CN101289670A - Process for obtaining antimycosis cut flower flameray gerbera by transgene - Google Patents
Process for obtaining antimycosis cut flower flameray gerbera by transgene Download PDFInfo
- Publication number
- CN101289670A CN101289670A CNA2008100585537A CN200810058553A CN101289670A CN 101289670 A CN101289670 A CN 101289670A CN A2008100585537 A CNA2008100585537 A CN A2008100585537A CN 200810058553 A CN200810058553 A CN 200810058553A CN 101289670 A CN101289670 A CN 101289670A
- Authority
- CN
- China
- Prior art keywords
- chi
- glu
- gene
- enzyme
- cut
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for transgenically obtaining a nosomycosis resistant cut gerbera flower. The method obtains a transgenic plant through the following steps of: separating an antifungal gene, namely a chitinase gene Chi and a beta-1, 3-dextranase gene Glu, cloning the Chi and the Glu, constructing a bivalent expression vector, constructing a high-efficient genetic transformation regeneration system of the cut gerbera flower, transformation of the cut gerbera flower by the antifungal gene and so on. The method uses CaMV35S as starter and transforms genes like Chi, Glu, Npt II and so on into a cut gerbera flower variety 'redcap' and then obtains the transgenic plant, thereby providing technical support for obtaining a large number of antifungal transgenic African daisy strains. The method effectively provides the antifungal transgenic African daisy strains and simultaneously provides a quick, effective and stable technical path for African daisy genetic engineering breeding.
Description
Technical field
The present invention relates to a kind of disease resistance breeding technique method of important flower plant, especially integrated the two kinds of different gene pairs African chrysanthemum of originating and carried out genetic transformation, fundamentally solved African chrysanthemum master and planted the serious difficult problem of regional fungal disease harm.Present technique belongs to the biotechnology breeding field.
Background technology
African chrysanthemum (Gerbera jamesonii Bolus) has another name called African daisy, is the perennial perennial root herbage flower of composite family chrysanthemum wood family's Gerbera, and one of world-renowned five big fresh cutting flower originate from the South Africa Transvaal area.African chrysanthemum has 42 kinds approximately, mainly is distributed in South Africa, Madagascar, India, China, Mongolia, Japan, South America and Australia, because of its pattern is abundant, form is graceful, liked by the people of the world.Nowadays, African chrysanthemum has become important trading commodity, and becomes world-renowned ornamental plant kind with Chinese rose, chrysanthemum, carnation and turmeric.Extensively cultivate 30 countries and regions, the whole world, and all there is cultivation in domestic more than ten provinces and cities, and area is about 800 hectares, and the Yunnan cultivated area is 296 hectares.
Along with the expansion of African chrysanthemum cultivated area, fungal disease all has generally at its main growing area and takes place, and harm is on the rise, and the general sickness rate in area, Kunming is 10%-30%, and weight person reaches 70%-80%.Powdery Mildew, spot disease, eqpidemic disease, root rot etc. are wherein comparatively significantly arranged, and fungal disease has had a strong impact on the output and the quality of African chrysanthemum fresh cutting flower.Because factors such as contaminate environment, cost height, effect are limited, physics or chemical soil disinfection and use systemic fungicide all can not satisfy the requirement of the production of flowers and plants.The developing into it new solution route be provided of transgenic breeding technology.Fungal cell wall is mainly by chitin and β-1, and the 3-dextran is formed, and chitin is present in the inside of fungal cell wall, and dextran then all has in inside and outside of cell, and inner and chitin forms mixture.By the conversion in plant is highly resistant to the harm that fungal disease causes to chitinase gene (Chitinase gene) and beta-1,3-glucanase gene (β-1,3-glucanase gene).Chitinase and beta-1,3-glucanase are divided into three classes, and wherein the I class has stronger inhibition activity to fungi.Experimental results demonstrate that chitinase and beta-1,3-glucanase have collaborative antifungic action.In addition, the transfer-gen plant of acquisition not only is highly resistant to fungal disease, and nematode is also had certain resistance.Therefore, utilize genetic engineering means to create African chrysanthemum resistance to fungal disease new variety the production problem that solves its fungal disease and cause is had main practical application meaning.
Summary of the invention
The objective of the invention is to utilize biotechnological means to create and be highly resistant to the African chrysanthemum new variety that fungal disease infects, do not influence the novel transgenosis African chrysanthemum new variety of ornamental value simultaneously again from the height resistance to fungal disease in the hope of obtaining.
The present invention finishes by following technical proposal: a kind of method of obtaining antimycosis cut flower flameray gerbera by transgene is characterized in that comprising the following steps:
Step 1 serves as the structure that the examination material carries out separation, clone and the expression vector of Chi gene and Glu gene with Kidney bean, tobacco:
(1) gene isolation and clone
A, Chi gene amplification primer: as follows according to bean chitinase cDNA sequence GenBank M13968 design primer:
P
1：5’GAATGAGGCTTTGTAAATTCAC 3’
P
2：5’CGTTAATTTCCAAAAGACCTCTGGT 3’
B, Glu gene amplification primer: as follows according to tobacco dextranase cDNA sequence GenBank X53600 design primer:
P
3：5’AAATGGCTGCTATCACACTCCTAG 3’
P
4：5’CGTCACCCAAAGTTGATATTATATTTGG 3’
The extraction of C, total RNA and the amplification of PCR product: from Kidney bean and tobacco, extract total RNA respectively, with RNA reverse transcription cDNA, and utilize the cDNA of reverse transcription in following reaction system, to carry out pcr amplification through reversed transcriptive enzyme, required Pcr product:
10×Pcr?buffer 2.5ul
dNTP(2.0mM) 2ul
Mgcl
2 2ul
Primer1(10pmol/ul)?1ul
Primer2(10pmol/ul)?1ul
Taq enzyme (1ug/ul) 0.5ul
cDNA(25ng) 2ul
H
2O 11ul
D, flat to Pcr product benefit: utilize the Klenow fragment that above-mentioned Pcr product is carried out filling-in, its reaction system is:
Klenow fragment Buffer 10ul
Klenow fragment 3ul
2.5mM dNTP 17ul
Pcr product 70ul
Reaction conditions is: 37 ℃, 1h obtains end-filling DNA product;
The dephosphorylation of E, end-filling DNA product: after utilizing dna fragmentation terminal bases dephosphorylation test kit that above-mentioned end is mended flat DNA product and gone 5 ' end dephosphorylation reaction, after reclaiming flat DNA product of benefit and T-carrier cloning, obtain clone Chi/T-Vector and Glu/T-Vector;
(2) structure of expression vector
The structure of A, pB-Chi, pB-Glu expression vector: cut Chi/T-Vector and Glu/T-Vector with Sal I enzyme respectively, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, cut 1% electrophoresis detection, the purpose fragment of recovery 958bp and 940bp again with the SacI enzyme; Use the digested plasmid pBI121 of SmaI simultaneously, this plasmid has promotor CaMV35S, cuts with the SacI enzyme again, reclaims the big fragment of carrier; The T4 dna ligase is made carrier respectively and is connected with purpose is segmental, connect product Transformed E .coli DH5a respectively, EcoR I/HindIII double digestion is identified the positive colony of pB-Chi plasmid, Xab I/Xho I double digestion is identified the positive colony of pB-Glu plasmid, obtains correct pB-Chi, the pB-Glu expression vector of closure;
The structure of B, pB-Chi-Glu bivalent expression carrier: cut pB-Chi with the EcoRI enzyme, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, after cutting with the HindIII enzyme again, with the Klenow fragment set by step the system of 1-(1)-D mend flat, electrophoresis reclaims the 2.0kb fragment, this fragment comprises 35S-Chi-Nos, then the process dephosphorylation of 1-(1)-E set by step; Cut pB-Glu with the HindIII enzyme, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, the raw spirit precipitophore, dissolving, the process dephosphorylation of 1-(1)-E set by step, the T4 dna ligase is made carrier and is connected with the purpose fragment, connects product Transformed E .coliDH5a, cut the positive colony of identifying pB-Chi-Glu with Pst I enzyme, obtain the closure pB-Chi-Glu bivalent expression carrier plasmid consistent after testing with intended purposes;
Step 2, the foundation of the efficient transformation tissue culture system of African chrysanthemum
(1) cultivates the African chrysanthemum callus
Select the African chrysanthemum individual plant of healthy growth under the isolated culture condition, the blade that has small callus with petiole is a material, at the African chrysanthemum callus inducing medium: promptly cultivate on the NAA of the 6-BA+0.5-1.5mg/L of Ms+6.0-10.0mg/L, its culture temperature is 24 ± 1 ℃, and illumination is 20001x; Grow the callus that has green vegetative point at petiole base after 14-21 days.
(2) anti-fungal gene is to the conversion of African chrysanthemum
The preparation of A, Agrobacterium competent cell: picking Agrobacterium LBA4404, being inoculated in 5ml contains in the LB liquid nutrient medium of Rifampin Rif of the kantlex Km of 50-80mg/L and 5-10mg/L, LB cultivation based formulas is as follows: the microbial culture of the 8g/l NaCl of the microbial culture of Tryptones+5g/L with yeast extract powder+10g/L, in 28 ℃, 200rpm overnight incubation; Get the 2ml culture and in identical LB liquid nutrient medium, continue to cultivate, to OD600 be 0.4-0.6, with culture ice bath 30min, 4 ℃, the centrifugal 5min of 5000rpm abandon supernatant, are the cold CaCl of 20mmol/L with the concentration of 1ml
2Suspend, be distributed into 50 μ l/ pipe, add 15% glycerine, freezing-70 ℃ of preservations in back get competent cell in the liquid nitrogen;
B, the conversion of plasmid in Agrobacterium: the above-mentioned competent cell for preparing is being melted on ice, add 1ug plasmid pB-Chi-Glu, after placing 30min on ice, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 3～5min are to melting fully, place 2min on ice, the LB liquid that adds the above-mentioned A step of 600ul, 200rpm recovers to cultivate 3～5h under 28 ℃ of temperature, centrifugal 3～the 5min of 5000rpm, collect thalline, stay 50～100ul resuspended, be coated in the microbial culture that contains antibiotic following LB flat board: the 8g/L Rif of the microbial culture of Tryptones+5g/L, cultivated 2 days for 28 ℃, get the single bacterium colony plate of agrobacterium tumefaciens pB-Chi-Glu/LBA4404 with the Km+5-8mg/L of NaCl+15g agar+50-100mg/L of yeast extract powder+10g/L;
C, Agrobacterium is infected African chrysanthemum callus (African chrysanthemum budlet): the single bacterium colony of the above-mentioned agrobacterium tumefaciens pB-Chi-Glu/LBA4404 of picking, at content is the following LB substratum of 50～80mg/L Rif: promptly among the Rif of microbial culture with Km+5～10mg/L of NaCl+50～80mg/L of yeast extract powder+10g/L of the microbial culture of 8g/L with Tryptones+5g/L, the concussion overnight incubation, must activate bacterium liquid, infect with the African chrysanthemum callus of this activation bacterium liquid step 2-(1), infect 8-10min, change in the Ms substratum, dark cultivation down 2 days, the African chrysanthemum callus that obtains infecting;
D, the antibiotic-screening of transformed plant: infect plant and forward the selection substratum to above-mentioned: promptly among the Rif of the Km+50-80mg/L of the KT+25mg/L of NAA+0.2～0.4mg/L of 6-BA+0.5～1.5mg/L of Ms+0.4～0.2mg/L, cultivated 14 days in 28 ℃, the normal African chrysanthemum that differentiates transforms seedling, change division culture medium over to: promptly among the KT of NAA+0.2～0.4mg/L of 6-BA+0.5～1.5mg/L of Ms+0.4～0.2mg/L, in 28 ℃ of screening and culturing 20 days, the normal African chrysanthemum strain of the growth that filters out tie up to expand on the subculture medium of step 3 numerous, must be through the transgenic positive plant of antibiotic-screening.
The pcr amplification reaction condition of described step 1-(1)-C is: the Chi gene: 94 ℃ of 4min, Glu gene: 94 ℃ of 45s; The Chi gene: 60～64 ℃, 45s, the Glu gene: 56～60 ℃, 45s; Chi gene and Glu gene: 72 ℃ of 90s, so carry out 35 circulations; 72 ℃ of 10min, reaction finishes promptly to get required Pcr product.
Described step 1-(1)-E dephosphorylation reaction is carried out according to dna fragmentation terminal bases dephosphorylation test kit specification sheets:
1) the following dephosphorylation reaction solution of preparation in Eppendorf tube:
10×BAP?Buffer 5ul
Bacterial?Alkaline?Phosphatase(BAP) 2.5ul
Mend flat dna fragmentation 42.5ul
2) 65 ℃ of insulations added the sterile purified water of 50 μ l after 30 minutes, replenished volume to 100 μ l;
3) add the following mixture of 100 μ l: phenol: chloroform: primary isoamyl alcohol=25: 24: 1, abundant mixing is got the upper water phase transition to another Eppendorf tube after centrifugal; Repeat this step once;
4) add the following mixture of 100 μ l: chloroform: primary isoamyl alcohol=24: 1, abundant mixing is got the upper water phase transition to another Eppendorf tube after centrifugal;
5) adding 10 μ l pH are 5.2 3M CH
3COONa (sodium acetate) mixes;
6) the DNAmate solution of adding 4 μ l mixes;
7) add 250 μ l-20 ℃ dehydrated alcohol, fully mixing;
8) centrifugal recovery precipitation, after 70% cold ethanol washing and precipitating, drying;
9) with the dilution of 50ul TE water.
Described step 1-(1)-E reclaims the test kit specification sheets to the recovery of mending flat DNA product according to glue to carry out; The T-carrier cloning carries out according to pMD18-T Vector Kit specification sheets, obtain clone Chi/T-Vector and Glu/T-Vector, cut Chi/T-Vector with Sma I enzyme more afterwards, cut Glu/T-Vector with the Xho enzyme, cutting out the segmental clone of 329bp, 690bp respectively is positive forward clone, and the clone makes further determined dna sequence to forward.
The material that the present invention selects for use is:
(1) bacterial classification and plasmid: PMD18-T vector, escherichia coli DH5a, expression vector pBI121, Agrobacterium LBA4404;
(2) vegetable material: common kidney bean (Phaseous vulgaris), tobacco (Nicotiana tabacum), African chrysanthemum kind ' red cap ';
(3) for the examination bacterial classification: latent ground epidemic disease mould (Phytophthora cryptogea) and Phytophthora cactorum (Phytophthoracactorum);
(4) main chemical reagent: ethene, SDS (sodium lauryl sulphate), chloroform, primary isoamyl alcohol, Virahol, ethanol, reversed transcriptive enzyme and Buffer, olig dt
(10), T4 ligase enzyme and Buffer thereof, plasmid segment extract test kit, glue reclaims test kit, Km (kantlex), Amp (penbritin), Cb (Pyocianil), Rif (Rifampin), Pcr amplimer, Taq enzyme and buffer, dNTP, DL2000Marker, restriction enzyme and Buffer thereof, Klenow fragment and Buffer thereof etc.;
The present invention has following advantage and effect:
1, makes up the Chi-Glu bivalent expression carrier that is with the pBI121 expression vector, provide thinking and research basis for making up corresponding bivalent expression carrier research work from now on;
2, setting up with ' red cap ' kind is the African chrysanthemum highly efficient regeneration transformation system of representative, shows that through the Pcr detected result transformation efficiency reaches 8%.Finishing to the follow-up African chrysanthemum transgenosis work of carrying out of this work provides comparatively rich experience and working foundation;
3, the low anti-kind of African chrysanthemum fungal disease has been carried out the conversion of Chi-Glu gene, effectively improve its collaborative antifungic action, system compares with the inoculation contrast strain same period, the phytophthora root rot occurring degree obviously reduces, show that transgenic line is highly resistant to the African chrysanthemum fungal disease that is caused by latent ground epidemic disease mould (Phytophthora cryptogea) and Phytophthora cactorum (Phytophthora cactorum), reduced the cost in the African daisy culture management, plantation is produced and is of practical significance to reality.
Concrete embodiment
For flesh and blood of the present invention is described better, provide embodiments of the invention below, but content of the present invention is not limited in these.
Step 1 serves as the structure that the examination material carries out separation, clone and the expression vector of Chi gene and Glu gene with Kidney bean, tobacco
(1) separation of gene and clone
A, Chi gene amplification primer: as follows according to bean chitinase cDNA sequence GenBank M13968 design primer:
P
1：5’GAATGAGGCTTTGTAAATTCAC 3’
P
2：5’CGTTAATTTCCAAAAGACCTCTGGT 3’
B, Glu gene amplification primer: as follows according to tobacco dextranase cDNA sequence GenBank X53600 design primer:
P
3：5’AAATGGCTGCTATCACACTCCTAG 3’
P
4：5’CGTCACCCAAAGTTGATATTATATTTGG 3’
More than the 2 pairs of primers synthetic by Beijing Ao Ke biotech firm;
The extraction of C, total RNA and the amplification of PCR product: from four leaf phase of ethephon-induction Kidney bean and inoculation TMV seedling phase tobacco, extract total RNA respectively according to conventional Tizol method, with Rever Tra Ace reversed transcriptive enzyme with RNA reverse transcription cDNA, and utilize the cDNA of reverse transcription to carry out pcr amplification, the reaction system of pcr amplification is:
10×Pcrbuffer 2.5ul
dNTP(2.0mM) 2ul
Mgcl
2 2ul
Primer1(10pmol/ul) 1ul
Primer2(10pmol/ul) 1ul
Taq enzyme (1ug/ul) 0.5ul
cDNA(25ng) 2ul
H
2O 11ul
Reaction conditions is: the Chi gene: 94 ℃ of 4min, Glu gene: 94 ℃ of 4 5s; The Chi gene: 60～64 ℃, 45s, the Glu gene: 56～60 ℃, 45s; Chi gene and Glu gene: 72 ℃ of 90s, so carry out 35 circulations; 72 ℃ of 10min, reaction obtains required Pcr product after finishing;
D, flat to Pcr product benefit: utilize the Klenow fragment that above-mentioned Pcr product is carried out filling-in, its reaction system is:
Klenow fragment Buffer 10ul
Klenow fragment 3ul
2.5mM dNTP 17ul
Pcr product 70ul
Reaction conditions is: 37 ℃, 1h obtains end-filling DNA product;
The dephosphorylation of E, end-filling DNA product: utilize dna fragmentation terminal bases dephosphorylation test kit that above-mentioned end is mended flat DNA and go 5 ' end dephosphorylation reaction, its process is:
1) the following dephosphorylation reaction solution of preparation in Eppendorf tube:
10×BAP?Buffer 5ul
Bacterial?Alkaline?Phosphatase(BAP) 2.5ul
Mend flat dna fragmentation 42.5ul
2) 65 ℃ of insulations added the sterile purified water of 50 μ l after 30 minutes, replenished volume to 100 μ l;
3) add the following mixture of 100 μ l: phenol: chloroform: primary isoamyl alcohol=25: 24: 1, abundant mixing is got the upper water phase transition to another Eppendorf tube after centrifugal; Repeat this step once;
4) add the following mixture of 100 μ l: chloroform: primary isoamyl alcohol=24: 1, abundant mixing is got the upper water phase transition to another Eppendorf tube after centrifugal;
5) adding 10 μ l pH are 5.2 3M CH
3COONa (sodium acetate) mixes;
6) the DNAmate solution of adding 4 μ l mixes;
7) add 250 μ l-20 ℃ dehydrated alcohol, fully mixing;
8) centrifugal recovery precipitation, after 70% cold ethanol washing and precipitating, drying;
9) with the dilution of 50ul TE water;
Mending flat DNA product reclaims and the T-carrier cloning: the recovery of target DNA fragment is reclaimed the test kit specification sheets according to glue and is carried out; The T-carrier cloning carries out according to pMD18-T Vector Kit specification sheets, obtains clone Chi/T-Vector and Glu/T-Vector;
The enzyme of T-carrier cloning is cut and is identified and sequencing: cut Chi/T-Vector with the SmaI enzyme, cut Glu/T-Vector with the Xho enzyme, cutting out the segmental clone of 329bp, 690bp respectively is positive forward clone, and the clone send Beijing Ao Ke biotech firm to make further determined dna sequence to forward;
(2) structure of expression vector
The structure of A, pB-Chi, pB-Glu expression vector: cut Chi/T-Vector and Glu/T-Vector with Sal I enzyme respectively, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, cut 1% electrophoresis detection, the purpose fragment of recovery 958bp and 940bp again with Sac I enzyme; Use the digested plasmid pBI121 of Sma I simultaneously, this plasmid has promotor CaMV35S, cuts with Sac I enzyme again, reclaims the big fragment of carrier; The T4 dna ligase is made carrier respectively and is connected with purpose is segmental, connect product Transformed E .coli DH5a respectively, EcoR I/HindIII double digestion is identified the positive colony of pB-Chi plasmid, Xab I/Xho I double digestion is identified the positive colony of pB-Glu plasmid, obtains correct pB-Chi, the pB-Glu expression vector of closure;
The structure of B, pB-Chi-Glu bivalent expression carrier: cut pB-Chi with EcoR I enzyme, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, after cutting with the HindIII enzyme again, with the Klenow fragment set by step the system of 1-(1)-D mend flat, electrophoresis reclaims the 2.0kb fragment, this fragment comprises 35S-Chi-Nos, then the process dephosphorylation of 1-(1)-E set by step; Cut pB-Glu with the HindIII enzyme, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, the raw spirit precipitophore, dissolving, the process dephosphorylation of 1-(1)-E set by step, the T4 dna ligase is made carrier and is connected with the purpose fragment, connects product Transformed E .coliDH5a, cut the positive colony of identifying pB-Chi-Glu with Pst I enzyme, obtain the closure pB-Chi-Glu bivalent expression carrier plasmid consistent after testing with intended purposes;
Step 2, the foundation of the efficient transformation tissue culture system of African chrysanthemum
(1) cultivates the African chrysanthemum callus
Select the African chrysanthemum individual plant of healthy growth under the isolated culture condition, the blade that has small callus with petiole is a material, at the African chrysanthemum callus inducing medium: promptly cultivate on the NAA of the 6-BA+0.5-1.5mg/L of Ms+6.0-10.0mg/L, its culture temperature is 24 ± 1 ℃, and illumination is 2000lx; Grow the callus that has green vegetative point at petiole base after 14-21 days.
African chrysanthemum microbiotic background test: according to the structure component characteristic of expression vector pBI121, selecting kantlex Km is the screening microbiotic of this African chrysanthemum converting material, in the subculture medium of step 3, add 20,25,30,40 respectively, the Km of 50mg/l, implant African chrysanthemum callus lines and individual plant and cultivated 14 days, the subculture cultivation base that contains the Km of 25mg/l through observation helps African chrysanthemum transgenic positive plant is screened;
(2) anti-fungal gene is to the conversion of African chrysanthemum
The preparation of A, Agrobacterium competent cell: picking Agrobacterium LBA4404, be inoculated in 5ml and contain in the LB liquid nutrient medium of Rifampin Rif of the kantlex Km of 50-80mg/L and 5-10mg/L, it is as follows that LB cultivates based formulas: microbial culture with Tryptones 8g/L+ microbial culture with yeast extract powder 5g/L+NaCl 10g/L; In 28 ℃, 200rpm overnight incubation; Get the 2ml culture and in identical LB liquid nutrient medium, continue to cultivate, to OD600 be 0.4-0.6, with culture ice bath 30min, 4 ℃, the centrifugal 5min of 5000rpm abandon supernatant, are the CaCl of 20mmol/L with the cold concentration of 1ml
2Suspend, be distributed into 50 μ l/ pipe, add 15% glycerine, freezing-70 ℃ of preservations in back get competent cell in the liquid nitrogen;
B, the conversion of plasmid in Agrobacterium: the above-mentioned competent cell for preparing is being melted on ice, add 1ug plasmid pB-Chi-Glu, after placing 30min on ice, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 3～5min are to melting fully, place 2min on ice, add the 600ul LB liquid identical with above-mentioned A, 200rpm recovers to cultivate 3～5h under 28 ℃ of temperature, centrifugal 3～the 5min of 5000rpm, collect thalline, stay 50～100ul resuspended, be coated in the microbial culture that contains antibiotic following LB flat board: the 8g/L Rif of the microbial culture of Tryptones+5g/L, cultivated 2 days for 28 ℃, get the single bacterium colony plate of agrobacterium tumefaciens pB-Chi-Glu/LBA4404 with the Km+5-8mg/L of NaCl+15g agar+50-100mg/L of yeast extract powder+10g/L;
C, Agrobacterium are infected the African chrysanthemum callus: the single bacterium colony of picking agrobacterium tumefaciens pB-Chi-Glu/LBA4404, at content is the following LB substratum of 50～80mg/L Rif: promptly among the Rif of microbial culture with Km+5～10mg/L of NaCl+50～80mg/L of yeast extract powder+10g/L of the microbial culture of 8g/L with Tryptones+5g/L, the concussion overnight incubation, must activate bacterium liquid, infect with the African chrysanthemum callus of this activation bacterium liquid step 2-(1), infect 8-10min, change in the Ms substratum, dark cultivation down 2 days obtains infecting plant;
The antibiotic-screening of D, transformed plant:
Infect plant and forward the selection substratum to above-mentioned: promptly among the Rif of the Km+50-80mg/L of the KT+25mg/L of NAA+0.2～0.4mg/L of 6-BA+0.5～1.5mg/L of Ms+0.4～0.2mg/L, cultivated 14 days in 28 ℃, the normal African chrysanthemum that differentiates transforms seedling, change division culture medium over to: promptly among the KT of NAA+0.2～0.4mg/L of 6-BA+0.5～1.5mg/L of Ms+0.4～0.2mg/L, in 28 ℃ of screening and culturing 20 days, the normal African chrysanthemum strain of the growth that filters out tie up to expand on the subculture medium of step 3 numerous, transfer-gen plant;
Step 3, the Pcr of transfer-gen plant detects
(1) the African chrysanthemum plant through the antibiotic-screening survival being carried out Pcr detects; The extraction of total DNA of the African chrysanthemum plant that transforms: under aseptic condition, get the blade of converting material, place centrifuge tube, under the liquid nitrogen condition, grind, add DNA extraction damping fluid (100mM NaCl, 50mM EDTA, 0.5%SDS, 50mM Tris, PH 7.4), mixing, 60 ℃ of water-bath 1h add isopyknic chloroform-primary isoamyl alcohol (24: 1), put upside down mixing, the centrifugal 4min of 10000rpm repeats extracting 2-3 time; Get the liquid aqueous phase layer, add the freezing Virahol of 2 times of volumes, abundant mixing ,-20 ℃ of placements.Detect through agarose electrophoresis, the result shows the total DNA that obtains to transform the African chrysanthemum plant.
The extraction of total DNA of African chrysanthemum adjoining tree: select the material without Agrobacterium-mediated Transformation, carry out the extraction of DNA, extracting method is identical with the total DNA extraction method that transforms the African chrysanthemum plant.Detect through agarose electrophoresis, the result shows the total DNA that obtains control material African chrysanthemum plant.
The Pcr amplification of total DNA: with total DNA of the African chrysanthemum of extracting in the converting material and contrast African chrysanthemum DNA is template, serves as according to the design primer with the Chi gene order, carries out the Pcr amplification:
Amplimer is: P
1: 5 ' GAATGAGGCTTTGTAAATTCAC 3 '
P
2：5’CGTTAATTTCCAAAAGACCTCTGGT 3’
Pcr reactive system: add in the aseptic Pcr pipe:
10×Pcrbuffer 2ul
4×dNTP(2mM) 2ul
Primer1(10pmol/ul) 2ul
Primer2(10pmol/ul) 2ul
Taq enzyme (1ug/ul) 1ul
Template DNA (about 25ng) 2ul
D
2H
2O 9ul
Cumulative volume 20ul
Last envelope paraffin oil, increase by following program:
Reaction conditions is: 94 ℃ of pre-sex change 4min; 94 ℃ of 30s, 64-60 ℃ of 30s, 72 ℃ of 3min, 35 circulations; 72 ℃ are extended 10min.
After reaction finishes, get the Pcr product and on 1.0% sepharose, carry out electrophoresis detection, with the negative contrast of Pcr product of African chrysanthemum ' red cap ' DNA of unconverted.
(2) disease resistance of transfer-gen plant detects:
A, strain culturing: gather the phytophthora root rot disease plant from African chrysanthemum morbidity strain, with about the fresh diseased tissues clip rhizome 2cm of portion, be seeded on the V8 substratum through surface cleaning, after placing 24 ℃ of dark 5-7d of cultivation, observation has mycelium to produce but does not have sporocyst, after treating that mycelia is covered with whole media surface, induce the generation sporocyst with the Pi Shi nutrient solution, it is standby that it is prepared into spore suspension;
B, material plantation: the expert evidence plantation that seedling age is identical is in the soil of bacterium that went out, and each kind is planted 10-20 basin, and the 8-10 basin is used for inoculation, the 2-4 basin is used for contrast, be placed in the greenhouse and plant, temperature is treated can inoculate after plant strain growth is stablized between 19-30 ℃;
C, inoculation method (soil inoculation method): suck the 1ml spore suspension with syringe and pour into plant rhizome portion, the plant that inoculated is placed on cultivation under the thermophilic, watering every day makes the Soil conservation humidity 1 time.
D, state of an illness investigation: institute an inquiry incidence behind the inoculation 10d, this moment, plant showed wilting, and blade presents red-purple or chocolate, and is withered successively, and whole strain is withered when serious.Every 4d investigation once, investigate altogether 9 times, the note " √ " of initial stage illness occurs, the note " √-" of wilting, withered note " X ", not being designated as of morbidity " 0 ".
It is as follows to gather the phytophthora root rot test result in the inoculation African chrysanthemum morbidity strain of selecting 2 transgenic positive strain systems and contrasting:
Claims (4)
1, a kind of method of obtaining antimycosis cut flower flameray gerbera by transgene is characterized in that comprising the following steps:
Step 1 serves as the structure that the examination material carries out separation, clone and the expression vector of Chi gene and Glu gene with Kidney bean, tobacco:
(1) gene isolation and clone
A, Chi gene amplification primer: as follows according to bean chitinase cDNA sequence GenBank M13968 design primer:
P
1：5’GAATGAGGCTTTGTAAATTCAC 3’
P
2：5’CGTTAATTTCCAAAAGACCTCTGGT 3’
B, Glu gene amplification primer: as follows according to tobacco dextranase cDNA sequence GenBank X53600 design primer:
P
3：5’AAATGGCTGCTATCACACTCCTAG 3’
P
4：5’CGTCACCCAAAGTTGATATTATATTTGG 3’
The extraction of C, total RNA and the amplification of PCR product: from Kidney bean and tobacco, extract total RNA respectively, with RNA reverse transcription cDNA, and utilize the cDNA of reverse transcription in following reaction system, to carry out pcr amplification through reversed transcriptive enzyme, required Pcr product:
10×Pcr?buffer 2.5ul
dNTP(2.0mM) 2ul
MgCl
2 2ul
Primerl(10pmol/ul) 1ul
Primer2(10pmol/ul) 1ul
Taq enzyme (1ug/ul) 0.5ul
cDNA(25ng) 2ul
H
2O 11ul
D, flat to Pcr product benefit: utilize the Klenow fragment that above-mentioned Pcr product is carried out filling-in, its reaction system is:
Klenow fragment Buffer 10ul
Klenow fragment 3ul
2.5mM dNTP 17ul
Pcr product 70ul
Reaction conditions is: 37 ℃, 1h obtains end-filling DNA product;
The dephosphorylation of E, end-filling DNA product: after above-mentioned end mended flat DNA product and go 5 ' end dephosphorylation reaction, reclaim mend flat DNA product and T-carrier cloning after, obtain clone Chi/T-Vector and Glu/T-Vector;
(2) structure of expression vector
The structure of A, pB-Chi, pB-Glu expression vector: cut Chi/T-Vector and Glu/T-Vector with Sal I enzyme respectively, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, cut 1% electrophoresis detection, the purpose fragment of recovery 958bp and 940bp again with the SacI enzyme; Use the digested plasmid pBI121 of SmaI simultaneously, cut with the SacI enzyme again, reclaim the big fragment of carrier; The T4DNA ligase enzyme is made carrier respectively and is connected with purpose is segmental, connect product Transformed E .coli DH5a respectively, EcoR I/HindIII double digestion is identified the positive colony of pB-Chi plasmid, Xab I/XhoI double digestion is identified the positive colony of pB-Glu plasmid, obtains correct pB-Chi, the pB-Glu expression vector of closure;
The structure of B, pB-Chi-Glu bivalent expression carrier: cut pB-Chi with the EcoRI enzyme, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, after cutting with the HinIII enzyme again, with the Klenow fragment set by step the system of 1-(1)-D mend flat, electrophoresis reclaims the 2.0kb fragment, this fragment comprises CaMV35S-Chi-Nos, then the process dephosphorylation of 1-(1)-E set by step; Cut pB-Glu with the HindIII enzyme, with the Klenow fragment set by step the system of 1-(1)-D it is mended flat, the raw spirit precipitophore, dissolving, the process dephosphorylation of 1-(1)-E set by step, the T4DNA ligase enzyme is made carrier and is connected with the purpose fragment, connects product and transforms coli DH5a, cut the positive colony of identifying pB-Chi-Glu with Pst I enzyme, obtain the closure pB-Chi-Glu bivalent expression carrier plasmid consistent after testing with intended purposes;
Step 2, the foundation of the efficient transformation tissue culture system of African chrysanthemum
(1) cultivates the African chrysanthemum callus
Select the African chrysanthemum individual plant of healthy growth under the isolated culture condition, the blade that has small callus with petiole is a material, at the African chrysanthemum callus inducing medium: promptly cultivate on the NAA of the 6-BA+0.5-1.5mg/L of Ms+6.0-10.0mg/L, its culture temperature is 24 ± 1 ℃, and illumination is 20001x; Grow the callus that has green vegetative point at petiole base after 14-21 days, aseptic condition downcuts the callus that grows down
(2) anti-fungal gene is to the conversion of African chrysanthemum
The preparation of A, Agrobacterium competent cell: picking Agrobacterium LBA4404, being inoculated in 5ml contains in the LB liquid nutrient medium of Rifampin Rif of the kantlex Km of 50-80mg/L and 5-10mg/L, LB cultivation based formulas is as follows: the microbial culture of the 8g/L NaCl of the microbial culture of Tryptones+5g/L with yeast extract powder+10g/L, in 28 ℃, 200rpm overnight incubation; Get the 2ml culture and in identical LB liquid nutrient medium, continue to cultivate, to OD600 be 0.4-0.6, with culture ice bath 30min, 4 ℃, the centrifugal 5min of 5000rpm abandon supernatant, are the cold CaCl of 20mmol/L with the concentration of 1ml
2Suspend, be distributed into 50 μ l/ pipe, add 15% glycerine, freezing-70 ℃ of preservations in back get competent cell in the liquid nitrogen;
B, the conversion of plasmid in Agrobacterium: the above-mentioned competent cell for preparing is being melted on ice, add 1ug plasmid pB-Chi-Glu, after placing 30min on ice, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 3～5min are to melting fully, place 2min on ice, the LB liquid that adds the above-mentioned A step of 600ul, 200rpm recovers to cultivate 3～5h under 28 ℃ of temperature, centrifugal 3～the 5min of 5000rpm, collect thalline, stay 50～100ul resuspended, be coated in the microbial culture that contains antibiotic following LB flat board: the 8g/L Rif of the microbial culture of Tryptones+5g/L, cultivated 2 days for 28 ℃, get the single bacterium colony plate of agrobacterium tumefaciens pB-Chi-Glu/LBA4404 with the Km+5-8mg/L of NaCl+15g agar+50-100mg/L of yeast extract powder+10g/L;
C, Agrobacterium is infected the African chrysanthemum callus: the single bacterium colony of the above-mentioned agrobacterium tumefaciens pB-Chi-Glu/LBA4404 of picking, at content is the following LB substratum of 50～80mg/L Rif: promptly among the Rif of microbial culture with Km+5～10mg/L of NaCl+50～80mg/L of yeast extract powder+10g/L of the microbial culture of 8g/L with Tryptones+5g/L, the concussion overnight incubation, must activate bacterium liquid, infect with the African chrysanthemum callus of this activation bacterium liquid step 2-(1), infect 8-10min, change in the Ms substratum, dark cultivation down 2 days is to the callus material through infecting;
D, the antibiotic-screening of transformed plant: infect plant and forward the selection substratum to above-mentioned: promptly among the Rif of the Km+50-80mg/L of the KT+25mg/L of NAA+0.2～0.4mg/L of 6-BA+0.5～1.5mg/L of Ms+0.4～0.2mg/L, cultivated 14 days in 28 ℃, the normal African chrysanthemum that differentiates transforms seedling, change division culture medium over to: promptly among the KT of NAA++0.2～0.4mg/L of 6-BA+0.5～1.5mg/L of Ms+0.4～0.2mg/L, cultivated 20 days in 28 ℃, the normal African chrysanthemum strain of the growth that filters out tie up to expand on the subculture medium of step 3 numerous, the transgenic positive plant of antibiotic-screening.
2, the method for obtaining antimycosis cut flower flameray gerbera by transgene according to claim 1 is characterized in that the pcr amplification reaction condition of described step 1-(1)-C is: the Chi gene: 94 ℃ of 4min, Glu gene: 94 ℃ of 45s; The Chi gene: 60～64 ℃, 45s, the Glu gene: 56～60 ℃, 45s; Chi gene and Glu gene: 72 ℃ of 90s, so carry out 35 circulations; 72 ℃ of 10min, reaction finishes promptly to get required Pcr product.
3, the method for obtaining antimycosis cut flower flameray gerbera by transgene according to claim 1 is characterized in that described step 1-(1)-E dephosphorylation reaction carries out according to dna fragmentation terminal bases dephosphorylation test kit specification sheets:
1) the following dephosphorylation reaction solution of preparation in Eppendorf tube:
10×BAP?Buffer 5ul
Bacterial?Alkaline?Phosphatase(BAP) 2.5ul
Mend flat dna fragmentation 42.5ul
2) 65 ℃ of insulations added the sterile purified water of 50 μ l after 30 minutes, replenished volume to 100 μ l;
3) add the following mixture of 100 μ l: phenol: chloroform: primary isoamyl alcohol=25: 24: 1, abundant mixing is got the upper water phase transition to another Eppendorf tube after centrifugal; Repeat this step once;
4) add the following mixture of 100 μ l: chloroform: primary isoamyl alcohol=24: 1, abundant mixing is got the upper water phase transition to another Eppendorf tube after centrifugal;
5) adding 10 μ l pH are 5.2 3M sodium acetate CH
3COONa mixes;
6) the DNAmate solution of adding 4 μ l mixes;
7) add 250 μ l-20 ℃ dehydrated alcohol, fully mixing;
8) centrifugal recovery precipitation, after 70% cold ethanol washing and precipitating, drying;
9) with the dilution of 50ul TE water.
4, the method for obtaining antimycosis cut flower flameray gerbera by transgene according to claim 1 is characterized in that described step 1-(1)-E reclaims the test kit specification sheets to the recovery of mending flat DNA product according to glue and carries out; The T-carrier cloning carries out according to pMD18-T Vector Kit specification sheets, obtain clone Chi/T-Vector and Glu/T-Vector, cut Chi/T-Vector with the SmaI enzyme more afterwards, cut Glu/T-Vector with the Xho enzyme, cutting out the segmental clone of 329bp, 690bp respectively is positive forward clone, and the clone makes further determined dna sequence to forward.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100585537A CN101289670A (en) | 2008-06-18 | 2008-06-18 | Process for obtaining antimycosis cut flower flameray gerbera by transgene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100585537A CN101289670A (en) | 2008-06-18 | 2008-06-18 | Process for obtaining antimycosis cut flower flameray gerbera by transgene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101289670A true CN101289670A (en) | 2008-10-22 |
Family
ID=40034115
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100585537A Pending CN101289670A (en) | 2008-06-18 | 2008-06-18 | Process for obtaining antimycosis cut flower flameray gerbera by transgene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101289670A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480188A (en) * | 2014-12-26 | 2015-04-01 | 瓦房店大河红运生态农业有限公司 | Partition type medium group capable of rapidly detecting fungusheterocaryon and preparation method of partition type medium group |
| CN105671056A (en) * | 2016-03-09 | 2016-06-15 | 南京农业大学 | Method for regulating and controlling growth of chrysanthemum petals through conversion of CmTCP20 gene |
| CN108660152A (en) * | 2018-05-22 | 2018-10-16 | 华南农业大学 | Application of the African Chrysanthemum GhGDEF3 genes in hose-in-hose is formed |
| CN109337924A (en) * | 2018-12-24 | 2019-02-15 | 武汉天问生物科技有限公司 | A kind of plant transgene rapid genetic transformation method |
| CN115005044A (en) * | 2022-07-08 | 2022-09-06 | 云南省农业科学院花卉研究所 | Disease control method for potted gerbera jamesonii |
-
2008
- 2008-06-18 CN CNA2008100585537A patent/CN101289670A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480188A (en) * | 2014-12-26 | 2015-04-01 | 瓦房店大河红运生态农业有限公司 | Partition type medium group capable of rapidly detecting fungusheterocaryon and preparation method of partition type medium group |
| CN105671056A (en) * | 2016-03-09 | 2016-06-15 | 南京农业大学 | Method for regulating and controlling growth of chrysanthemum petals through conversion of CmTCP20 gene |
| CN105671056B (en) * | 2016-03-09 | 2018-12-07 | 南京农业大学 | A method of by turning the growth of CmTCP20 gene regulation Chrysanthemum Petal |
| CN108660152A (en) * | 2018-05-22 | 2018-10-16 | 华南农业大学 | Application of the African Chrysanthemum GhGDEF3 genes in hose-in-hose is formed |
| CN108660152B (en) * | 2018-05-22 | 2020-04-14 | 华南农业大学 | Application of African daisy GhGDEF3 gene in forming of double-petal flower |
| CN109337924A (en) * | 2018-12-24 | 2019-02-15 | 武汉天问生物科技有限公司 | A kind of plant transgene rapid genetic transformation method |
| CN115005044A (en) * | 2022-07-08 | 2022-09-06 | 云南省农业科学院花卉研究所 | Disease control method for potted gerbera jamesonii |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102010466B (en) | Plant resistance associated protein MYB, as well as coding gene and application thereof | |
| CN105543269B (en) | Plant is improved to the method for resistance to verticillium wilt using beauveria bassiana BbP4-ATPase gene | |
| CN102634541A (en) | Agrobacterium tumefaciens gene transformation method of hybrid poplar | |
| CN102174566B (en) | Method for improving stress resistance of chrysanthemum through trans-CgHSP70 genes | |
| CN101289670A (en) | Process for obtaining antimycosis cut flower flameray gerbera by transgene | |
| CN103525828B (en) | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof | |
| CN101006768A (en) | Agrobacterium-mediated Sophora japonica transgenic and tissue-culturing rapid propagation method | |
| CN102719449A (en) | Clone of apple resistance-related gene MdSIMYB1 and application thereof | |
| CN104388433B (en) | A kind of Plant Osmotic Stress inducible promoter and application thereof | |
| CN103360484A (en) | Upland cotton protein GhMADS22, and coding gene and application thereof | |
| CN103146722B (en) | Gene sequence of I-type tonoplast pyrophosphatase from ammopiptanthus nanus and cloning method of gene sequence | |
| CN103966221A (en) | Cloning and application of seed-root tip specific expression promoter | |
| CN101984059A (en) | Gossypium barbadense DREB transcription factor gene and application thereof | |
| CN101481410A (en) | Drought resisting related transcription factor of cotton, and encoding gene and use thereof | |
| CN103468792A (en) | Method used for detecting rice double T-DNA transgenic non-linked integration by molecular marker | |
| CN105695471B (en) | Root-specific expresses AhOda promoters and its application | |
| CN102618561B (en) | Genes related to stress resistance and application to improving stress resistance of plant to environment | |
| CN103255155B (en) | Gene sequence of phospholipase D alpha1 from short mongolian ammopiptanthus and clone method of gene sequence | |
| CN102559745A (en) | EPSP synthase gene rice chloroplast expression vector and application thereof | |
| CN101892242A (en) | Ammopiptanthus mongolicus cold-resistant gene AmEBP1 | |
| CN101781654B (en) | Novel cotton fungal disease-resistant gene GhMPK7 and application thereof | |
| CN102586269A (en) | Ammopiptanthus mongolicus cold resistant gene AmGS | |
| CN103224945A (en) | Gene sequence of molybdenum cofactor sulfurylase from ammopiptanthus nanus and cloning method thereof | |
| CN101463393A (en) | Method for screening transgenic plate with safety marker gene | |
| CN101392260B (en) | Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20081022 |