CN110157713A - Drought-resistant maize related gene ZmDi19-7 and its application - Google Patents
Drought-resistant maize related gene ZmDi19-7 and its application Download PDFInfo
- Publication number
- CN110157713A CN110157713A CN201910274035.7A CN201910274035A CN110157713A CN 110157713 A CN110157713 A CN 110157713A CN 201910274035 A CN201910274035 A CN 201910274035A CN 110157713 A CN110157713 A CN 110157713A
- Authority
- CN
- China
- Prior art keywords
- zmdi19
- gene
- drought
- plant
- resistant maize
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The invention discloses a kind of drought-resistant maize related gene ZmDi19-7 and its application, the gene has the nucleotide sequence as shown in SEQ ID NO.1, and the coding albumen of the gene has the amino acid sequence as shown in SEQ ID NO.2.The gene is a kind of new gene studies on plant drought-resistance, can be improved plant drought performance, the discovery of the gene enriches the resource of gene related to drought tolerance, is conducive to further study crop drought resistance regulatory mechanism, be of great significance to the breeding of crop drought resistance new varieties.
Description
Technical field
The present invention relates to gene engineering technology field more particularly to a kind of drought-resistant maize related genes
ZmDi19-7 and its application.
Background technique
Currently, improving crop varieties performance with the maturation of transgenic technology using transgenic technology and having become reality.
Transgenic technology compares traditional breeding technology, and breeding cycle greatly shortens, and has apparent advantage in improvement,
And the key that transgenic technology is promoted is that the acquisition and building in functional gene library.
Currently, the exploitation development of corn functional gene is advanced by leaps and bounds, wherein is closed with the completion that Maize genome is sequenced
It is also constantly being broken through in the research and development work of the adversity genes such as corn salt resistance drought resisting.The anti-adversity of plant is that there are many classes
Type functional gene coordinate expression, it is coefficient as a result, its mechanism is complicated, wherein the regulation of transcription factor is in Genes For Plant Tolerance
Critical role is captured in inverse response matrix.Therefore, in corn adversity gene database, transcription factor is a large family.
Report display, the embodiment of the anti-adversity of plant is not that some transcription factor individually regulates and controls as a result, being by multiple transcriptions
Factor coordinate expression, the complex biological character that joint effect determines, it is therefore desirable to transcription factor as much as possible is constantly excavated,
Genetic resources abundant is provided for research plant stress-resistance response matrix, it is crop molecule breeding for stress tolerance, it is strong cultivates anti-adversity
Crop provides heredity and supports.
In transcription factor, C2H2 zinc finger protein family is disclosed that be primarily involved in regulating growth of plants related to resistance
Activity, Di19 albumen are not only a member of C2H2 zinc finger protein family, while being also the member of drought induced-protein.At present
Di19 gene is cloned in the plants such as arabidopsis, cotton, soybean, wheat, rice, Di19 gene in corn as transcription because
Son also has been reported that, such as ZmDi19-5 (publication number CN108410883A), with drought resisting salt resistance activity, but still has many Di19
Gene transcription factor has not been reported.Although being all transcription factor, different Di19 genes is in regulating growth of plants and degeneration-resistant
Respective role and effect are all played in sexuality, continually develop new transcription factor, it is living to plant stress-resistance is further appreciated that
Mechanism has far reaching significance, and also can improve crop anti-adversity for molecular level can provide more genetic resources information.
Summary of the invention
It is an object of the invention to overcome the shortage of prior art, provide a kind of drought-resistant maize related gene ZmDi19-7 and
It is applied, to provide a kind of new gene that can be used for drought-resistant maize genetic improvement.
The present invention is achieved by the following technical solutions:
The present invention provides a kind of drought-resistant maize related gene ZmDi19-7, the gene has such as SEQ ID NO.1 institute
The nucleotide sequence shown, overall length 690dp.
The present invention also provides above-mentioned drought-resistant maize related gene ZmDi19-7 in increasing or decreasing drought-resistant maize performance
Application.
The present invention also provides the coding albumen of above-mentioned drought-resistant maize related gene ZmDi19-7, the albumen has such as
Amino acid sequence shown in SEQ ID NO.1, overall length 229aa.
The present invention also provides a kind of plant Overexpression vector, the plant Overexpression vector is pCAMBIA1301
Carrier, and the multiple cloning sites region of the pCAMBIA1301 carrier be connected in turn 35S promoter, as described in claim 1
ZmDi19-7 gene and terminator.
The present invention also provides a kind of genetically engineered host cell, the host cell contains such as claim 4 institute
The ZmDi19-7 gene as described in claim 1 of external source is integrated in the plant Overexpression vector or its genome stated
Sequence forward or backwards.
The present invention also provides a kind of methods for improving plant drought performance, by drought-resistant maize as described in claim 1
Related gene ZmDi19-7 is integrated into the cell, tissue and organ of plant, and makes its overexpression.
It is further preferred that the plant includes corn, rice, wheat, arabidopsis.
The present invention has the advantage that the present invention provides a kind of drought-resistant maize related genes compared with prior art
ZmDi19-7 and its application, the gene are a kind of new gene studies on plant drought-resistance, and the discovery of the gene enriches current corn
Genetic resource of the Di19 gene as transcription factor, to further appreciate that plant stress-resistance active mechanism have far reaching significance,
Crop anti-adversity can be improved for molecular level can provide more genetic resources information.
Detailed description of the invention
Fig. 1 is ZmDi19-7 gene gel electrophoresis test result chart；
Fig. 2 is ZmDi19-7 gene digestion proof diagram；
Fig. 3 is the Phylogenetic analysis result figure of ZmDi19-7 and other Di19 protein family members；
Fig. 4 is ZmDi19-7 subcellular localization result figure；
Fig. 5 is ZmDi19-7 yeast transcriptional activity analysis result figure；
Fig. 6 is ZmDi19-7 expression pattern analysis result figure；Wherein, A is ZmDi19-7 expression pattern in different tissues
As a result histogram (R: root, S: stem, L: leaf, T: male inflorescence, SK: filigree)；B is ZmDi19-7 under 20%PEG6000 processing
Inducing expression model results histogram；
Fig. 7 is that the drought resisting of ZmDi19-7 transgenic arabidopsis handles comparison diagram；
Fig. 8 is ZmDi19-7 transgenic arabidopsis drought resisting Determination of Physiological And Biochemical Indices result figure before and after the processing；Wherein, A is
Malonaldehyde (MDA) assay result figure；B is relative water content (RWC) measurement result figure；C is peroxidase (POD) activity
Measurement result figure.
Specific embodiment
Embodiment 1
1, material
The present embodiment method therefor is known to those skilled in the art the conventional method of dawn unless otherwise instructed, used
The materials such as reagent be commercially available products unless otherwise instructed.
2, method
The clone of 2.1 ZmDi19-7 genes
Select corn B73 self-mating system as experimental material, by extracting maize leaf tissue RNA, and reverse transcription is at cDNA,
Using cDNA as the template of subsequent ZmDi19-7 gene cloning.
ZmDi19-7 gene and its upstream and downstream sequence of the gene are obtained from maize database retrieval, with the gene
Upstream and downstream sequence be stencil design specificity amplification primer, introduce Kpn I and XbaI enzyme cutting site in primer, then with
Above-mentioned cDNA is that template carries out PCR clone, obtains the ZmDi19-7 full length gene sequence that KpnI and Xba I restriction enzyme site is contained at both ends
Column.
Specificity amplification primer sequence containing restriction enzyme site is as follows:
ZmDi19-7-F:GGGGTACC ATGGACTCCGAGCACTGGAT
ZmDi19-7-R:GCTCTAGA TCAGTCGCCGAATAGAGTAG
Pcr amplification reaction system is as follows
PrimerSTAR Max Premix(2×)12.5μL
ZmDi19-7-F 1μL
ZmDi19-7-R 1μL
1 μ L of template cDNA
ddH2O Up to 25μL
Pcr amplification reaction program is as follows:
The PCR product agarose gel electrophoresis testing result of acquisition is as shown in Fig. 1, and in figure, target gene band is clear,
Size is consistent with prediction result.
Target gene is recycled, is ligated and transformed into Escherichia coli Trans5 α competent cell, double enzymes with T1Simple carrier
Screening positive clone is cut, as a result as shown in Fig. 2, obtaining T1-ZmDi19-7 recombinant plasmid, is sequenced, sequencing result and SEQ ID
NO.1 sequence table compares, and as a result unanimously, successfully obtains ZmDi19-7 gene.
The bioinformatic analysis of 2.2 ZmDi19-7 genes
2.2.1 ZmDi19-7 protein structural analysis
Domains characteristic analysis is carried out using in coding albumen of the sequence of threads PFAM to ZmDi19-7 gene, the results showed that its
Contain two structural domains of zf-Di19 and Di19-C in protein structure domain, wherein zf-Di19 structural domain is located at the amino of protein
End since 40, is terminated by 54 Amino acid profiles to 93；And Di19-C structural domain is then located at the c-terminus of protein, by
114 Amino acid profiles terminate since 113 to 226.The two structural domains have absolutely proved that ZmDi19-7 gene belongs to really
In drought induced-protein family, and there is complete, conservative structural domain.
Using 7.0 software of MEGA, ZmDi19-7 and published other plant Di19 family members are subjected to phyletic evolution
Tree analysis, as a result as shown in figure 3, result is it can be seen that the gene of Di19 family can gather for 3 classes, wherein ZmDi19-1,
ZmDi19-2, ZmDi19-5, ZmDi19-7 and OsDi19-1, the genes such as OsDi19-3, OsDi19-4 flock together, in the branch
There is no the homologous gene of arabidopsis, illustrates that these genes may be distinctive in gramineae plant.Wherein OsDi19-4 gene exists
It has been demonstrated to be expressed by drought stress rapid induction height in rice, which imply that ZmDi19-7 gene is as OsDi19-4's
Homologous gene may also have the function of similar.
2.4 ZmDi19-7 subcellular localizations
2.4.1 protein transmembrane area is predicted by HMMTOP program
(http://www.enzim.hu/hmmtop)。
2.4.2 ZmDi19-7 subcellular localization carrier is constructed
In order to understand the localization and expression situation of ZmDi19-7 gene, subcellular localization fusion expression vector is constructed.It utilizes
PCAMBIA1305 (p1305) is used as skeleton, and GFP green fluorescent protein constructs p1305-35S- as reporter gene
ZmDi19-7-GFP fusion expression vector.Restriction enzyme site of Spe I and the Xba I as upstream and downstream primer.Primer sequence is as follows:
ZmDi19-7-F:GACTAGTATGGACTCCGAGCACTGGAT
ZmDi19-7-R:GCTCTAGAGTCGCCGAATAGAGTAGAGA
2.4.3 Agrobacterium conversion tobacco
After ZmDi19-7 gene completes the connection with pCAMBIA1305 (p1305) carrier, plasmid is transformed into Agrobacterium,
With the Agrobacterium conversion tobacco of the fusion expression vector containing p1305-35S-ZmDi19-7-GFP, infecting should be smaller in tobacco
When, excessively old tobacco cell is thicker, it is difficult to infect and influence observation.
The formula for infecting required treatment fluid is as follows:
The MES 200ul of 0.5M
The MgCl2 100ul of 1M
Acetosyringone (AS) 10ul of 100mM
dd H2O up to 10ml
(note: being protected from light, can not place for a long time)
Specific step is as follows for transformation of tobacco:
(1) expand numerous p1305-35S-ZmDi19-7- using LB liquid medium containing kanamycin and rifampin mycin
GFP Agrobacterium and p19 bacterial strain, are incubated overnight, and survey the light absorption value of OD600；
(2) according to the quantity of tobacco leaf, the volume of Agrobacterium bacterium solution is determined；
(3) the Agrobacterium bacterium solution containing target fragment and p19 bacterium solution are uniformly mixed, 4 DEG C, 5000rpm is centrifuged 5min；
(4) supernatant is removed, thallus (sediment fraction) is resuspended with Vfinal treatment fluid is prepared, is put into ice chest and is protected from light standing 2-
3h；
(5) the above-mentioned bacterium solution prepared is drawn with 2ml syringe, after pulling out syringe needle, avoids the master pulse injection Tobacco Leaf of leaf
The piece back side；
(6) tobacco is then protected from light 36-48h, then uses confocal laser scanning microscope assignment of genes gene mapping feelings
Condition.
2.5 ZmDi19-7 yeast transcriptional activity analysis
For the yeast self-activation situation for understanding ZmDi19-7 gene, the yeast crossbreeding pGBKT7 carrier of ZmDi19-7 is constructed,
Restriction enzyme site of Nde I and the EcoR I as upstream and downstream primer.Primer sequence is as follows:
ZmDi19-7-F:GGAATTCCATATGATGGACTCCCAGCACTGG
ZmDi19-7-R:CGGAATTCTCAGTCGCCGAATAGAGTAGA
After ZmDi19-7 gene completes the connection with pGBKT7 carrier, by the correct plasmid pGBKT7-ZmDi19-5 of sequence
It is transformed into yeast cells.
As a result as shown in figure 5, as can be seen that the gene is activity without transcription self-excitation in yeast in Fig. 5.
The expression pattern analysis of 2.6 ZmDi19-7
2.6.1 sample of tissue
In order to study expression of the ZmDi19-7 gene in corn Different Organs, in corn inbred line B73 tri-leaf period
When choose root in plant, stem, leaf and seedling stage tassel and filigree, sampling is put in liquid nitrogen rapidly, then -80 DEG C of ice of placement
Case saves.
For expression of the research ZmDi19-7 gene under stress, test corn tri-leaf period with 20% PEG600 into
Row processing is sampled in 0h, 3h, 6h, 12h respectively, in liquid nitrogen flash freezer and places -80 DEG C of refrigerators preservations.
2.6.2 Total RNAs extraction
Sample total serum IgE is extracted using the Trizol method of improvement, steps are as follows:
(1) in masking foil, 180 DEG C of high-temperature sterilization box sterilization 8h or so take out packet after mortar cleans up, and room temperature is cooling,
First by mortar and mortar stick Liquid nitrogen precooler, extracted corn sample is placed in mortar, appropriate liquid nitrogen is added and grinds rapidly
Thoroughly, appropriate powder is then taken to move on in precooled 1.5ml RNase-free centrifuge tube；
(2) 1ml Trizol reagent is added in above-mentioned centrifuge tube, then turns upside down uniformly mixed, and in room temperature (25
DEG C or less) place 10min；
(3) centrifuge tube is put into centrifuge, 12,000rpm, 4 DEG C, 20min；
(4) supernatant in appropriate above-mentioned steps is added in new RNase-free centrifuge tube, it is heavy to pay attention to be drawn onto
It forms sediment, then 250 μ l of 5M NaCl solution, 250 μ l of chloroformic solution is added in ventilating kitchen；
(5) 10,000rpm, 4 DEG C are placed in a centrifuge, 20min；
(6) supernatant in appropriate above-mentioned steps is added in new RNase-free centrifuge tube, it is heavy to pay attention to be drawn onto
It forms sediment, 200 μ l of aqueous isopropanol, (25 DEG C or less) standing 10min of room temperature is added；
(7) 12,000rpm, 4 DEG C are placed in a centrifuge, 15min；
(8) supernatant in above-mentioned centrifuge tube is outwelled, 75% ethanol solution, 500 μ l is added；
(9) it is placed in a centrifuge 8000rpm, 4 DEG C, 5min discards liquid；
(10) it is primary to repeat above-mentioned centrifugation step, test tube is upside down on filter paper and is dried；
(11) appropriate DEPC water is added in above-mentioned test tube, piping and druming mixes, and is put into -80 DEG C of refrigerators and saves for use.
2.6.3 the quality and concentration of RNA are measured
(1) integrality of RNA electrophoresis detection RNA: 2 μ l bromophenol blues of the above-mentioned RNA sample addition of 3 μ l are drawn and are uniformly mixed, so
Loading runs electrophoresis afterwards, if electrophoresis has two clearly bands, wherein the width of a band is about 2 times of another band, respectively
It is 28S rRNA and 18S rRNA, it is higher illustrates that RNA extracts quality；Illustrate RNA if band is fuzzy or band is unintelligible
It extracts unqualified, needs to re-start the extraction of RNA.
(2) RNA purity and concentration are detected: drawing 1 μ l RNA sample, point is added on the probe of micro ultraviolet specrophotometer
(need to first use DEPC water school zero).If display peak figure is single and the value of A260/A280 is between 1.8-2.0, illustrate that RNA is extracted
Purity it is higher；If the value of A260/A280 is greater than 2, illustrate that ethyl alcohol is non-volatile clean in RNA；If the value of A260/A280
Less than 1.8, then illustrate that, containing protein or phenols in sample RNA, sample RNA is contaminated.
2.6.4 the reverse transcription of sample RNA
Use reverse transcription reagent boxRT reagent Kit with gDNA Eraser, according to using
Specification carries out the reverse transcription of RNA sample, and steps are as follows:
(1) genomic DNA contained in sample RNA is removed
Total RNA 1μg
gDNA Eraser 1.0μl
5×gDNA Eraser Buffer 2.0μl
RNase Free H2O up to 10μl
According to the sample RNA concentration that above-mentioned steps are surveyed, the amount that 1 μ g total serum IgE of final concentration needs is calculated, according to above-mentioned experiment body
It ties up in micro RNase-free centrifuge tube and is loaded；
By above-mentioned sample with point shake machine concussion mix, 42 DEG C water-bath 2 minutes, place on ice 3-5 minutes it is spare.
(2) sample RNA reverse transcription
In the above system, following reagent is added:
Remove the 10.0 μ l of RNA solution of genome
Buffer 2 4.0μl
RT Enzyme MixⅠ1.0μl
RT Primer Mix 1.0μl
RNase Free H2O up to 20μl
After the concussion of above-mentioned sample is mixed, it is placed in PCR instrument, program is set:
37℃ 15min
85℃ 5s
4℃ 30min
After reaction, room temperature high speed centrifugation 5 seconds after taking 1 μ l sample detection cDNA concentration, are placed in -20 DEG C of refrigerators and save
It is spare.
2.6.5 quantitative fluorescent PCR
It is true further according to the website NCBI using the primer of Primer Express 3.0 (ABI) software design quantitative fluorescent PCR
Determine primer specificity, send and synthesized in biotech firm.
The primer nucleotide sequences of target gene ZmDi19-7 and reference gene ZmActin are as follows:
ZmDi19-7-F:5 '-CTGCTACGAGGACCACGACGTC-3 '
ZmDi19-7-R:5 '-GGTTAACCATATCCTTCGTAAC-3 '
ZmActin-F:5 '-GGGATTGCCGATCGTATGAG-3 '
ZmActin-R:5 '-GAGCCACCGATCCAGACACT-3 '
20 μ l systems of fluorescence quantitative PCR reaction solution:
SYBR Green Mix 10μl
2 μ l of template cDNA
1 μ l of upstream primer F
1 μ l of downstream primer R
RNase Free H2O up to 20μl
Sample is added according to above-mentioned system, program is set in fluorescence quantitative PCR instrument are as follows: 95 DEG C of 10min；95 DEG C of 15s, 60 DEG C
1min, totally 40 recycle.Then the processing of data is carried out by Ct method.4 secondary pollutants are done to repeat to repeat with 3 experiments.
As a result as shown in fig. 6, being the expression pattern and inducing expression mode point in different tissues of ZmDi19-7 gene
It analyses, as can be seen that the gene has expression in nutrition organs in Fig. 6, wherein it is higher in the aerial parts expression quantity such as stem and leaf,
And in reproductive organs, in male inflorescence, expression quantity is minimum, and can normal expression in filigree.Meanwhile in the PEG6000 of high concentration
When simulating drought, expression quantity can be significantly improved.These results illustrate that the gene is the pass that can respond drought stress
Key transcription factor.
The building of 2.7 ZmDi19-7 transgenic arabidopsis and Drought Resistance Analysis
2.7.1 the building of ZmDi19-7 gene overexpression carrier
Using pCAMBIA1301 as initial carrier, one is connected between the KpnI and XbaI enzyme cutting site of its multiple cloning sites
A 35S promoter, and add the preceding paragraph terminator between SphI and HindIII restriction enzyme site, obtain the carrier of transformation
pCAMBIA1301a。
It will with Kpn I, Xba I double digestion T1-ZmDi19-7 recombinant plasmid and pCAMBIA1301a, T4 ligase
ZmDi19-7 connects the multiple cloning sites into pCAMBIA1301a, obtains over-express vector p1301a-ZmDi19-7.
2.7.2 the processing of arabidopsis seed:
Colombia's wildtype Arabidopsis thaliana seed is taken, the liquor natrii hypochloritis's cleaning and sterilization standby for being 12% with mass concentration
With.
2.7.3 the culture of arabidopsis
Seed after cleaning is taken out, is uniformly spread on the rectangular culture dish for being dispersed in MS solid medium by liquid-transfering gun, south is intended
The culture of mustard culturing room；The seedling for growing 10d or so on culture medium is moved into mixed Nutrition Soil and is grown, nutrition black earth and leech
Stone volume ratio is 1:3, continues hot-house culture；It should be noted that the seedling just transplanted need to keep moisture, using light-passing plastic
Film cladding process is opened after 2-3d.
2.7.3 agrobacterium mediation converted arabidopsis
The over-express vector p1301a-ZmDi19-7 of building is imported in Agrobacterium EHA105 competent cell, is invaded
Microbiological contamination.When arabidopsis wait transplant largely prepares to bloom for the first time, as arabidopsis infects best period.Method for transformation is such as
Under: bacterium will be infected and expanded culture to OD600Value is 0.8.Conversion Buffer solution (treatment fluid) is configured simultaneously: 1L's
Buffer solution needs the MS of 2.3g, 50g sucrose, and the MES of 0.5g adjusts pH value to 5.8 with NaOH.Treatment fluid is also needed using preceding
Surfactant is added.The fungus block that is centrifuged of mixing Buffer solution suspension after taking stirring is to get to infecting solution.
Dip dyeing arabidopsis floral: when about 10 centimetres of arabidopsis bolting high, soaking arabidopsis floral with During Agrobacterium liquid, weight
It is 2-3 times multiple, above-ground plant parts is wrapped with preservative film, is cultivated 2-3 days under dark.After one week, repeat to disseminate again.
About two months, the seed (T0 generation) of mature arabidopsis is harvested, dry be placed at 4 DEG C saves.
2.7.4 the screening of transgenic arabidopsis
The arabidopsis seed (T0 generation) of above-mentioned harvest is sterilized, after 4 DEG C of vernalization treatments, uniformly it is sprinkled upon the MS containing hygromycin
On culture medium flat plate, while using wildtype Arabidopsis thaliana seed as control.If wildtype Arabidopsis thaliana seed is not resistant
On MS plate can normal germination and growth, on resistant plate cannot normal germination and growth, and in transgenic arabidopsis
But there is seed being capable of normal germination and growth on resistant plate, then it is assumed that it is effective for screening positive Arabidopsis plant.
Using ZmDi19-7 gene as purpose gene, PCR Molecular Detection is carried out to the positive plant of screening, Preliminary Identification turns base
Because whether arabidopsis converts success.
2.7.5 the acquisition of transgenic arabidopsis offspring
According to the method for step 2.7.4, the seed (T1 generation) of transgenic Arabidopsis plants will be initially identified as with containing damp mould
The MS culture medium flat plate of element is screened, and obtains T1 for plant, when T1 is for plant fruit pod maturation, harvest transgenosis T2 generation is planted
Son, and so on, it is finally obtained the transgenic arabidopsis seed (at least T3 generation) for stablizing heredity, takes three groups to stablize turning for heredity
Gene arabidopsis T3 carries out Drought Stress Tolerance Analysis of A for strain, respectively L5, L16 and L31.
2.7.6 transgenic arabidopsis Drought Stress Tolerance Analysis of A
After stablizing hereditary transgenic arabidopsis T3 for seed disinfection for three groups of step 2.7.5, uniformly it is layered on mould containing tide
On the MS solid medium of element, wild type seeds are layered on MS solid medium, are placed in vernalization 2 days in 4 DEG C of refrigerators and (are convenient for same
Step germination).It is 22 DEG C that seed after vernalization, which is placed in condition, and the arabidopsis of 16/8h light dark culture is trained in dedicated culture greenhouse
It supports.It sprouts 10 days or so, chooses transgenic line and wild type seedlings immigration Nutrition Soil of the same size and vermiculite volume ratio is
It is grown in the Nutrition Soil of 1:3 mixing.When seedling is vibrant, use mass ratio young for 20% PEG-6000 simulating drought processing
Seedling 15 days or so, paired observation was taken pictures, and measured its physiological and biochemical index.
It waters again after 15 days, according to daily management schema management, observes the drought-enduring implementations of seedling.
2.7.6.1 the observation of plant phenotype before and after the processing
As a result as shown in fig. 7, as can be seen that WT lines blade and rotaring gene plant blade have after processing in Fig. 7
The withered jaundice of large area is blue, leaf rolling, but the blue jaundice area of WT lines blade and rotaring gene plant blade
Greatly, curling is serious.Again after watering, wild type table shape is not improved, and transgenic plant has certain improvement.
2.7.6.2 the measurement of mda content
(1) it weighs the tissue of experimental group and control group equivalent weight, sodium phosphate buffer is added and by means of quartz sand, grind
Wear into tissue homogenate；
(2) it takes homogenate in centrifuge tube, is centrifuged 15min, whether observation homogenate is layered；
(3) take the homogenate supernatant of layering in new test tube, 0.5% thiobarbituricacidα- that 3ml is first added mixes, then
5% solution of trichloroacetic acid is added, rocks mixing, water-bath (100 DEG C) 10min, and rinse test tube with fast cooling, so with clear water
After be centrifuged, with deionized water be control, measurement centrifugation supernatant light absorption value A under 532nm, 600nm wavelength532、A600。
(4) processing of data is according to following operational formula:
In formula, A is absorbance, V1For reaction solution total amount, V is extracting solution total amount, V2For the extraction liquid measure in reaction solution, W is
The weight of plant sample, 1.55 × 10-1For micromole's absorptivity of malonaldehyde.
2.7.6.3 the measurement of relative water content
(1) transgenic plant and adjoining tree same area blade for taking Osmotic treatment forward and backward respectively.
(2) ddH is used2O is rinsed twice, is removed the soil and impurity on blade face, then exhaust surface moisture with filter paper, is claimed fresh weight
W0；
(3) weighing rear blade is taken to impregnate 5-6h in deionized water, until claiming fresh weight W1 when water suction saturated weight is constant；
(4) blade weighed in (3) is wrapped with masking foil, is put into 180 DEG C of baking oven, dry moisture, claim dry weight W2；
(5) calculation formula of relative water content:
2.7.6.4 the measurement of peroxidase activity
(1) preparation of plant tissue homogenate: accurately weighing 0.1g Arabidopsis leaf tissue, and the physiological saline of 900 μ l is added,
10% tissue homogenate is prepared under the conditions of ice-water bath, 3500rpm/min is centrifuged 10min, takes supernatant to be measured.
(2) it takes centrifuge tube with holes on lid to be numbered, is loaded by operations described below table:
(3) 3500rpm/min is centrifuged 10min after mixing, and 420nm wavelength measures each pipe absorbance.
(4) calculation formula:
As a result as shown in figure 8, passing through the measurement to plant physiological and biochemical index before and after Osmotic treatment, it is found that dry
Under drought processing, being overexpressed mda content in the transgenic arabidopsis strain of ZmDi19-7 gene is significantly reduced, and relative hydration
Amount is all remarkably higher than wild type with peroxidase content.These results, which all demonstrate ZmDi19-7 gene, has the response arid side of body
Urgent biological function.
Result above can be seen that drought-resistant maize related gene ZmDi19-7 of the invention, on nucleus and cell membrane
There is expression, is a kind of transcription factor, it is activity without transcription self-excitation in yeast.The ZmDi19-7 gene takes part in the anti-of plant
Arid activity adjustment mechanism, the biological function with certain drought stress can improve the anti-of crop when its overexpression
Non-irrigated performance.It can be promoted on the crops such as corn, rice, wheat, to cultivate the new work with stronger drought resistance
Article kind.
The above are a kind of detailed embodiment and specific operating process of the present invention, are before being with technical solution of the present invention
It puts and is implemented, but protection scope of the present invention is not limited to the above embodiments.
Sequence table
<110>Agricultural University Of Anhui
<120>a kind of drought-resistant maize related gene ZmDi19-7 and its application
<141> 2019-04-04
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 690
<212> DNA
<213>corn (Zea mays)
<400> 1
atggactccg agcactggat ctcgcgcctg gccgccgcga agcgcttcta cgcggcgcag 60
ctcggccaca gcgatcgggc cgggatggat gagctggaga tggacgagga ggtcaggccc 120
gagttcccct gcccctactg ctacgaggac cacgacgtcg gatccctctg cgcgcacctg 180
gaggaggagc acccgttcga accccaagcc gcggcctgcc ctgtctgctc agagatggtt 240
acgaaggata tggttaacca tattactacg caacatggat atttattcaa gaatcgccgc 300
cggctgcgca gattcatcat tccaggcagc caggccctct ctttgctgag ccgagatcta 360
cgggaagccc acttgcaggt gctcctcgga ggaggcggac agagatccag cgacaacagc 420
agcagcagca gcgccacgaa catttcggct gatcctcttc tgtcgtcgtt cggccttggc 480
ttccctacct cagacgcgga gcaagcatcc aagtcgactg tttccattcc tgatgatgca 540
acgacggtga aagaagcgcc cgctcaggca cggaagctaa gtatcgattc gtcgctcaca 600
agtgaagaaa gggagctgaa gcggaagcaa gcccgcgtca gagccacgtt cgtgcaggac 660
ctgctgctct ctactctatt cggcgactga 690
<210> 2
<211> 229
<212> PRT
<213>corn (Zea mays)
<400> 2
Met Asp Ser Glu His Trp Ile Ser Arg Leu Ala Ala Ala Lys Arg Phe
1 5 10 15
Tyr Ala Ala Gln Leu Gly His Ser Asp Arg Ala Gly Met Asp Glu Leu
20 25 30
Glu Met Asp Glu Glu Val Arg Pro Glu Phe Pro Cys Pro Tyr Cys Tyr
35 40 45
Glu Asp His Asp Val Gly Ser Leu Cys Ala His Leu Glu Glu Glu His
50 55 60
Pro Phe Glu Pro Gln Ala Ala Ala Cys Pro Val Cys Ser Glu Met Val
65 70 75 80
Thr Lys Asp Met Val Asn His Ile Thr Thr Gln His Gly Tyr Leu Phe
85 90 95
Lys Asn Arg Arg Arg Leu Arg Arg Phe Ile Ile Pro Gly Ser Gln Ala
100 105 110
Leu Ser Leu Leu Ser Arg Asp Leu Arg Glu Ala His Leu Gln Val Leu
115 120 125
Leu Gly Gly Gly Gly Gln Arg Ser Ser Asp Asn Ser Ser Ser Ser Ser
130 135 140
Ala Thr Asn Ile Ser Ala Asp Pro Leu Leu Ser Ser Phe Gly Leu Gly
145 150 155 160
Phe Pro Thr Ser Asp Ala Glu Gln Ala Ser Lys Ser Thr Val Ser Ile
165 170 175
Pro Asp Asp Ala Thr Thr Val Lys Glu Ala Pro Ala Gln Ala Arg Lys
180 185 190
Leu Ser Ile Asp Ser Ser Leu Thr Ser Glu Glu Arg Glu Leu Lys Arg
195 200 205
Lys Gln Ala Arg Val Arg Ala Thr Phe Val Gln Asp Leu Leu Leu Ser
210 215 220
Thr Leu Phe Gly Asp
225
Claims (7)
1. a kind of drought-resistant maize related gene ZmDi19-7, which is characterized in that the gene has as shown in SEQ ID NO.1
Nucleotide sequence.
2. a kind of drought-resistant maize related gene ZmDi19-7 as described in claim 1 is in increasing or decreasing plant drought performance
Application.
3. a kind of coding albumen of drought-resistant maize related gene ZmDi19-7 as described in claim 1, which is characterized in that described
Albumen has the amino acid sequence as shown in SEQ ID NO.1.
4. a kind of plant Overexpression vector, which is characterized in that the plant Overexpression vector is pCAMBIA1301 carrier,
The multiple cloning sites region of the pCAMBIA1301 carrier is connected with 35S promoter, as described in claim 1 in turn
ZmDi19-7 gene and terminator.
5. a kind of genetically engineered host cell, which is characterized in that the host cell contains plant as claimed in claim 4
Be integrated in object Overexpression vector or its genome the ZmDi19-7 gene as described in claim 1 of external source forward direction or
Reverse sequence.
6. a kind of method for improving plant drought performance, which is characterized in that by drought-resistant maize dependency basis as described in claim 1
Because ZmDi19-7 is integrated into the cell, tissue and organ of plant, and make its overexpression.
7. a kind of method for improving plant drought performance according to claim 6, which is characterized in that the plant includes jade
Rice, rice, wheat, arabidopsis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910274035.7A CN110157713A (en) | 2019-04-08 | 2019-04-08 | Drought-resistant maize related gene ZmDi19-7 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910274035.7A CN110157713A (en) | 2019-04-08 | 2019-04-08 | Drought-resistant maize related gene ZmDi19-7 and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110157713A true CN110157713A (en) | 2019-08-23 |
Family
ID=67639128
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910274035.7A Pending CN110157713A (en) | 2019-04-08 | 2019-04-08 | Drought-resistant maize related gene ZmDi19-7 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110157713A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114262369A (en) * | 2021-12-15 | 2022-04-01 | 中国农业大学 | ZmDi19 gene and application of ZmDi 10 target gene in cultivation of gray leaf spot resistant plants |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101442902A (en) * | 2004-12-21 | 2009-05-27 | 孟山都技术有限公司 | Transgenic plants with enhanced agronomic traits |
| CN103748089B (en) * | 2011-06-24 | 2016-08-17 | 陶氏益农公司 | Pesticidal combination and correlation technique thereof |
| CN106906224A (en) * | 2017-05-04 | 2017-06-30 | 安徽农业大学 | A kind of corn anti contravariance related gene ZmDi19 5 and its application |
| CN106978424A (en) * | 2017-05-04 | 2017-07-25 | 安徽农业大学 | A kind of drought-resistant maize related gene Zmhdz12 and its application |
| CN108410883A (en) * | 2018-04-19 | 2018-08-17 | 安徽农业大学 | Corn anti contravariance related gene ZmDi19-9 and its application |
| CN108840915A (en) * | 2018-06-27 | 2018-11-20 | 安徽农业大学 | Moso bamboo PeDi19-4 albumen and its encoding gene and application |
-
2019
- 2019-04-08 CN CN201910274035.7A patent/CN110157713A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101442902A (en) * | 2004-12-21 | 2009-05-27 | 孟山都技术有限公司 | Transgenic plants with enhanced agronomic traits |
| CN103748089B (en) * | 2011-06-24 | 2016-08-17 | 陶氏益农公司 | Pesticidal combination and correlation technique thereof |
| CN106906224A (en) * | 2017-05-04 | 2017-06-30 | 安徽农业大学 | A kind of corn anti contravariance related gene ZmDi19 5 and its application |
| CN106978424A (en) * | 2017-05-04 | 2017-07-25 | 安徽农业大学 | A kind of drought-resistant maize related gene Zmhdz12 and its application |
| CN108410883A (en) * | 2018-04-19 | 2018-08-17 | 安徽农业大学 | Corn anti contravariance related gene ZmDi19-9 and its application |
| CN108840915A (en) * | 2018-06-27 | 2018-11-20 | 安徽农业大学 | Moso bamboo PeDi19-4 albumen and its encoding gene and application |
Non-Patent Citations (6)
| Title |
|---|
| SHELBY ELLISON等: "Fine Mapping, Transcriptome Analysis, and Marker Development for Y2, the Gene That Conditions β-Carotene Accumulation in Carrot (Daucus carota L.)", 《GENES GENOMES GENETICS》 * |
| WANG LILI等: "OsDi19-4 acts downstream of OsCDPK14 to positively regulate ABA response in rice", 《PLANT,CELL AND ENVIRONMENT》 * |
| WARE,D.: "drought-induced 19 [Zea mays]", 《GENBANK DATABASE》 * |
| 张敏: "玉米抗逆基因ZmDi19-5的功能研究", 《中国优秀硕士学位论文全文数据库》 * |
| 蔡慧林: "玉米抗逆相关基因ZmDi19-9的鉴定及其功能研究", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
| 赵娟莹等: "大豆锌指转录因子GmDi19-5对高温的响应及互作蛋白的筛选", 《中国农业科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114262369A (en) * | 2021-12-15 | 2022-04-01 | 中国农业大学 | ZmDi19 gene and application of ZmDi 10 target gene in cultivation of gray leaf spot resistant plants |
| CN114262369B (en) * | 2021-12-15 | 2023-05-16 | 中国农业大学 | Application of ZmDi19 gene and target gene ZmPR10 thereof in cultivation of anti-gray-spot plant |
| WO2023109729A1 (en) * | 2021-12-15 | 2023-06-22 | 中国农业大学 | Use of zmdi19 gene and target gene zmpr10 thereof in cultivating gray leaf spot-resistant plant |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110105438B (en) | Alfalfa drought-resistant gene MsTHI1, protein coded by same and application thereof | |
| CN113604490B (en) | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof | |
| CN114480431B (en) | Application of corn ZmBES1/BZR1-10 gene in improving drought tolerance and yield of plants | |
| CN104450740B (en) | A kind of alfalfa MsWRKY33 transcription factor and encoding proteins, preparation method and application | |
| CN106978424A (en) | A kind of drought-resistant maize related gene Zmhdz12 and its application | |
| CN107383179A (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN102675441B (en) | Application of OsMADS57 protein or coding gene thereof to inhibiting tillering of rice | |
| CN108624596A (en) | It is a kind of regulation and control Legume nodule growth gene GmSPX5 and its application | |
| CN101608184B (en) | Clone of cotton mitogen activated protein kinase gene GhMAPK16 and application thereof | |
| CN110229818A (en) | Wax plum CpSNAC1 gene promoter and its application | |
| CN111593065B (en) | Rubber tree phytoene dehydrogenase gene VIGS silencing system and construction method and application thereof | |
| CN109880829A (en) | Barley HvPAA1 gene and application thereof | |
| CN106906224A (en) | A kind of corn anti contravariance related gene ZmDi19 5 and its application | |
| CN108424920A (en) | The resistance to inversely related transcription factor ZmNAC33 genes of corn and its application | |
| CN110157713A (en) | Drought-resistant maize related gene ZmDi19-7 and its application | |
| CN108034662B (en) | Application of wheat stripe rust PSTG _06025 gene in stripe rust prevention and treatment and cultivation method of stripe rust resistant wheat | |
| CN108559753B (en) | Application of wheat stripe rust PSTG _17694 gene in stripe rust prevention and treatment and stripe rust resistant wheat cultivation method | |
| CN111334492A (en) | Watermelon chitinase and coding gene and application thereof | |
| CN110656118A (en) | Geranium strictipes inulin degrading enzyme gene Tk1-FEH and application thereof | |
| CN108864264B (en) | Corn OXS2a gene, and encoding protein and application thereof | |
| CN108220304A (en) | The breeding method of application and Rust resistance bacterium wheat of the wheat stripe rust PSTG_06371 genes in stripe rust prevention | |
| CN104762305B (en) | The gene TaUreG related to Drought-resistance in Wheat and its application | |
| CN114478730B (en) | Wheat TaVQ14 protein, and coding gene and application thereof | |
| CN106544347B (en) | A method of regulation vegetable seeds dormancy time | |
| CN110129338B (en) | Corn transcription factor ZmEREB160 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190823 |