser Leu Gln Asp Ile

275 280 285

Ser Met Tyr Leu Gln Lys Pro Phe

290 295

<210> 3

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gttgtgaggc gcatttcttg cgt 23

<210> 4

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gcttctgctc tacatgctct tcctc 25

<210> 5

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gctcttcctc catctcattc tccctgc 27

<210> 6

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

gaacagcaat cggttgtgag gcg 23

<210> 7

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

aactgcagca agtagggcta aataacccat ttacc 35

<210> 8

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

aactgcagat gttgttgcac gagcgatcaa t 31

<210> 9

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

aactgcaggt tttccaacac gagccctctc t 31

<210> 10

<211> 32

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

catgccatgg gaacagcaat cggttgtgag gc 32

<210> 11

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

catcctctgg gaaccactga ac 22

<210> 12

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

catcacattg ctcgcttcgt t 21

<210> 13

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

gttatggttg ggatgggaca gaaag 25

<210> 14

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

gggcttcagt aaggaaacag ga 22

<210> 15

<211> 1437

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

gagagttgga tgatgagaag aagatatttc atctattggg gtccacattg gccattgtta 60

tttgtcgggc gttaatgtaa tctatgtggg cccacgtatg atgtcgttga attgaaagat 120

ctaaattcat gcatttgaaa ggagaaaaaa accaatgttg gccaaaagga taccttttct 180

tcaaagagta aaagctcttt cttcttttct ttgacaagta gggctaaata acccatttac 240

ccaattaaat aataacattc aaatccaacg atcaaatcat cctccacgta ggacatggcc 300

attaataaat tataattacc aattgatacg acctcagccc caattcggtc tcatgacaat 360

catattttac actttgcatt tcgtgattaa ctctttttta tctatattat ggatctaaaa 420

aaatacaaaa tgtcaaataa aataaagatt ttatcattta attcttttaa ttatatttcc 480

aaatggaccc atagtctaaa aaatatagaa ttaaaatgag attaattttt attttaataa 540

aataaaaact gatgttcaaa tcaatttctc caaatactca tgataagtca aattgaatag 600

ttagatagat ggatgtatag aaataacact aatcttaata tatgaataat aattaattta 660

ttaaagaata aaatttaaaa gaaactatct actataaaga ttagtgtgaa tatcatgaaa 720

tggcaaatgt tgttgcacga gcgatcaatg attatctaga ttaattatat aaaataaaaa 780

atataattat taaaataaat caaagaaata aaagtggagc ccaccacaac gtacagacgt 840

ccagttggta tgcaaggggc ggttctgagg atcaagtcac cgtcgggcgt caacagacta 900

tcctgacaca tacgagccta cgtggaaatc taatccgacg cccgcaattt cctagaaaaa 960

acaccggtcc aacgttttcc aacacgagcc ctctcttttt ccgccacgtg cgcctccatc 1020

caaaacttgt gacctaagca gtgacgaaaa ctgcccagcc aagtggcgca gcatcgacac 1080

gtgtacgaat gcggtcaact tgtcttcatg gatccaaagc cgattgacgg tccccacgcg 1140

tgtatttcta gagaaacctc gagccgactt agacacgtgt cgcgaatcca ccttggctcc 1200

cctctataaa ggccgaggtt tctctcgatt tccgagtttc aactttcaac cgccgaattc 1260

agttctccag atccgttttg cagtggcaga ctcacatagc agattataga agaaagaaga 1320

agaagaagat gagttgtaat ttgcagctgc ctcctggttt tagatttcac ccaacagatg 1380

aggaattggt actgcactat ttatgcaaga aatgcgcctc acaaccgatt gctgttc 1437

Claims (7)

1. wax plum CpSNAC1 gene promoter, it is characterised in that: its nucleotide sequence such as SEQ ID No.15 the 974th~1437 Shown in position.

2. wax plum CpSNAC1 gene promoter, it is characterised in that: its nucleotide sequence such as SEQ ID No.15 the 727th~1437 Shown in position.

3. wax plum CpSNAC1 gene promoter, it is characterised in that: its nucleotide sequence such as SEQ ID No.15 the 215th~1437 Shown in position.

4. wax plum CpSNAC1 gene promoter, it is characterised in that: its nucleotide sequence such as SEQ ID No.15 the 1st~1437 It is shown.

5. use of the described in any item wax plum CpSNAC1 gene promoters of Claims 1 to 4 in regulation plant stress resistance On the way.

6. purposes of the wax plum CpSNAC1 gene promoter as claimed in claim 5 in regulation plant stress resistance, feature Be: the plant is arabidopsis or wax plum.

7. such as purposes of the wax plum CpSNAC1 gene promoter described in claim 5 or 6 in regulation plant stress resistance, Be characterized in that: the adverse circumstance is hormone, with high salt, arid, high temperature or low temperature.

Specifically, the HORMONE TREATMENT is 50 μM of L of concentration^-1Abscisic acid processing.

Specifically, described is with high salt for concentration 150mML^-1NaCl processing.

Specifically, the PEG that the arid is 10% mass fraction of concentration is handled.

Specifically, the high temperature is 42 DEG C.

Specifically, the low temperature is 4 DEG C.