CN102559745A - EPSP synthase gene rice chloroplast expression vector and application thereof - Google Patents
EPSP synthase gene rice chloroplast expression vector and application thereof Download PDFInfo
- Publication number
- CN102559745A CN102559745A CN2012100208208A CN201210020820A CN102559745A CN 102559745 A CN102559745 A CN 102559745A CN 2012100208208 A CN2012100208208 A CN 2012100208208A CN 201210020820 A CN201210020820 A CN 201210020820A CN 102559745 A CN102559745 A CN 102559745A
- Authority
- CN
- China
- Prior art keywords
- rice
- synthase gene
- expression vector
- chloroplast
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses an EPSP synthase (5-enolpyruvyl-shikimate-3-phosphate synthase) gene rice chloroplast expression vector and application of the expression vector. The rice chloroplast expression vector comprises EPSP synthase gene expression cassette, and homologous recombination fragments atpB and rbcL in rice chloroplast genome, wherein the EPSP synthase gene expression cassette is located between atpB and rbcL. The invention also provides a construction method of the chloroplast expression vector. According to the invention, the rice chloroplast expression vector is applied to improve glyphosate resistance of rice, and the application comprises transforming rice callus or callus cells with rice chloroplast expression vector and regenerating to obtain genetically modified rice with notably improved glyphosate resistance. The rice chloroplast expression vector of the invention can efficiently improve glyphosate resistance in the genetically modified rice to obtain genetically modified rice with stable heredity and without gene silencing or gene segregation, and has the advantages of high safety, time saving effect, high efficiency, low energy consumption, low cost and the like.
Description
Technical field
The present invention relates to a kind of chloroplast expression carrier; Relate in particular to a kind of EPSP synthase (5-enol form acetone shikimic acid-3-phosphate synthase) trans-genetic hybrid rice chloroplast expression carrier and construction process thereof; The invention further relates to the application of this epsp synthase gene rice chloroplast expression vector in improving the paddy rice glyphosate resistance, belong to the transgenic paddy rice field.
Background technology
1988, the chloroplast DNA that Boynton etc. utilize particle bombardment will have the atpB wild type gene first bombarded the chlamydomonas of atpB sudden change, makes it recover photosynthetic ability, thereby indicates the beginning of chloroplast gene engineering.1900, utilize particle bombardment that the rrn16 gene is obtained expressing in tobacco chloroplast first, drawn back the curtain that the higher plant chloroplast(id) transforms.Grasses such as paddy rice, corn and wheat are important crops, and are but very slow in the progress of application of grass but chloroplast(id) transforms technology.2006; (Lee, S.M., et al. such as Lee; Plastid transformation in the monocotyledonous cereal crop; Rice (Oryza sativa) and transmission of transgenes to theirprogeny.Mol Cells, 2006.21 (3): p.401-10.) first CFP and aadA gene are successfully recombinated in paddy rice (Oryza sativa) the chloroplast gene group, lay a good foundation for chloroplast(id) transforms the application of technology in grass.Li Yinv etc. (Li Yinv etc. the foundation of rice chloroplast expression system and anti-PPT chloroplast(id) transform the acquisition of plant. Scientia Agricultura Sinica; 2007.40 (9): 1849-1855.) select the site of the intergenic sequence of ndhF and trnL as weedicide PPT resistant gene bar site-directed integration; With the bar recombination in the rice chloroplast gene; The bar gene is expressed in rice genome normally, has both improved the ability of the anti-PPT of paddy rice, can be used as the selection markers of conversion again.(Cui such as Cui; C.; Et al.; Stable chloroplast transformation of immature scutella and inflorescences in wheat (Triticum aestivum L.) .Acta Biochim Biophys Sin (Shanghai) .43 (4): p.284-91.) utilize particle bombardment with GFP and npt II gene transformation wheat prematurity scultellum and inflorescence; Cultivation has obtained transformed plant, and the new kind of grass cultivation that is applied to that transforms the technology success for chloroplast(id) is laid a good foundation.
Expression efficiency height that chloroplast(id) transforms and foreign gene can site-directed integrations; Each mesophyll cell of polycarpeae contains 100 chloroplast(id)s of having an appointment; Each chloroplast(id) contains 100 the chloroplast gene group copies of having an appointment; If complete homogeneity also has strong promoter to exist, foreign gene can be expressed efficiently, and chloroplast(id) has remarkable power of endurance to expression of exogenous gene simultaneously.Chloroplast(id) can directly be expressed the gene from protokaryon; The chloroplast gene group has prokaryotic, and the preferences of chloroplast gene group polycistronic transcription, sequence in the gene, control methods, codon etc. are very similar with prokaryotic.The prokaryotic of chloroplast(id) is beneficial to protokaryon source expression of gene.But eukaryotic gene also can well be expressed in chloroplast gene.Polygene can transform at chloroplast(id) simultaneously, improves transformation efficiency; The chloroplast gene group has overlapping genes; Be to be transcription unit with the polycistron, produce polycistronic mRNA and come synthetic protein, so can in chloroplast(id), express simultaneously by a plurality of foreign genes under the promotor guiding; Express when can realize a plurality of gene; A plurality of foreign genes can be expressed simultaneously, and do not influence each other, and avoid when expressing, producing the gene silencing phenomenon because of a plurality of genes of a plurality of identical promoter regulations.Chloroplast(id) transforms does not have carrier sequence, position effect and manifold effect; Belong to matrocliny, progeny material is stable; Safe.Chloroplast(id) is a matrilinear inheritance, and foreign gene can not cause genetic drift with pollen transmission.
Glyphosate 62 IPA Salt is a kind of efficient, wide spectrum, low residue, low toxicity, is prone to be widely used in agricultural by the nonselective weedicide of microbiological degradation and interior suction conduction, and most plants is had the natural disposition of going out.Because Glyphosate 62 IPA Salt uses easily, efficient, low price, various countries constantly increase the turnout of Glyphosate 62 IPA Salt to satisfy the demand that increases day by day.Genetically modified glyphosate resistant crops big area is promoted the frontier that provides Glyphosate 62 IPA Salt to use to the peasant.The resistance glyphosate soybean GTS40-3-2 of Monsanto Company's exploitation in 1996 sells first, and up to the present 1000 business-like resistance glyphosate soybean varieties of surpassing have been arranged.
Crops such as the soybean of resistance glyphosate, cotton, paddy rice, peanut, tobacco, beet have obtained popularization.Whole world resistance glyphosate soybean acreage was greater than 0.41 hundred million hm in 2003
2, the popularization that the crop of other antiweed is also a large amount of mainly is the resistance glyphosate kind.From the glyphosate resistant crops of having promoted, mainly be Monsanto Company's exploitation of the U.S., the gene that changes over to is the CP4EPSPS gene.Meng Shan reaches glyphosate resistant crops seed and farming at the sale of weedicide cluster, has formed the situation of dominating exclusively.Though cloned the EPSPS gene of some antiweeds from mikrobe, plant etc., also obtained corresponding transgenic plant, seldom can reach the level of popularization.Up to now, the domestic new variety that also do not have to occur the extensive resistance glyphosate of promoting.
Chloroplast(id) conversion system has expression efficiency height and foreign gene can site-directed integration; No matter be that the eucaryon or the foreign gene of protokaryon can be expressed in chloroplast(id) efficiently, especially chloroplast(id) belongs to matrilinear inheritance, and progeny material is stable; Safe; Foreign gene can not cause advantages such as genetic drift with pollen transmission, so receive more and more many attention.
Summary of the invention
One of the object of the invention provides a kind of epsp synthase gene rice chloroplast expression vector;
Two of the object of the invention provides a kind of method that makes up said epsp synthase gene rice chloroplast expression vector;
Three of the object of the invention is that constructed epsp synthase gene rice chloroplast expression vector is applied to improve the glyphosate resistance of paddy rice.
To achieve these goals; One aspect of the present invention provides a kind of epsp synthase gene rice chloroplast expression vector; This epsp synthase gene rice chloroplast expression vector comprises: the expression cassette of epsp synthase gene, homologous recombination fragment atpB and rbcL in the rice chloroplast genome; Wherein, the expression cassette of epsp synthase gene is between homologous recombination fragment atpB and rbcL.
Described epsp synthase gene is that publication number is the gene of the coding EPSP synthase described in the CN101429499 A (denomination of invention: the EPSP synthase and the encoding sequence thereof of glyphosate highly-tolerant), and this gene order has been all open in the patent of invention of CN101429499A (annotate: epsp synthase gene is SEQID NO:2 or the nucleotide sequence shown in the SEQID NO:3 in the sequence table in the patent publication of CN101429499A) at publication number.
The expression cassette of described epsp synthase gene is made up of promotor, epsp synthase gene and terminator; Wherein, described promotor is the rice chloroplast specific promoter, for example, can be promotors such as prrn, atpA, atpB, psbA, psbD or rbcL, and preferred, described promotor is the psbA promotor; In order to improve psbA promotor and ribosomal binding ability; The present invention is with one section 3 ' end that contains sequence (GGGAGG) the introducing psbA promotor of SD sequence; Obtain nucleotides sequence and classify the promotor shown in the SEQ ID No.1 as, can effectively improve the translation skill of downstream gene; Described terminator is preferably the rbcL terminator, and its nucleotides sequence is classified as shown in the SEQID NO:2.
Under the exercisable regulation and control that place said rice chloroplast specific promoter and terminator of epsp synthase gene, promptly obtain the expression cassette of described epsp synthase gene.
The nucleotides sequence of described homologous recombination fragment atpB is classified as shown in the SEQ ID No.3;
The nucleotides sequence of described homologous recombination fragment rbcL is classified as shown in the SEQ ID No.4.
In order to reach better effect, also can contain dominant selectable marker expression of gene box in the described epsp synthase gene rice chloroplast expression vector; This dominant selectable marker gene is preferably the antibiotic resistance genes of bacterial origin, and more preferably anti-hygromycin gene, its nucleotides sequence are classified as shown in the SEQ ID NO:5.
Another aspect of the present invention has provided a kind of method that makes up said epsp synthase gene rice chloroplast expression vector, and this method may further comprise the steps:
(1), be connected with terminator with the rice chloroplast specific promoter epsp synthase gene is exercisable, epsp synthase gene is placed under the regulation and control of rice chloroplast specific promoter and terminator, obtain the expression cassette of epsp synthase gene;
(2), with homologous recombination fragment atpB in the rice chloroplast genome and the exercisable respectively both sides that are connected the expression cassette of epsp synthase gene of rbcL, promptly get.
Further; The invention provides an a kind of preferred embodiment that makes up epsp synthase gene rice chloroplast expression vector; Comprise: epsp synthase gene is cloned between the HindIII and XbaI of pSK-PpsbA-T carrier, makes the epsp synthase gene fragment place the expression cassette that obtains epsp synthase gene under rice chloroplast gene specific promotor PpsbA and the regulation and control of rbcL terminator; Anti-Totomycin expression cassette is inserted into make up between Sal I and the KPn I of expression cassette of epsp synthase gene and obtains the plasmid formed by epsp synthase gene expression cassette and anti-hygromycin gene expression cassette; Again this plasmid clone is gone into to contain the pBR plasmid Bgl II site of homologous recombination fragment atpB-rbcL, make up and obtain epsp synthase gene rice chloroplast expression vector.
Further, the present invention is with constructed epsp synthase gene rice chloroplast expression vector rice transformation callus or cell, to improve the glyphosate resistance of paddy rice.
For reaching above-mentioned purpose, can be with the epsp synthase gene rice chloroplast expression vector rice transformation that makes up, screening obtains callus, cell or the protoplastis of paddy rice resistance glyphosate; (3) induction of resistance callus or cytodifferentiation, regeneration obtains the resistant plant of paddy rice resistance glyphosate, promptly gets.
Said " conversion " is that epsp synthase gene is imported to rice callus tissue or cell, adopts the conventional cell or tissue cultural method in this area again, induces the rice callus tissue or the cell regeneration of conversion to obtain whole plant.Described " conversion " method comprises: microinjection, electroporation, agriculture bacillus mediated conversion, particle bombardment and bombardment of high speed trajectory etc. are preferably particle bombardment.Cell transformed regeneration obtains stable transformed plant (McCormick et al.Plant Cell Reports.1986.5:81-84) to utilize ordinary method can make.
It is fine that described rice strain is preferably Japan.
The present invention adopts the dna homolog recombinant technology; The epsp synthase gene that derives from pseudomonas stanieri is building up to the expression cassette that is driven by rice chloroplast specific promoter PpsbA and the combination of rbcL terminator; Utilize atpB-rbcL in the rice chloroplast genome as homologous fragment; Homologous recombination taking place, import in the rice chloroplast through the particle gun conversion method, detects through the PCR molecular biology method; The expression of in rice chloroplast, succeeding of the final transgenic paddy rice that obtains, epsp synthase gene.Confirm that through test the transfer-gen plant that is obtained has good glyphosate resistance.
The present invention utilizes the rice chloroplast expression system to obtain the resistance glyphosate transgenic paddy rice, has the following advantages: the first, and rice chloroplast is expression alien gene efficiently, and plant can obtain good resistance; The second, biological safety is high, because chloroplast(id) is a matrilinear inheritance, the possibility of producer drift is extremely low; The 3rd, foreign gene ability site-directed integration is on the rice chloroplast genome; The 4th, but foreign gene stably express in the offspring; The 5th, the rice chloroplast genome has characteristics such as molecular weight is little, simple in structure, debond histone and helps realizing molecule manipulation.
The present invention adopts the rice chloroplast expression system to obtain the resistance glyphosate transgenic paddy rice, and the transgenic paddy rice of acquisition has good glyphosate resistance.The transgenic paddy rice that the present invention obtains transforms with protokaryon and compares: the foreign gene fixed point is inserted in the rice chloroplast genome, and no proterties is separated, and is easy to detect the time-saving and efficiency; Foreign gene is expressed in chloroplast(id) efficiently, obtains transfer-gen plant and has good resistance; Biological safety is high, and the possibility that drift takes place foreign gene is extremely low.In general, the present invention can improve the glyphosate resistance of transgenic paddy rice to a great extent, has plurality of advantages such as biological safety height, time-saving and efficiency, less energy consumption, cost be low.
Description of drawings
Fig. 1 changes epsp synthase gene paddy rice PCR detected result; M:DL2000; 1,2,3: transfer-gen plant; The contrast of 4 wild-types.
The PCR detected result of Fig. 2 chloroplast transgenic paddy rice degree of homogenization; M:DL2000; 1: the wild-type contrast; 2,3,4,5: the transgenic sample.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.But these embodiment only are exemplary, scope of the present invention are not constituted any restriction.It will be understood by those skilled in the art that and down can make amendment with form or replace without departing from the spirit and scope of the present invention, but these modifications and replacing all fall in protection scope of the present invention the details of technical scheme of the present invention.
Experiment material:
1.E.coif TOP10 is available from Promega company; The fine spring and summer of paddy rice Japan is planted in experiment base, the Chinese Academy of Agricultural Sciences Langfang, and winter planting is (for example the Chinese Academy of Agricultural Sciences Hainan Island experiment base) in south.
2. enzyme and reagent: various restriction enzymes, T
4Dna ligase, the big fragment of Klenow and supporting damping fluid thereof are available from Promega company;
3. substratum: the intestinal bacteria substratum be LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0); Plant culture is N6 and MS substratum;
The evaluation of the acquisition of embodiment 1, epsp synthase gene, the structure of expression vector and conversion, transgenic paddy rice
The genomic extraction of 1 rice chloroplast:
(1) the 5-10g rice leaf is removed vein, blade is shredded liquid nitrogen grinding;
(2) add 4 ℃ of preparatory ice-cold buffer A of 5 times of volumes (buffer A:50mM Tris-HCl, 20mM EDTA, 0.5M sucrose, 0.25M Vc, pH3.5), homogenate is filtrated to the 50mL centrifuge tube of precooling with 8 layers of hospital gauze, abandons residue.
(3) filtrating 1500g/min, 15min is centrifugal, abandons supernatant, stays deposition.
(4) in deposition, add 3mL bufferA, fully suspend, change in the 10mL centrifuge tube.
(5) 2000g/min, 15min is centrifugal, abandons supernatant, collecting precipitation.
(6) add 2mL bufferB, fully suspend (buffer B:50mM Tris-HCl, 20mM EDTA, 0.5M sucrose, 1%BSA, 7mM beta-mercaptoethanol are at present with add at present).
(7) 1500g/min, centrifugal 10min abandons supernatant, and collecting precipitation is washed once with bufferB again.
(8) the same centrifugal, abandon supernatant, add bufferC again and wash once, centrifugal, the deposition major part is chloroplast(id) (buffer C:50mM Tris-HCl pH8.0,20mM EDTA, a 0.5M sucrose).
(9) the chloroplast(id) deposition is suspended among the 3mL bufferD (50mM Tris-HCl, 20mM EDTA), adds 2mL lysate (50mM Tris-HCl; 20mM EDTA; 10%N-lauroylsarcosine), behind the 37 insulation 15min, add Proteinase K to 100 μ g/mL and continue 37 ℃ of insulation 4h.
(10) with equal-volume phenol/chloroform extracting, add 3M NaAC to 0.3M, the absolute ethyl alcohol of two volumes ,-20 ℃ of depositions are spent the night.
(11) centrifugal, deposition is cool to half-dried, is dissolved among the 50 μ LTER (being added with the TE of RNase).
The clone of 2EPSP synthase gene and the structure of expression vector
2.1 the acquisition of goal gene
According to known epsp synthase gene sequence, design primer respectively, and introduce HindIII site and XbaI site respectively, two pairs of primers are following:
A?15FP?1：GAAGCTTATGCATTCCAATGACCTCG HindIII
A?15RP?1：GTCTAGATCATGAGGCGCCCTC XbaI
In 0.5mL eppendorf pipe, add following reagent:
The PCR response procedures is following:
2.2 the clone of anti-hygromycin gene (HPT)
According to plasmid pSELECT-hygro-mcs (InvivoGen, article No.: HPT gene order design primer pseth-mcs), and introduce HindIII site and XbaI site respectively, two pairs of primers are following:
HPTFP：C
AAGCTTATGAAAAAGCCTGAACTCACC HindIII
HPTRP：C
TCTAGACTACTCTATTCCTTTGCCCTC XbaI
The PCR program is with the PCR program of above-mentioned step 2.1.
2.3 the recovery of product
Carry out electrophoresis with ordinary gel, downcut required DNA band, put into the Eppendorf pipe after weighing, add the 6mol/L NaI solution of 3 times of volumes (v/w); Under 37 ℃ gel is fully dissolved, add 10 μ L glass milk adsorption of DNA again, room temperature held 5min, centrifugal slightly 5s; Remove supernatant, deposition is washed once with New Wash washing lotion, repeated centrifugation, washing three times; Dry the back with 30 μ L, 0.1 * TE Buffer dissolving DNA, get supernatant after centrifugal, DNA is stored in-20 ℃ subsequent use.
2.4T the ligation of carrier
Behind PCR product 2.5 μ L, pMD18-T 0.5 μ L and the soul I 3 μ L mixings that reclaim, 16 ℃ of reaction 2h.
2.5 the conversion of DNA or connection product
Get-70 ℃ of frozen competent cells, with the hands rub with the hands to most of the thawing and put on ice rapidly.Competent cell melts the back fully and adds DNA 20～100ng or connect mixture 5 μ L, mixing gently, ice bath 30min.42 ℃ of heat shock 90sec put 1～2min on ice rapidly.Add 1mL LB substratum, 37 ℃ of vibrations (≤150rpm) cultivation 1h.4, the centrifugal 5min of 000g goes behind the part supernatant (staying 150～200 μ L) to coat and contains on the suitable antibiotic LB flat board.Be inverted overnight cultures for 37 ℃.
2.6 alkaline lysis method of extracting plasmid DNA
2.7 the evaluation of recon
Enzyme is cut evaluation: extracting DNA at first in a small amount, and utilize HindIII and XbaI to carry out endonuclease reaction then, the plasmid of the DNA band of the about 1.3kb of appearance is recombinant plasmid T-A15N behind the electrophoresis.T-A15N checks order with recombinant plasmid.Sequencing result is consistent with expected results.
The structure of 3 rice chloroplast conversion carriers
3.1 the acquisition of homologous fragment
It is following to design primer respectively according to known rice chloroplast genome sequence:
AtpBFP2：CTCTAGACTCTTGCTACAGTTAAACGATCC (XbaI)
AtpBRP：C
AAGCTTAG
ATCTTAATAGTACCCCCTTTTCT (HindIII，BglII)
RbcLFP：CAGA
TCTTAATAAGGATTAGAAGTTGAT (Bgl?II)
RbcLRP：CGTCGACCTAGCTATCTAGTTTATCTAC (Sal?I)
In 0.5mL eppendorf pipe, add following reagent:
The PCR response procedures is following:
Reclaim the correct pcr amplified fragment of size, will above-mentioned two gene fragment atpB and rbcL be connected respectively to evaluations of checking order of T carrier, result and expect in full accord.
3.2 the structure of homologous vector
With the T carrier of the atpB gene fragment of HindIII and BglII enzyme cutting clone, reclaim the fragment of 1.69kb, with this fragment cloning to carrier pBluescript SK (Biovector Co., LTD; Article No.: between HindIII Biovector008) and the XbaI site, carrier construction pSK-atpB.Then with the T carrier of BglII and XbaI enzyme cutting clone's rbcL gene fragment; Reclaim the dna fragmentation of 1.8kb; This fragment cloning between the BglII and Sal I site of carrier pSK-atpB, is obtained to contain the carrier pBR of rice chloroplast homologous fragment atpB-rbcL gene fragment.
3.3 the clone of rice chloroplast psbA promotor and rbcL terminator
This experiment improves one section 3 ' end that contains base sequence (GGGAGG) the introducing psbA promotor of SD sequence psbA promotor and ribosomal binding ability, thereby improves the translation skill of downstream gene.
According to the rice chloroplast gene order, the design primer is following:
PpsbAFP：CGTCGACGACTTCCTCTTCGGAATAGAAATAG Sal?I
PpsbARP：GCTAATTTTATCCACTTAGTTCTAGAGATCTGAAGCTTCCCTCCCGGTAAGATCTTGG XbaI HindIII
TrbcLFP：GCCAAGATCTTACCGGGAGGGAAGCTTCAGATCTCTAGAACTAAGTGGATAAAATTAG HindIII Xba?I
TrbcLRP：CGGATCCGTGGAATAGAATAACCCGGTTAAAGGG BamH?I
In 0.5mL eppendorf pipe, add following reagent:
The PCR response procedures is following:
With pfu enzyme increase respectively PpsbA and two sections sequences of rbcL terminator, be template with these two sections sequences, utilize PpsbAFP, TrbcLRP to be primer, carry out pcr amplification.Reclaim the correct pcr amplified fragment of size, be connected to evaluations of checking order of pMD18Tsimple carrier, the result with expect in full accord.
3.4 the structure of destination gene expression box
3.4.1 the insertion of goal gene
Cut the correct positive recombinant plasmid T-A15N of order-checking with HindIII, Xba I enzyme, reclaim the enzyme of about 1.3kb and cut product.The goal gene that reclaims is connected under rice chloroplast specific promoter PpsbA and the terminator rbcL regulation and control, obtains plasmid T-PpsbA-A15N-T; With SalI, BamH I digested plasmid T-PpsbA-A15N-T, reclaim the fragment of about 2.1kb, the recovery fragment is connected to Sal I, the BamH I site of pSK, construct the pSK-PpsbA-A15N-T carrier.
3.4.2 the structure of selection markers expression cassette
The goal gene (HPT) of the anti-Totomycin that will clone with HindIII, Xba I is inserted into the chloroplast gene expression cassette that constructs anti-Totomycin between genomic psbA promotor of rice chloroplast and the rbcL terminator.Design primer PCR amplification Totomycin expression cassette, the restriction enzyme site at change Totomycin expression cassette two ends reclaims the purpose fragment and is connected on the pMD18T carrier and checks order, and sequencing result is correct.
Design of primers is following:
PcoreFP：C
GTCGACGACTTCCTCTTCGGAATAGAAATAG Sal?I
PcoreRP：C
GGTACCGGATCCGTGGAATAGAATAACCCGGTTAAAG
Kpn?I BamH?I
3.4.3 the structure of rice chloroplast expression vector
Cut the anti-Totomycin expression cassette that is structured in above-mentioned pMD18T carrier with Sal I, Kpn I enzyme, reclaim the purpose fragment of about 1.6kb, the purpose fragment of recovery is connected to Sal I, the KpnI site of pSK-PpsbA-A15N-T, construct the pSK-PTN-hpt carrier.Carrying out enzyme with BamHI again cuts; Recovery contains about 3.9kbDNA fragment of the expression cassette of epsp synthase gene and hygromycin gene; It is cloned into the pBR plasmid BglII site with homologous recombination fragment aptB-rbcL, is built into rice chloroplast expression vector pBR-PTN-hpt with epsp synthase gene expression cassette.
4. the rice callus tissue induces
(1) rice varieties " Japan is fine " is seeded in by stages and plants in the base, Hainan Island in Langfang or winter summer, gather in the crops sophisticated seed.
(2), on super clean bench,, with 10% Youxiaolin sterilization 20-30min, wash 3 times with high-temperature sterilization, at every turn about 10min more earlier with 70% alcohol disinfecting 2min with the shell back sterilization of sophisticated seed.Seed after the sterilization is placed on the filter paper of sterilization blots excessive moisture, take out rataria, evenly be inoculated on the inducing culture 20-30 seed of every petridish inoculation.28 ℃ of dark cultivations about 1 week are removed bud, and through 2-3 week, callus produces gradually.Isolate callus, succeeding transfer culture on same substratum.
5. particle gun transforms
5.1 the preparation of recipient cell
(1) callus
Get eugonic embryo callus, be combined into the fritter that diameter is 3-4mm, the N6 height that is seeded in petridish oozes in the central authorities of substratum (0.2mol/L N.F,USP MANNITOL and 0.2mol/L sorbyl alcohol), and bombardment transforms behind the 4h.
5.2 the preparation of particulate bullet (DNA coated microprojectiles)
The bronze (Bio-Rad) of claiming 60mg 1.0 μ m is in 1.5mL Eppendorf pipe; Add the 1mL absolute ethyl alcohol, fully vortex (vortex) leaves standstill 10min then, and 10, the centrifugal 10sec of 000rpm; The careful supernatant of removing adds the 1mL sterilized water, abundant vortex, and 10, the centrifugal 10sec of 000rpm abandons supernatant; Repeat with sterilized water washing 2 times; With the aseptic resuspended bronze particle of 50% (v/v) glycerine of 1mL.Bronze after the processing can be-20 ℃ of prolonged preservation; Get that 50 μ L are above-mentioned to prepare and the bronze particle of vortex, change in the aseptic 1.5mL eppendorf pipe, be sequentially added into 5 μ L DNA (1 μ g/ μ L), 50 μ L 2.5mol/L CaCl
2With 20 μ L 0.1mol/L spermidines (Free base joins existing usefulness) at present; With mixture vortex 1min, place 1min on ice; Repeat 10 times; Place on ice more than the 30min; 15, the centrifugal 5sec of 000rpm removes supernatant; The bronze particle that encapsulates with 250 μ L absolute ethanol washings 2 times, 10, the centrifugal 10sec of 000rpm removes supernatant; The resuspended bronze particle of 60 μ L absolute ethyl alcohols.
5.3 equipment particle gun
(1) preparation of particle gun
Particle gun is positioned on the Bechtop of big model, opens more than the super clean bench uv lamp sterilization 30min; Clean particle gun Vakuumkammer and various element with 70% alcohol; Can split film (Rupture disk 1 with the soaking disinfection method; 100psi), carrier film (Macrocarrier), stop net (Stopping screen) and the Macrocarrier holders 15min that in absolute ethyl alcohol, sterilizes; Then Rupture disk and Macrocarrier are placed on the aseptic filter paper, in super clean bench, dry up; Clamp Macrocarrier holder with tweezers, on spirit lamp flame, pause calcination and be placed on the aseptic filter paper; After treating Macrocarrier holder cooling, Macrocarrier is placed in one and flattens with tweezers.Get the bronze particle absolute ethyl alcohol suspension-s that 10 μ L encapsulate DNA, put, in Bechtop, dry up in the Macrocarrier central position; Turn on the power switch, vacuum pump and helium tank valve; Take out Macrocarrier launch assembly, twist the lid off, Stopping screen calcination on spirit lamp flame is placed in the groove, Macrocarrier holder back-off on groove, the lid of screwing; Rupture disk is loaded in the fixed cap and screws; The Macrocarrier launch assembly that assembles is placed last several second grid of particle gun Vakuumkammer; The petridish that the MS substratum is housed is placed Target shelf center, and Target shelf is placed last several the 4th grid of Vakuumkammer, making target distance is 9cm; Fasten the Vakuumkammer wicket.
(2) bombardment
Vacuumize: press the VAC key, when vacuum tightness reaches 25～28inches Hg, the VAC key directly is locked in the HOLD position; Bombardment: pin the FIRE key, until Rupture disk explosion; Press the VENT key again, make the vacuum meter pointer return zero.Open the Vakuumkammer wicket, take out sample.Usually each sample bombardment is 2 times.
6. the screening of transgenic paddy rice callus
(1) transition is cultivated
Place the N6 subculture medium that contains permeate agent (0.2mol/L N.F,USP MANNITOL and 0.2mol/L sorbyl alcohol) continue to handle 16h in the sample after the bombardment, changed in the N6 subculture medium that does not contain any other composition the transition cultivation then over to 5～7 days.Transition is cultivated and is helped being bombarded the recovery of cell and giving full expression to of foreign gene.
(2) screening and culturing
Kanamycin-resistant callus tissue screening is transferred to transformation receptor and is selected to screen on the substratum, selects to press to be Totomycin (50mg/L), and the screening cycle is 4 months, and every to take turns screening be about 3 weeks.Each subculture is all eliminated brown and is hygrophanous callus, and is cut into the 2-3 piece to the normal callus of growth, is close to media surface and cultivates.
(3) regeneration of plant
The kanamycin-resistant callus tissue of screening is transferred on the N6 substratum (Totomycin 50mg/L), and illumination cultivation (14h illumination, 10h is dark) is cultivated and about 2 weeks is differentiated plant.
(4) seedling hardening is long to about 2cm when the regeneration seedling, and when 2-3 sheet leaf and main root are arranged, seedling is transferred in triangular flask or the culture tube, and is all at indoor cultivation 1-2.Seedling stem further elongation increases slightly, and the number of blade increases, and stretches.
(5) regrowth is transplanted seedling is carefully taken out from triangular flask or culture tube, washes down substratum with tap water, cuts off dead leaf and brown root shape thing, transplants in the small flower of nutrition soil and vermiculite (1: 2), and the outer cover plastic film is preserved moisture a week.When seedling grows 1-2 sheet young leaves again in small flower divides, but balled transplanting is in the big flowerpot in greenhouse or in the greenhouse.
7. the detection of transgenic paddy rice
7.1 the extraction of Rice Chloroplast DNA (process for extracting of Rice Chloroplast DNA is with the genomic extraction of above-mentioned rice chloroplast)
7.2 transgenic paddy rice PCR detects
(1) PCR of transgenic paddy rice EPSPS synthase gene detects
Primer is following:
A?15FP：ATGCATTCCAATGACCTCGTTTTCC
A?15RP：TCATGAGGCGCCCTCCGCCTGAACC
The PCR reaction system is as follows:
The PCR response procedures is:
Get 8 μ LPCR products and be splined on electrophoresis on 1% sepharose, amplification obtains and the big or small on all four fragment of expection respectively in the DNA of transgenic paddy rice, in the wild-type paddy rice, does not then have corresponding band (Fig. 1) to occur.
(2) PCR of the chloroplast transgenic EPSPS synthase gene paddy rice degree of homogenization detects
The upstream and downstream primer that PCR detects is following:
BRFP：GTCAGTGTCTCGACTCTTGACTACC
BRRP：CCCTGTGTACATTCTATGCTATAGG
With the transgenic paddy rice chloroplast DNA is template, carries out pcr amplification with LA Taq archaeal dna polymerase.The PCR reaction system is:
The PCR response procedures is:
The pcr amplification result: the total DNA cloning of the chloroplast(id) of transgenic paddy rice has gone out the band of a treaty 4.5kb and the band of a treaty 0.75kb; And the Rice Chloroplast DNA of wild-type only amplifies the band of a 0.75kb, and epsp synthase gene site-directed integration in the rice chloroplast genome (Fig. 2) is described.
7.3 the glyphosate resistance of transgenic paddy rice detects
Wild-type plant and the positive rice plant (transgenic paddy rice) that is screened are planted in (28 ℃ in greenhouse simultaneously; 16h illumination, 8h is dark) in, wherein; 30 strains of wild-type rice plant; Positive rice plant 30 strains, wild-type rice plant and positive transgenic rice plant are in growing way, basic identical on vegetative period, and the two is identical on illumination, temperature, humidity, soil and other cultivation management; When plant grows 5-6 sheet leaf, spray 3% (w/v) Glyphosate 62 IPA Salt solution simultaneously, spray once weekly.After one week, a large amount of yellow spottings appears in wild-type rice plant blade, and blade tip and edge begin to wither, and the transgenic rice plant growth is normal basically.After two weeks, most of blade of wild-type rice plant is withered, root and stem's blackening, and the blade of transgenic rice plant is normal basically, has only the slightly withered phenomenon of blade tip and limb edge.
8. the content of EPSPS synthase and enzyme activity determination in the transgenic rice plant
8.1.1 proteic quantitative analysis
It is quantitative that employing BCA method protein quantification test kit carries out the EPSPS synthase protein;
The composition of test kit: protein standard (5mg/ml BSA), BCA Solution A and BCA Solution B;
8.1.2 proteic quantitative analysis principle brief introduction
Quantification of protein is one of element task of protein research.BCA (bicinchoninic acid) is an ideal quantification of protein method.Under the alkaline condition, albumen is with Cu
2+Be reduced to Cu
+, Cu
+With the complex compound of BCA reagent formation purple, measure its absorption value, and contrast with typical curve at the 562nm place, can calculate the concentration of testing protein.The BCA method is measured the influence that protein concentration does not receive the chemical substance in most samples.In histocyte cracking experiment, the washing agent SDS of lower concentration, Triton X-100, Tween do not influence detected result, but sequestrant (EDTA, EGTA), reductive agent (DTT, mercaptoethanol) and lipid can have certain influence to detected result.
8.1.3 measuring method
1. prepare working fluid:, add an amount of BCA working fluid of 1 volume BCA Solution B (50: 1) preparation, fully mixing by 50 volume BCA Solution A according to standard substance and sample size.Stable in the BCA working fluid room temperature 24h;
2. dilution standard article: get 10 μ l standard substance and be diluted to 100 μ l (the general available PBS dilution of standard substance) with PBS, making final concentration is 0.5mg/ml.Standard substance are added in the protein standard substance hole of 96 orifice plates by 0 μ l, 1 μ l, 2 μ l, 4 μ l, 8 μ l, 12 μ l, 16 μ l, 20 μ l, add PBS and supply 20 μ l;
3. add proper volume sample (the solubility total protein of transgenic rice plant) in the sample well of 96 orifice plates, add PBS to 20 μ l;
4. each hole adds 200 μ l BCA working fluids, places 30min for 37 ℃;
5. cool to room temperature is measured A562 with ELIASA, calculates protein concentration according to typical curve.
Mensuration result shows that the solubility total protein content of transgenic rice plant blade is 11.8 ± 0.29mg/g.
8.2EPSPS enzyme kinetic analysis
8.2.1 the foundation of inorganic phosphorus typical curve
10mM inorganic phosphorus reference liquid (stoste, 1: 5 diluent and 1: 10 diluent); Get 0 μ l, 1 μ l, 2 μ l, 3 μ l, 20 μ l respectively in 1.5ml Eppendorf centrifuge tube; Add milli-Q water to 100 μ l mixing, add MAT solution 0.8ml mixing, add the rapid mixing of 34%SC solution 100 μ l behind the timing 3min; Room temperature is measured the OD660 value, triplicate after leaving standstill 20min.With the inorganic phosphorus concentration is X-coordinate, and the OD660 value is set up typical curve (Lanzetta, P.A. for the ordinate zou mapping; Alvarez; L.J., Reinach, P.S.; Et al..An improved assay for nanomole amounts of inorganic phosphate.Anal Biochem, 1979.100:95-97).
8.2.2 enzyme activity determination
Commentaries on classics epsp synthase gene rice plant extraction of the present invention is contained enzyme crude extract albumen; Adopt Xylene Brilliant Cyanine G G-250 staining to carry out enzyme activity determination (Brodford the total soluble protein that contains the enzyme crude extract that is extracted; M.M..A rapid and sensitive metod for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.Anal.Biochem., 1976.72:248-254).The preparation method of total soluble protein who contains the enzyme crude extract is following: 500 milligrams in water intaking rice blade; Liquid nitrogen grinding; Add 200 μ L1 * PBS and change in the 1.5mL centrifuge tube, centrifugal 5 minutes of 4000rpm gets supernatant; Again throw out is pressed the aforesaid operations step and repeat 2 times, merge the gained supernatant and promptly get blade solubility total protein.With carrying out determination of protein concentration as stated above after the dilution of blade solubility total protein.The measuring method that enzyme is lived is following: in 1.5mL Eppendorf centrifuge tube, add following solution on ice: 10mM PEP solution 2 μ L, 10mM S3P solution 2 μ L, 0.5M HEPES solution 2 μ L, 1mM (NH
4+)
6MO
7O
24.4H
2O solution 2 μ L and milli-Q water 12 μ L mixings; Bathe 5min in 28 ℃ of temperature; Each is managed sample room and added 1 μ L crude enzyme liquid and timing at a distance from 2 seconds; Add 200 μ LMAT solution behind the 2min more at interval in 2 seconds successively, added the rapid mixing of 20 μ L 34%SC solution successively in 2 seconds at interval again behind the colour developing 3min, measure the OD660 value behind the color development at room temperature 20min.Contrast except that not enzyme-added liquid, all the other same sample hoses.The OD of sample hose and control tube
660After value is subtracted each other; Contrast inorganic phosphorus typical curve can be tried to achieve the inorganic phosphorus molar weight that reaction discharges; Just obtain the enzyme activity (U/mg) of this enzyme again divided by reaction times and zymoprotein amount; According to quadrat method preparation, the solubility total protein concentration of measuring the wild-type plant leaf and enzyme work as background rejection, the enzyme activity that the result records the EPSP synthase in the commentaries on classics epsp synthase gene rice plant of the present invention is 2.434U/mg ± 0.246.
< 110>Biological Technology institute, Chinese Academy of Agricultural Sciences
< 120>epsp synthase gene rice chloroplast expression vector and application thereof
<130> DQXL-0026
<160> 5
<170> PatentIn?version?3.5
<210> 1
<211> 390
<212> DNA
<213> Oryza?sativa
<400> 1
gacttcctct?tcggaataga?aatagcctat?ttctacatag?ggaaagtcgt?gtgcaatgaa 60
aaatgcaagc?acgatttggg?gagaggtttt?ttctctattg?taacaaggaa?taattatcta 120
ctccatccga?ctagttccgg?gttcgagtcc?cgggcaaccc?atatggaaac?tagaaaggag 180
caatctgagt?tttgattttt?cactcacttc?atttacaaaa?ttttttggtt?tggtaaattt 240
tgttgtatgg?atatacaact?gtcggggctg?gcttggttga?cattggtata?tagtctatat 300
tatactgtta?aataacaagc?cttctattat?ctttctagtt?aatacgtgtg?cttgggagtc 360
cttgcaattt?gaataaacca?agatcttacc 390
<210> 2
<211> 389
<212> DNA
<213> Oryza?sativa
<400> 2
ggataaaatt?agatagaaaa?aaggtctaaa?taaaaaagaa?gagaaataga?aagatcaaaa 60
atcagttacg?aaaatgcagt?aattcttctt?ttttcttcta?attgattgca?attaaactcg 120
tctcaatctg?aaaaaagatt?gagccgagtt?taaatagatt?ttgatacgat?catgagactt 180
gacaaatcgg?gattcctcta?ttctatatat?ttagaagata?taaaggtata?atacaataaa 240
taaatacaaa?tagagtatta?tcatatgata?atggaatcaa?atacgcagta?tttacagaaa 300
aagttttcat?ttattgggaa?agaatcaatg?acatacaatg?cattacagac?gtatgatcat 360
taccctttaa?ccgggttatt?ctattccac 389
<210> 3
<211> 1680
<212> DNA
<213> Oryza?sativa
<400> 3
ctcttgctac?agttaaacga?tcctcctccg?ataattcatc?caacccaaga?attgcgataa 60
tgtcctgaag?ttctttgtaa?cgttgtaaag?tttgcttaac?tctttgcgca?gtttcataat 120
gttcgttgcc?aacgatccga?ggttgtaaca?tagttgaggt?tgaatctaaa?ggatctactg 180
caggataaat?ccctttggaa?gctaatcctc?tggaaagtac?ggtagtagca?tccaaatgtg 240
caaatgttgt?agcaggagca?gggtcggtca?aatcgtccgc?aggtacataa?accgcttgga 300
tcgaagttat?agatcccttt?ttagtagaag?taattctttc?ttgcaaagaa?cccatttctg 360
tactaagagt?aggttgataa?cccactgcag?agggcattct?ccctaataag?gcagatacct 420
ccgatcctgc?ttgaacaaaa?cgaaagatat?tatcgatgaa?tagaagcacg?tcttgcttat 480
taacatctcg?gaaatattct?gccatagtta?gggcagtcaa?accaactctc?atacgagctc 540
ctggcggttc?attcatttgg?ccatagacta?gagctacctt?tgattcctca?agattttttt 600
cattaattac?tccagattcc?ttcatttcca?tataaagatc?atttccttca?cgagtccgtt 660
cccctactcc?gccaaatacg?gatacgcccc?cgtgagcttt?agcaatattg?ttgattaatt 720
ccatgatgag?tactgtttta?cctactccag?ctcccccaaa?tagtccgatt?tttcctccac 780
gccgataagg?agctaaaaga?tcgaccacct?taataccagt?ttcaaagatg?gataatttcg 840
tatctaactc?gataaaggcg?ggcgcggatc?tatgaatagg?gaatgttgca?ctagtatcta 900
caggacccaa?attgtcaaca?ggctccccaa?gaacgttgaa?aattcgtcca?agagtagctc 960
caccgacagg?aacactgaga?ggagctcccg?tgtcaatcac?ttccattcct?ctcatcaacc 1020
catctgtagc?actcatagct?acagctctaa?ctcgattatt?tcctaataat?tgttgtacct 1080
cacaagttac?attaatttgc?ttaccgtcag?tgtctcgact?cttgactacc?aaagcattat 1140
aaatataagg?taacttgccc?cggggaaaag?tgacatccag?cacgggtcca?ataatttgat 1200
cgatacgccc?tgtacttttt?tcttcaattg?tagaaacccc?gggacgagaa?gtagtaggat 1260
tggttctcat?aattatcaca?taattttcaa?aaaaaaggaa?tttatcgaaa?ttttgatttt 1320
tttcttgttg?aataatgcca?aatcaacacc?aaaaaaaata?tccaaaaatc?caaaagtcaa 1380
aaggaaatga?attagttaat?tcaataagag?agaaaagggg?accagcactt?gatttcgttg 1440
cccaaacgaa?tcccattcaa?tcgtttactc?atggaatgag?cccgtcggaa?agttcaatca 1500
atcttttttt?catatacatt?ttgccttttg?taaacgattt?gtgcctactc?tactttctta 1560
tctaggactt?cgatatacaa?aatatatact?actgtgaagc?atagattgct?gtcaacagag 1620
aattttcgta?tatttaggta?tttccactca?aaataagaaa?agggggtact?attaagaact 1680
<210> 4
<211> 1808
<212> DNA
<213> Oryza?sativa
<400> 4
taataaggat?tagaagttga?tttggggttg?cgctatatct?attaaagagt?atacaataaa 60
gatggatttg?gtgaatcaaa?tccatggttt?aataatcgaa?gcatgttgac?ttacaataac 120
aacaactcaa?gtcttatgaa?ttcctatagc?atagaatgta?cacagggtgt?acccattata 180
tatgaatgaa?acatattata?tgaatgaaac?atattcatta?acttaagcat?gccccccatt 240
ttctttaatg?agttgatatt?aattgaatat?ctttttttta?agatttttgc?aaaggtttca 300
tttacgccta?atccatatcg?agtagaccct?gtcgttgtga?gaattcttaa?ttcatgagtt 360
gtagggaggg?acgtatgtca?ccacaaacag?aaactaaagc?aagtgttgga?tttaaagctg 420
gtgttaagga?ttataaattg?acttactaca?ccccggagta?cgaaaccaag?gacactgata 480
tcttggcagc?attccgagta?actcctcagc?cgggggttcc?gcccgaagaa?gcaggggctg 540
cagtagctgc?cgaatcttct?actggtacat?ggacaactgt?ttggactgat?ggacttacca 600
gtcttgatcg?ttacaaaggc?cgatgctatc?acatcgagcc?cgttgttggg?gaggataatc 660
aatatatcgc?ttatgtagct?tatccattag?acctatttga?agagggttct?gttactaaca 720
tgtttacttc?cattgtgggt?aacgtatttg?gtttcaaagc?cctacgcgct?ctacgtctgg 780
aggatctgcg?aattccccct?acttattcaa?aaactttcca?aggtccgcct?catggtatcc 840
aagttgaaag?ggataagttg?aacaaatacg?gtcgtccttt?attgggatgt?actattaaac 900
caaaattggg?attatctgca?aaaaattatg?gtagagcatg?ttatgagtgt?ctacgcggtg 960
gacttgattt?taccaaagat?gatgaaaacg?taaactcaca?accatttatg?cgttggaggg 1020
accgttttgt?cttttgtgcc?gaagctattt?ataaatcaca?ggccgaaacc?ggtgaaatta 1080
aggggcatta?cttgaatgcg?actgcaggta?catgcgaaga?aatgattaaa?agagctgtat 1140
ttgcgaggga?attaggggtt?cctattgtaa?tgcatgacta?cttaaccggg?gggttcaccg 1200
caaatactag?tttggctcat?tattgccgcg?acaacggcct?acttcttcac?attcaccgag 1260
caatgcatgc?agttattgat?agacagaaaa?atcatggtat?gcatttccgt?gtattagcta 1320
aagcattgcg?tatgtctggg?ggagatcata?tccacgctgg?tacagtagta?ggtaagttag 1380
aaggggaacg?cgaaatgact?ttaggttttg?ttgatttatt?gcgcgatgat?tttattgaaa 1440
aagatcgtgc?tcgcggtatc?tttttcactc?aggactgggt?atccatgcca?ggtgttatac 1500
cggtggcttc?agggggtatt?catgtttggc?atatgccagc?tctgaccgaa?atctttggag 1560
atgattctgt?attgcaattt?ggtggaggaa?ctttaggaca?tccttggggt?aatgcacctg 1620
gtgcagcagc?taatcgggtg?gctttagaag?cctgtgtaca?agctcgtaac?gaagggcgcg 1680
atcttgctcg?tgaaggtaat?gaaattatcc?gatcagcttg?caaatggagt?cctgaactag 1740
ccgcagcttg?tgaaatatgg?aaagcgatca?aattcgagtt?cgagccggta?gataaactag 1800
atagctag 1808
<210> 5
<211> 1026
<212> DNA
<213> PHT
<400> 5
atgaaaaagc?ctgaactcac?cgcgacgtct?gtcgagaagt?ttctgatcga?aaagttcgac 60
agcgtctccg?acctgatgca?gctctcggag?ggcgaagaat?ctcgtgcttt?cagcttcgat 120
gtaggagggc?gtggatatgt?cctgcgggta?aatagctgcg?ccgatggttt?ctacaaagat 180
cgttatgttt?atcggcactt?tgcatcggcc?gcgctcccga?ttccggaagt?gcttgacatt 240
ggggagttta?gcgagagcct?gacctattgc?atctcccgcc?gtgcacaggg?tgtcacgttg 300
caagacctgc?ctgaaaccga?actgcccgct?gttctacaac?cggtcgcgga?ggctatggat 360
gcgatcgctg?cggccgatct?tagccagacg?agcgggttcg?gcccattcgg?accgcaagga 420
atcggtcaat?acactacatg?gcgtgatttc?atatgcgcga?ttgctgatcc?ccatgtgtat 480
cactggcaaa?ctgtgatgga?cgacaccgtc?agtgcgtccg?tcgcgcaggc?tctcgatgag 540
ctgatgcttt?gggccgagga?ctgccccgaa?gtccggcacc?tcgtgcacgc?ggatttcggc 600
tccaacaatg?tcctgacgga?caatggccgc?ataacagcgg?tcattgactg?gagcgaggcg 660
atgttcgggg?attcccaata?cgaggtcgcc?aacatcttct?tctggaggcc?gtggttggct 720
tgtatggagc?agcagacgcg?ctacttcgag?cggaggcatc?cggagcttgc?aggatcgcca 780
cgactccggg?cgtatatgct?ccgcattggt?cttgaccaac?tctatcagag?cttggttgac 840
ggcaatttcg?atgatgcagc?ttgggcgcag?ggtcgatgcg?acgcaatcgt?ccgatccgga 900
gccgggactg?tcgggcgtac?acaaatcgcc?cgcagaagcg?cggccgtctg?gaccgatggc 960
tgtgtagaag?tactcgccga?tagtggaaac?cgacgcccca?gcactcgtcc?gagggcaaag 1020
aaatag 1026
Claims (10)
1. 5-enol form acetone shikimic acid-3-phosphate synthase gene rice chloroplast expression vector; It is characterized in that; Comprise: the expression cassette of 5-enol form acetone shikimic acid-3-phosphate synthase gene, rice chloroplast genomic homologous recombination fragment atpB and rbcL; Wherein, the expression cassette of 5-enol form acetone shikimic acid-3-phosphate synthase gene is between homologous recombination fragment atpB and rbcL.
2. according to the described 5-enol form acetone shikimic acid of claim 1-3-phosphate synthase gene rice chloroplast expression vector, it is characterized in that: the expression cassette of described 5-enol form acetone shikimic acid-3-phosphate synthase gene is made up of rice chloroplast promotor, 5-enol form acetone shikimic acid-3-phosphate synthase gene and terminator.
3. according to the described 5-enol form acetone shikimic acid of claim 2-3-phosphate synthase gene rice chloroplast expression vector, it is characterized in that: described rice chloroplast promotor comprises
Prrn,
AtpA,
AtpB,
PsbA,
PsbDOr
RbcLDescribed terminator does
RbcLTerminator.
4. according to according to the described 5-enol form acetone shikimic acid of claim 3-3-phosphate synthase gene rice chloroplast expression vector, it is characterized in that: described
PsbAThe nucleotides sequence of promotor is classified as shown in the SEQ ID No.1; Said
RbcLThe nucleotides sequence of terminator is classified as shown in the SEQID NO:2.
5. according to the described 5-enol form acetone shikimic acid of claim 1-3-phosphate synthase gene rice chloroplast expression vector, it is characterized in that: the nucleotides sequence of described homologous recombination fragment atpB is classified as shown in the SEQ ID No.3; The nucleotides sequence of described homologous recombination fragment rbcL is classified as shown in the SEQ ID No.4.
6. according to the described 5-enol form acetone shikimic acid of claim 1-3-phosphate synthase gene rice chloroplast expression vector, it is characterized in that: also contain dominant selectable marker expression of gene box; Described dominant selectable marker gene is preferably the antibiotic resistance genes of bacterial origin; More preferably anti-hygromycin gene, its nucleotide sequence are SEQ ID NO.5.
7. the rice callus tissue, cell or the protoplastis that contain any one described 5-enol form acetone shikimic acid of claim 1-6-3-phosphate synthase gene rice chloroplast expression vector.
8. a method that makes up any one said 5-enol form acetone shikimic acid of claim 1-6-3-phosphate synthase gene rice chloroplast expression vector is characterized in that, may further comprise the steps:
(1), is connected with terminator with the rice chloroplast specific promoter 5-enol form acetone shikimic acid-3-phosphate synthase gene is exercisable; 5-enol form acetone shikimic acid-3-phosphate synthase gene is placed under the regulation and control of rice chloroplast specific promoter and terminator, obtain the expression cassette of 5-enol form acetone shikimic acid-3-phosphate synthase gene;
(2), with homologous recombination fragment atpB in the rice chloroplast genome and the exercisable respectively both sides that are connected the expression cassette of 5-enol form acetone shikimic acid-3-phosphate synthase gene of rbcL.
9. the application of any one said 5-enol form acetone shikimic acid of claim 1-6-3-phosphate synthase gene rice chloroplast expression vector in improving the paddy rice glyphosate resistance.
10. according to the described application of claim 9; It is characterized in that; Comprise: with described 5-enol form acetone shikimic acid-3-phosphate synthase gene rice chloroplast expression vector rice transformation callus, cell or protoplastis, screening obtains paddy rice resistant calli or cell; (3) inducing paddy rice resistant calli or cytodifferentiation, regeneration obtain paddy rice resistance glyphosate plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100208208A CN102559745A (en) | 2012-01-30 | 2012-01-30 | EPSP synthase gene rice chloroplast expression vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100208208A CN102559745A (en) | 2012-01-30 | 2012-01-30 | EPSP synthase gene rice chloroplast expression vector and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102559745A true CN102559745A (en) | 2012-07-11 |
Family
ID=46406351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100208208A Pending CN102559745A (en) | 2012-01-30 | 2012-01-30 | EPSP synthase gene rice chloroplast expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559745A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107129993A (en) * | 2016-02-26 | 2017-09-05 | 华中农业大学 | A kind of Antiglyphosate gene of modification and the breeding method of glyphosate-resistant rice |
| CN108251448A (en) * | 2018-01-17 | 2018-07-06 | 吉林省农业科学院 | A kind of screening technique of homogeneity rice chloroplast transfer-gen plant |
| CN108291236A (en) * | 2015-09-30 | 2018-07-17 | 先锋国际良种公司 | Plant EPSP synthase and application method |
| CN110042119A (en) * | 2018-01-17 | 2019-07-23 | 吉林省农业科学院 | A kind of rice chloroplast genetic transforming method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101429499A (en) * | 2007-11-09 | 2009-05-13 | 中国农业科学院生物技术研究所 | Glyphosate highly-tolerant EPSP synthase and coded sequence thereof |
-
2012
- 2012-01-30 CN CN2012100208208A patent/CN102559745A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101429499A (en) * | 2007-11-09 | 2009-05-13 | 中国农业科学院生物技术研究所 | Glyphosate highly-tolerant EPSP synthase and coded sequence thereof |
Non-Patent Citations (9)
| Title |
|---|
| 《万方数据》 20111031 王金辉 水稻、玉米叶绿体蛋白组学的研究和玉米叶绿体转化体系的建立 正文第32页至第41页以及图3.3至图3.16 1-3,8-10 , * |
| NISHIZAWA,Y. AND HIRAI,A.: "Oryza sativa Japonica Group chloroplast atpB, atpE genes for ATP synthetase beta subunit, ATP synthetase epsilon subunit, complete cds", 《NCBI GENBANK: D00432.1》, 27 December 2007 (2007-12-27) * |
| NISHIZAWA,Y. AND HIRAI,A: "Oryza sativa chloroplast gene for ribulose 1,5-bisphosphate carboxylase large subunit, complete cds", 《NCBI GENBANK: D00207.1》, 28 April 2001 (2001-04-28) * |
| NOCK,C.J. ET AL.: "Oryza sativa Japonica Group cultivar Nipponbare voucher AC01-1001045 chloroplast, complete genome", 《NCBI GENBANK: GU592207.1》, 25 March 2011 (2011-03-25) * |
| PHELAN,S. AND MULLINS,E.: "Phytophthora infestans clone Cu24_cyc_10_R3 genomic sequence", 《NCBI GENBANK: JN113289.1》, 5 December 2011 (2011-12-05) * |
| 任延国 等: "水稻psbA启动子诱导的GUS基因在烟草叶绿体中的瞬间表达", 《农业生物技术学报》, vol. 3, no. 4, 31 December 1995 (1995-12-31) * |
| 李轶女 等: "水稻叶绿体表达体系的建立及抗PPT叶绿体转化植株的获得", 《中国农业科学》, vol. 40, no. 9, 31 December 2007 (2007-12-31) * |
| 王金辉: "水稻、玉米叶绿体蛋白组学的研究和玉米叶绿体转化体系的建立", 《万方数据》, 31 October 2011 (2011-10-31) * |
| 苏宁等: "水稻叶绿体16S 启动子克隆改造、载体构建及转化研究", 《植物学通报》, vol. 20, no. 3, 31 December 2003 (2003-12-31) * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108291236A (en) * | 2015-09-30 | 2018-07-17 | 先锋国际良种公司 | Plant EPSP synthase and application method |
| CN108291236B (en) * | 2015-09-30 | 2022-07-26 | 先锋国际良种公司 | Plant EPSP synthases and methods of use |
| CN107129993A (en) * | 2016-02-26 | 2017-09-05 | 华中农业大学 | A kind of Antiglyphosate gene of modification and the breeding method of glyphosate-resistant rice |
| CN107129993B (en) * | 2016-02-26 | 2020-10-13 | 华中农业大学 | Modified glyphosate-resistant gene and cultivation method of glyphosate-resistant rice |
| CN108251448A (en) * | 2018-01-17 | 2018-07-06 | 吉林省农业科学院 | A kind of screening technique of homogeneity rice chloroplast transfer-gen plant |
| CN110042119A (en) * | 2018-01-17 | 2019-07-23 | 吉林省农业科学院 | A kind of rice chloroplast genetic transforming method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102010466B (en) | Plant resistance associated protein MYB, as well as coding gene and application thereof | |
| CN102533844A (en) | Corn chloroplast transgene expression vector containing herbicide resistant gene and application thereof | |
| CN1884518A (en) | Directional gene transfer method of cabbage type rape C chromosome set | |
| CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
| CN103436547A (en) | Gene with glyphosate tolerance and application thereof | |
| CN102174566A (en) | Method for improving stress resistance of chrysanthemum through trans-CgHSP70 genes | |
| CN102559745A (en) | EPSP synthase gene rice chloroplast expression vector and application thereof | |
| CN102226188A (en) | Application of paddy rice transcription factor OsAP21 gene | |
| CN101880674B (en) | Date tree aquaporin gene and application in improvement on plant drought resistance and salt resistance | |
| CN113388017A (en) | Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants | |
| Manners | Transformation of Stylosanthes spp. using Agrobacterium tumefaciens | |
| CN103243096B (en) | Plant tissue specific expression promoter and application of plant tissue specific expression promoter | |
| CN107033229B (en) | Wheat anti-powdery mildew GAP-associated protein GAP TaEDS1-D1 and its encoding gene and application | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN113943742B (en) | Gene DcCIPK24 capable of improving drought tolerance and salt tolerance of plants and application thereof | |
| CN109355297A (en) | Dendrobium candidum DcWOX4 gene and its application in raising axis tiller | |
| CN101864430B (en) | Wheat introgression family gene Tamyb31 for resisting abiotic stress and application thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN107142252A (en) | Wheat anti-powdery mildew GAP-associated protein GAP TaEDS1 B1 and its encoding gene and application | |
| CN103509804B (en) | Ammopiptanthus mongolicus low-temperature stress related gene, and expression carrier and applications thereof | |
| CN114032245A (en) | Gene VLNHX3D in regulating plant cell Na+And/or K+Application in concentration | |
| CN105505984A (en) | Vector of rice respiratory burst oxidase gene OsRboh(LOC_Os01g25820) and application thereof | |
| CN110904106A (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN104498508A (en) | Wheat introgression line response abiotic stress regulation gene TaGBF and application | |
| CN104558132B (en) | Peanut DELLA gene families and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120711 |