CN105087632A - Saccharomyces cerevisiae chromosome as well as construction method and application thereof - Google Patents
Saccharomyces cerevisiae chromosome as well as construction method and application thereof Download PDFInfo
- Publication number
- CN105087632A CN105087632A CN201510564754.4A CN201510564754A CN105087632A CN 105087632 A CN105087632 A CN 105087632A CN 201510564754 A CN201510564754 A CN 201510564754A CN 105087632 A CN105087632 A CN 105087632A
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- saccharomyces cerevisiae
- yeast saccharomyces
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a saccharomyces cerevisiae chromosome as well as a construction method and application thereof. The saccharomyces cerevisiae chromosome comprises two telomeric repeat sequences, two insulator sequences, a centromere-autonomously replicating sequence, a po130 gene and n repeated recombination boxes. Experiment results prove that auxotrophic marker genes of the saccharomyces cerevisiae chromosome are few, normal and stable growth in the situation that screening is not carried out can be realized, the expression quantity and copy number of exogenous genes in yeast are increased, the stability of exogenous genes in yeast is improved, genes integrated into a genome can be increased or reduced, and even expanded into new polygene clusters, and the rapid exogenous expression of beta carotene and violacein is successfully realized in yeast, so that a rapid feasible method is provided for yeast heterogeneous production of various exogenous approaches, and the saccharomyces cerevisiae chromosome can meet the application requirements of fields of gene engineering, metabolic engineering and synthetic biology.
Description
Technical field
The invention belongs to genetically engineered, metabolic engineering and synthetic biology field, be specifically related to a kind of S. cerevisiae chromosomal and construction process thereof and application; Particularly relate to one and can realize polygene, many metabolic pathways, easily extensible without the need to screening, and the S. cerevisiae chromosomal of stable existence and construction process thereof and application.
Background technology
Along with the development of modern biotechnology and biological medicine, heterologous systems is utilized to express and to obtain the application of high added value product more and more general.Famous successful case comprises the fermentative production etc. of Artemisinin.Traditional expression system utilizes microorganism as biological in chassis such as intestinal bacteria, Bacillus subtilus and yeast saccharomyces cerevisiaes, by putting into these systems non-existent enzyme gene originally, thus utilize the meta-bolites originally existed in these systems, the target product needed for acquisition.By further optimization, the final product obtaining high yield and quality.In order to realize the expression of foreign gene in these systems, usually need multiple gene pcr amplification from other biological out, then to put into host cell and express.The common method multiple foreign gene being put into host system has: 1) be cloned on independent carrier respectively by multiple gene, then each vector with foreign gene entered same cell; 2) multiple gene substep is cloned on same carrier, then transforms and enter cell; 3) multiple gene is transformed respectively, be incorporated in host genome.
Early stage metabolic engineering method is by the gene of required expression, utilizes molecular biological method, increases, and be cloned on carrier from the source species of this gene.If need to express multiple gene simultaneously, can adopt identical strategy, be cloned into respectively by each gene on the carrier with different resistance marker, each gene is regulated and controled by biological elements such as identical or different promotors.Then by build plasmid substep or cotransformation in host cell (normally intestinal bacteria), the screening marked by antagonism, obtains the bacterial strain with these foreign genes.
Because alternative resistant gene Limited Number, so the expression adopting aforesaid method to carry out foreign gene is limited to.For this reason, people develop again new method, and by multiple gene, substep is cloned on same carrier.So only need a kind of resistant vector, just can proceed to multiple gene simultaneously.Utilize the method, people can express the foreign gene of larger amt simultaneously.
Multiple gene clone is solved on same carrier part because the restriction of number gene, but the same with independent vector expression, to the last screening obtaining bacterial strain and must keep resistance.Once screening pressure disappears, the foreign gene entrained by bacterial strain can very fast being lost.And the use of microbiotic etc., also to greatly improving industrial production cost.In order to obtain stable expression system, reject the demand to screening pressures such as microbiotic, a terms of settlement is in host genome by these exogenous origin gene integrators.But it is low that of being incorporated on karyomit(e) limits to the gene copy number can integrated exactly, and the number gene that can integrate is little, and therefore product expression amount is few, is difficult to meet industrial mass-produced object.
Because the bacteria growths such as intestinal bacteria are fast, genome is relatively simple, and molecule manipulation technology maturation, so they are used to the host of various metabolic engineering very early.Meanwhile, yeast saccharomyces cerevisiae is as the simple eukaryotic microorganisms of one, because its genetic background is clear, genetic manipulation is convenient, is widely used as eukaryotic expression system.In addition, yeast is considered to a kind of safe microorganism, the production of to food be correlated with etc. product more favourable than intestinal bacteria etc.In addition, yeast has a powerful homologous recombination system, can utilize the homologous sequence of only tens base pairs, carries out accurate and efficient homologous recombination, thus can carry out the assembling of polygene, large fragment DNA more efficiently.
Therefore, in order to improve the expression amount of foreign gene in yeast, stability, can they be incorporated in genome, and must ensure that these genes can improve copy number in the case of necessary, and realize increasing being integrated into genomic gene, sieving and subtract and even expand new multiple gene cluster.Meanwhile, the minimum use of nutrient defect type mark must be ensured, and normal and stable growth can be carried out when not screening.
Summary of the invention
An object of the present invention is to provide a kind of yeast saccharomyces cerevisiae artificial chromosome.
Yeast saccharomyces cerevisiae artificial chromosome provided by the invention comprises n and repeats restructuring box, 2 telomere repeat sequences, 2 separaant sequences, kinetochore-autonomously replicating sequence and pol30 genes;
Each described restructuring box that repeats is made up of upstream target recombinant sequence, reporter gene, riddled basins and downstream target recombinant sequence; Described reporter gene and described riddled basins are all between described upstream target recombinant sequence and described downstream target recombinant sequence; Described n be more than or equal to 1 natural number.
Described upstream target recombinant sequence and described downstream target recombinant sequence are the sequences that homologous recombination does not all occur with rest part on yeast saccharomyces cerevisiae artificial chromosome.
In above-mentioned yeast saccharomyces cerevisiae artificial chromosome,
Described n is 1 or 2;
Described yeast saccharomyces cerevisiae artificial chromosome comprise successively from upstream to downstream a telomere repeat sequence, separaant sequence, first repeat restructuring box, kinetochore-autonomously replicating sequence, pol30 gene, second repeat recombinate box, another separaant sequence and another telomere repeat sequence;
Or described yeast saccharomyces cerevisiae artificial chromosome comprise successively from upstream to downstream a telomere repeat sequence, separaant sequence, first repeat recombinate box, kinetochore-autonomously replicating sequence, pol30 gene, another separaant sequence and another telomere repeat sequence.
In above-mentioned yeast saccharomyces cerevisiae artificial chromosome,
Described telomere repeat sequence is sequence 1 in sequence table;
Described separaant sequence is sequence 2 in sequence table;
Described kinetochore-autonomously replicating sequence is sequence 4 in sequence table;
Described pol30 gene order is sequence 6 in sequence table;
Described reporter gene is RFP gene;
Described riddled basins is TRP1 gene;
Described first upstream target recombinant sequence repeating restructuring box is sequence 9 in sequence table;
Described first downstream target recombinant sequence repeating restructuring box is sequence 10 in sequence table;
Described second upstream target recombinant sequence repeating restructuring box is sequence 11 in sequence table;
Described second downstream target recombinant sequence repeating restructuring box is sequence 12 in sequence table;
Described first sequence repeating restructuring box is sequence 15 in sequence table;
Described second sequence repeating restructuring box is sequence 16 in sequence table.
Another object of the present invention is to provide a kind of preparation method of yeast saccharomyces cerevisiae artificial chromosome.
The preparation method of yeast saccharomyces cerevisiae artificial chromosome provided by the invention is incorporated in pNEOC14 carrier for n being repeated restructuring box, obtains yeast saccharomyces cerevisiae artificial chromosome.
In aforesaid method,
Each described restructuring box that repeats is made up of upstream target recombinant sequence, reporter gene, riddled basins and downstream target recombinant sequence; Described reporter gene and described riddled basins are all between described upstream target recombinant sequence and described downstream target recombinant sequence; Described n be more than or equal to 1 natural number.
In aforesaid method, described method comprises the steps: that n being repeated restructuring box proceeds in the yeast saccharomyces cerevisiae containing linearizing pNEOC14 carrier, obtains recombinant bacterium, extracts the plasmid of described recombinant bacterium, namely obtain yeast saccharomyces cerevisiae artificial chromosome;
The described yeast saccharomyces cerevisiae containing linearizing pNEOC14 carrier is linearizing pNEOC14 carrier is proceeded to the middle bacterium that host's yeast saccharomyces cerevisiae obtains;
Described linearizing pNEOC14 carrier is the linear DNA molecule obtained after cutting pNEOC14 carrier with restriction enzyme PmeI enzyme;
The nucleotides sequence of described pNEOC14 carrier is classified as the ring-shaped DNA molecule shown in sequence 7 in sequence table.
In aforesaid method,
Described n is 1 or 2;
Described telomere repeat sequence is sequence 1 in sequence table;
Described separaant sequence is sequence 2 in sequence table;
Described kinetochore-autonomously replicating sequence is sequence 4 in sequence table;
Described pol30 gene order is sequence 6 in sequence table;
Described reporter gene is RFP gene;
Described riddled basins is TRP1 gene;
Described first upstream target recombinant sequence repeating restructuring box is sequence 9 in sequence table;
Described first downstream target recombinant sequence repeating restructuring box is sequence 10 in sequence table;
Described second upstream target recombinant sequence repeating restructuring box is sequence 11 in sequence table;
Described second downstream target recombinant sequence repeating restructuring box is sequence 12 in sequence table;
Described first sequence repeating restructuring box is for shown in sequence in sequence table 15;
Described second sequence repeating restructuring box is for shown in sequence in sequence table 16.
In aforesaid method, described yeast saccharomyces cerevisiae is that genome knocks out pol30 gene, and the yeast saccharomyces cerevisiae JDY52 containing URA-pol30 plasmid; The nucleotide sequence of described URA-pol30 plasmid is as shown in sequence in sequence table 8.
A further object of the invention is to provide a kind of DNA fragmentation.
DNA fragmentation provided by the invention be above-mentioned repeat recombinate box.
A further object of the invention is to provide a kind of yeast containing yeast saccharomyces cerevisiae artificial chromosome.
Yeast containing yeast saccharomyces cerevisiae artificial chromosome provided by the invention is that above-mentioned yeast saccharomyces cerevisiae artificial chromosome is imported the yeast obtained in yeast saccharomyces cerevisiae.
Above-mentioned yeast saccharomyces cerevisiae artificial chromosome or above-mentioned DNA fragmentation or the above-mentioned application of yeast in expression alien gene containing yeast saccharomyces cerevisiae artificial chromosome also belong to protection scope of the present invention.
Above-mentioned yeast saccharomyces cerevisiae artificial chromosome or above-mentioned DNA fragmentation or the above-mentioned application of yeast in the product preparing expression alien gene containing yeast saccharomyces cerevisiae artificial chromosome also belong to protection scope of the present invention.
Last object of the present invention is to provide a kind of method of expression alien gene.
The method of expression alien gene provided by the invention comprises the steps: the DNA fragmentation containing foreign gene to import above-mentioned containing in the yeast of yeast saccharomyces cerevisiae artificial chromosome, obtains recombinant bacterium A, cultivates described recombinant bacterium A, realize the expression of foreign gene;
The DNA fragmentation of described foreign gene comprises upstream homology arm, exogenous gene expression box, riddled basins and downstream homology arm;
Described upstream homology arm is the upstream target recombinant sequence repeating restructuring box of described yeast saccharomyces cerevisiae artificial chromosome;
Described downstream homology arm is the downstream target recombinant sequence repeating restructuring box of described yeast saccharomyces cerevisiae artificial chromosome.
In aforesaid method,
Described foreign gene can be multiple;
Described foreign gene is the gene of synthesis beta carotene or the gene of synthesis violacein;
The nucleotides sequence of the described DNA fragmentation containing synthesis beta carotene gene is classified as sequence 17;
The nucleotides sequence of the described DNA fragmentation containing synthesis chromobacterium plain gene is classified as sequence 18.
The present invention discloses a kind of S. cerevisiae chromosomal and construction process thereof and application.Proved by test: the auxotrophic marker gene of S. cerevisiae chromosomal of the present invention is few, normal and stable growth can be carried out when not screening, not only increase the expression amount of foreign gene in yeast, stability and copy number, and can increase being integrated into genomic gene, sieve subtracts and even expands new multiple gene cluster, the quick heterogenous expression of beta carotene and violacein is successfully achieved in yeast, for the yeast heterologous production of multiple exogenous route provides method feasible fast, genetically engineered can be met, the application demand in metabolic engineering and synthetic biology field.
Accompanying drawing explanation
Fig. 1 is sample and beta carotene standard substance HPLC peak figure.
Fig. 2 is violacein sample HPLC peak figure.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
PRS403 carrier in following embodiment, pRS404 carrier and pRS414 carrier are all disclosed in document " RobertS.Sikorski; PhilipHieter; ASystemofShuttleVectorsandYeastHostStrainsDesignedforEff icientManipulationofDNAinSaccharomycescerevisiae.Genetic s; 1989; 122:19-27. ", and the public can obtain from Tsing-Hua University.
Yeast saccharomyces cerevisiae JDY52 in following embodiment, the haploid strains that its diploid strains product spore formed for yeast saccharomyces cerevisiae BY4727 and yeast saccharomyces cerevisiae BY4733 post-coitum obtains, its genotype is MATa, his3 Δ 200leu2 Δ 0lys2 Δ 0trp1 Δ 63ura3 Δ 0met15 Δ 0, the public can obtain from Tsing-Hua University.
Yeast saccharomyces cerevisiae BY4727 (SaccharomycescerevisiaeBY4727) in following embodiment and yeast saccharomyces cerevisiae BY4733 (SaccharomycescerevisiaeBY4733) is all at document " BrachmannCB, DaviesA, CostGJ, CaputoE, LiJ, HieterP, BoekeJD.DesignerdeletionstrainsderivedfromSaccharomycesc erevisiaeS288C:ausefulsetofstrainsandplasmidsforPCR-medi atedgenedisruptionandotherapplications.Yeast, 1998, 14 (2): 115-32. " be disclosed in, the public can obtain from Tsing-Hua University.
The preparation method of embodiment 1, yeast chromosomal
The acquisition of the yeast strain one, containing pNEOC14 carrier
1, the acquisition of pNEOC1 carrier
(1) according to the structure of the natural telomere of yeast saccharomyces cerevisiae, devise the DNA fragmentation with telomere repeat sequence and Xcore, and obtain pUC19-F126 carrier by the way synthesis of business gene chemical synthesis.Carry out double digestion with restriction enzyme BsaI and AgeI to pUC19-F126 carrier, reclaim and obtain the fragment that size is 770bp, be the DNA fragmentation of telomere repeat sequence and Xcore, the nucleotide sequence of this fragment is as shown in sequence in sequence table 1.
(2) to remove the pRS414 of BsaI and BsmBI restriction enzyme site for template, adopt primer 1 (GCACCGGTTTCCCCGAAAAGTGCCACCT) and primer 2 (TAGGTCTCTTGTGTTTAAACATGTGCGCGGAACCCCTATTT), pfu enzyme is used to carry out pcr amplification, obtain the pcr amplification product that size is 4816bp, namely with the pRS414 carrier of BsaI and the AgeI restriction enzyme site introduced by primer, with restriction enzyme BsaI and AgeI, double digestion is carried out to the pRS414 carrier with BsaI and the AgeI restriction enzyme site introduced by primer, reclaim carrier segments.
(3) telomere repeat sequence step (1) obtained is connected with the carrier segments that step (2) obtains with the DNA fragmentation of Xcore, obtains pNEOC1 carrier.
2, the acquisition of pNEOC10 carrier
(1) synthesis of separaant
Synthetic primer 3 (catgTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG GGTTAGGGcctgcagggcatgc) and primer 4 (ccgggcatgccctgcaggCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC CTAACCCTAACCCTAACCCTAA), and the primer 3 of equimolar amount and primer 4 are mixed, room temperature cooling after heat denatured, obtain the DNA fragmentation that size is 82bp, be separaant, separaant is 10 TTAGGG unit repeated, and its nucleotide sequence is as shown in sequence in sequence table 2.
(2) with restriction enzyme A geI and NcoI, double digestion is carried out to the pNEOC1 carrier that step 1 obtains, reclaim and obtain the carrier large fragment that size is 5561bp.
(3) the carrier large fragment be DNA fragmentation and the size that step (2) obtains of 82bp by the size that step (1) obtains being 5561bp is connected, and obtains pNEOC10 carrier.After connection, on recombinant vectors pNEOC10, AgeI and NcoI identifies that restriction enzyme site disappears, and introduces SbfI and SphI restriction enzyme site simultaneously.
3, the acquisition of pNEOC11 carrier
(1) acquisition of HIS3 gene fragment
With pRS403 carrier for template, adopt primer 5 (TTACgagctcAGTCAGGGAAGTCATAACACAGTCC) and primer 6 (TAggtctcTTGTGTTTAAACCTGTGCGGTATTTCACACCGC), pfu enzyme is used to carry out pcr amplification, obtain pcr amplification product, be HIS3 gene fragment, its nucleotide sequence is as shown in sequence in sequence table 3.
With restriction enzyme SacI and BsaI, double digestion is carried out to above-mentioned pcr amplification product, obtain the DNA fragmentation that size is 1168bp.
Pcr amplification reaction condition: 94 DEG C, 3min; 94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 45s, 30cycles; 68 DEG C, 3min; 4 DEG C ,+∞.
(2) carry out double digestion with restriction enzyme A geI and BsaI to pUC19-F126 carrier, reclaiming size is the DNA fragmentation of 770bp, and its nucleotide sequence is as shown in sequence in sequence table 1.
(3) with restriction enzyme SacI and XmaI, double digestion is carried out to the pNEOC10 carrier that step 2 obtains, reclaim and obtain the carrier large fragment that size is 5593bp.
(4) be the HIS3 gene fragment of 1160bp by the size that step (1) obtains, the size that obtains of step (2) be DNA fragmentation and the size that step (3) obtains of 770bp is 5593bp carrier large fragment is connected, utilize AgeI and XmaI to be isocaudarner, obtain pNEOC11 carrier.
4, the acquisition of pNEOC12 carrier
To remove the pRS414 of BsaI and BsmBI restriction enzyme site for template, adopt primer 7 (TTAgcatgcCACCGCATAGGCAAGTGCAC) and primer 8 (TTActcgagCCGAAgagacgCGATcgtctcATGACaccggtactagtGAAAAGTGC CACCTGGGTCC), pfu enzyme is used to carry out pcr amplification, obtain pcr amplification product, i.e. TRP1 gene and CEN/ARS, its nucleotide sequence is as shown in sequence in sequence table 4.
With restriction enzyme XhoI and SphI, double digestion is carried out to the pNEOC11 carrier that above-mentioned pcr amplification product and step 3 obtain, connect, obtain pNEOC12 carrier.
5, the acquisition of pNEOC13 carrier
(1) synthesis of separaant
Synthetic primer 9 (catgggcgccTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG GGTTAGGGTTAGGGggatcc) and primer 10 (AATTggatccCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT AACCCTAACCCTAAggcgcc), and the primer 9 of equimolar amount and primer 10 are mixed, room temperature cooling after heat denatured, obtain the DNA fragmentation that size is 80bp, be separaant, its nucleotide sequence is as shown in sequence in sequence table 5.
(2) with restriction enzyme A geI and NcoI, double digestion is carried out to the pNEOC12 carrier that step 4 obtains, reclaim and obtain the carrier large fragment that size is 6751bp.
(3) the carrier large fragment be DNA fragmentation and the size that step (2) obtains of 80bp by the size that step (1) obtains being 6751bp is connected, and obtains pNEOC13 carrier.After connection, on recombinant vectors pNEOC13, EcoRI identifies that restriction enzyme site disappears, and introduces BamHI and KasI restriction enzyme site simultaneously.
6, the acquisition of pNEOC14 carrier
With pJD280 carrier for template, adopt primer 11 (GCGTAATACGACTCACTATAGGGC) and primer 12 (GGactagtGTGAGTTACCTCACTCATTAGGCACC), use KOD enzyme to carry out PCR and carry out pcr amplification, obtain the pcr amplification product that size is 1896bp, i.e. pol30 gene, its nucleotide sequence is as shown in sequence in sequence table 6.
Pcr amplification reaction: 94 DEG C, 3min; 94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 75s, 30cycles; 68 DEG C, 3min; 4 DEG C ,+∞.
Be that the pcr amplification product of 1896bp and pNEOC13 carrier carry out double digestion with restriction enzyme SpeI and XhoI to size, connect, obtain pNEOC14 carrier.
Check order to pNEOC14 carrier, sequencing result shows: pNEOC14 carrier is the ring-shaped DNA molecule shown in sequence in sequence table 7.
7, pNEOC14 vector linearization
Utilize restriction enzyme PmeI to carry out enzyme to the pNEOC14 carrier that above-mentioned steps 6 obtains to cut, 37 DEG C of enzymes cut 3 hours, obtain enzyme and cut mixture.
Enzyme is cut mixture to utilize in yeast conventional transformation methods transforming gene group and knock out pol30 gene, and containing the Wine brewing yeast strain of URA-pol30 plasmid, (this Wine brewing yeast strain is that genome knocks out pol30 gene, and the yeast saccharomyces cerevisiae JDY52 containing URA-pol30 plasmid, the nucleotide sequence of URA-pol30 plasmid is as shown in sequence in sequence table 8), obtain the yeast strain after transforming.
By the yeast strain after conversion at the enterprising row filter of substratum lacking tryptophane, obtain transformant.After mono-clonal grows, from each flat board, random choose 4 mono-clonals are at the flat lining out of new SC-TRP.Cultivate after about 48 hours for 30 DEG C, photocopy is on the flat board of SC-URA, SC-HIS, SC-TRP in order.Cultivate after about 24 hours, cut the flat board of mixture from containing enzyme, select the mono-clonal of two TRP+, HIS-, URA-for 30 DEG C, and preserve bacterial strain at the flat lining out of SC-TRP, obtain the yeast strain containing pNEOC14 carrier.
Two, the acquisition containing new chromosomal yeast strain
1, the Design and synthesis of restructuring box is repeated
The length repeating the target recombinant sequence of recombinating in box is 500bp, stochastic generation.The GC content of setting is 50%, and detects through NCBIblast, without any homology in sequencing data storehouse.The target recombinant sequence repeating restructuring box 1 of the present invention is URR1 and URR2, and wherein, URR1 sequence is as shown in sequence in sequence table 9, and URR2 sequence is as shown in sequence in sequence table 10; The target recombinant sequence repeating restructuring box 2 of the present invention is URR3 and URR4, and wherein, URR3 sequence is as shown in sequence in sequence table 11, and URR4 sequence is as shown in sequence in sequence table 12.URR1, URR2, URR3, URR4 are synthesized by Qing Lan bio tech ltd, Wuxi, are cloned in pMV carrier, and the sequence of order-checking confirmation and design is completely the same.
2, the acquisition of RFP gene
According to the sequence of RFP in GeneBank, the sequence of the RFP gene of design is as shown in sequence in sequence table 13.Synthesized by Qing Lan bio tech ltd, Wuxi, be cloned in pMV carrier, the sequence of order-checking confirmation and design is completely the same.
3, the acquisition of yeast selection mark
With pRS404 carrier for template, adopt primer 13 (TGATGTggtctcGTGAGCTGTGCGGTATTTCACACCG) and primer 14 (AGCGTGggtctcTAGCGAGATTGTACTGAGAGTGCAC), KOD enzyme is used to carry out pcr amplification, obtain pcr amplification product, be TRP1 gene, its nucleotide sequence, as shown in sequence in sequence table 14, is cloned into pSMARTHCKan carrier, check order, confirm not undergo mutation.
4, with the acquisition of yeast strain of the box that repeats to recombinate
(1) acquisition of the yeast strain of restructuring box is repeated containing one
With the DNA molecular shown in sequence in sequence table 15 for template, adopt primer 15 (ATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGGTCATC TAAGCACAGTCGCG) and primer 16 (CTATTTCTTAGCATTTTTGACGAAATTTGCTATTTTGTTAGAGTCTTTTATTAGCG TGGCGAGCCCGCCT), use KOD enzyme to carry out pcr amplification, obtain the pcr amplification product that size is 3475bp.
Pcr amplification reaction condition: 94 DEG C, 3min; 94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 3min, 30cycles; 68 DEG C, 5min; 4 DEG C ,+∞.
Above-mentioned pcr amplification product (sequence 15) is transformed the yeast containing pNEOC14 carrier that above-mentioned steps one obtains, screening obtains the clone that can grow on SC-HIS, can not grow on SC-TRP, extract the genome of this clone, design primer, to the integration site left arm at the fragment place of inserting, right arm and total length, carry out PCR checking, obtains the yeast strain of repeating restructuring box containing.The concrete steps of checking are as follows:
The left arm repeating the yeast strain of restructuring box containing one adopts F1 primer (CGCATAGGCAAGTGCACAAAC) and R1 primer (GCGTCAGGACGACTAGCATG), use KOD enzyme to carry out pcr amplification, obtain the pcr amplification product that size is 520bp; And adopt F2 primer (CGCATAGGCAAGTGCACAAAC) and R2 primer (ATGGAGATGAGTCGTGGCAAG), use KOD enzyme to carry out pcr amplification, without any band.
The right arm repeating the yeast strain of restructuring box containing one adopts F3 primer (ACGGTCACAGCTTGTCTGTAAG) and R3 primer (AACGCCGGAGTATGGGAATG), use KOD enzyme to carry out pcr amplification, obtain the pcr amplification product that size is 717bp; And adopt F4 primer (ACGGTCACAGCTTGTCTGTAAG) and R4 primer (CAGCAAGTCAGCATCGGAATC), use KOD enzyme to carry out pcr amplification, without any band.
The total length repeating the yeast strain of restructuring box containing one adopts F5 primer (CGCATAGGCAAGTGCACAAAC) and R5 primer (ACGGTCACAGCTTGTCTGTAAG), use KOD enzyme to carry out pcr amplification, obtain the pcr amplification product that size is 3941bp.
(2) yeast strain of restructuring box is repeated containing two
With the DNA molecular shown in sequence in sequence table 16 for template, adopt primer 17 (CAGCAGTTAAGGCCTTCCACCTCTCACCCAATATTCTGCCTACTTGGCCAGTCAGT CTCGTATTTCTCTTGGAGA) and primer 18 (ATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCTAACGCCCCTAACCGAAG GAACTAGAGGTCTTCTTTA), use KOD enzyme to carry out pcr amplification, obtain the pcr amplification product that size is 3387bp.
Pcr amplification reaction condition: 94 DEG C, 3min; 94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 3min, 30cycles; 68 DEG C, 5min; 4 DEG C ,+∞.
Above-mentioned pcr amplification product is transformed the yeast strain of repeating restructuring box containing that above-mentioned steps (1) obtains, screening obtains the clone that can grow on SC-HIS and SC-LEU, extract the genome of this clone, design primer 19 (CGTCGGATGGAGAAGAAAAA) and primer 20 (CGGCCAAACAACCAATTACT), PCR checking is carried out to the integration site at the fragment place of inserting, amplification obtains the pcr amplification product that size is 1088bp, be the yeast strain of repeating restructuring box containing two, extract plasmid, be yeast artificial chromosome.First is repeated restructuring box integration site and is positioned at TRP1 gene, and homology arm is respectively CTATTTCTTAGCATTTTTGACGAAATTTGCTATTTTGTTAGAGTCTTTTA and CAAACTTTCACCAATGGACCAGAACTACCTGTGAAATTAATAACAGACAT; Second is repeated restructuring box integration site between pol30 gene and separaant, and homology arm is respectively CAGCAGTTAAGGCCTTCCACCTCTCACCCAATATTCTGCCTACTTGGCCA and TTAGGGGCGTTAGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTAT.
According to the method described above, the present invention can introduce multiple repeat recombinate box, obtain containing multiple repeat restructuring box yeast strain.
Embodiment 2, yeast chromosomal are producing the application in beta carotene
1, the synthesis of object fragment
DNA fragmentation shown in sequence 17 in artificial synthesized sequence table, this fragment is made up of URR1, TDH3 promotor, crtE gene, TEF1 terminator, ADH1 promotor, crtI gene, ADH1 terminator, TEF2 promotor, crtYB gene, TEF2 terminator, LEU2 (riddled basins) and URR2 successively.All promotors, gene, terminator are seamless link.
2, transform
What in the sequence table of step 1 being synthesized, the DNA fragmentation shown in sequence 17 was transformed into prepared by embodiment 1 repeats to recombinate in the yeast strain of box containing one, utilizes yeast homologous recombinate, obtains the yeast strain of correct integration.And PCR qualification is carried out to it.Wherein the step of PCR qualification is as follows:
With the genomic dna of transformant for template, with PrimerA and PrimerB for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 568bp be containing URR1; With PrimerC and PrimerD for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 752bp be containing URR1, TDH3 promotor, crtE gene; With PrimerE and PrimerF for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 735bp be containing crtE gene, TEF1 terminator, ADH1 promotor, crtI; With PrimerG and PrimerH for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 880bp be containing crtI gene, ADH1 terminator, TEF2 promotor, crtYB; With PrimerI and PrimerJ for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 1335bp be containing crtYB gene, TEF2 terminator and LEU2; With PrimerK and PrimerL for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 977bp be containing LEU2 and URR2; With PrimerM and PrimerN for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 555bp be containing URR2, the transformant containing all object fragments is the object transformant finally obtained.The primer sequence of PCR qualification is as follows:
PrimerA:5’-GGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACG-3’；
PrimerB:5’-CCAGAATCCGGGGCCTCTAAAGTAGAGCTAGGTTCGGAC-3’；
PrimerC:5’-ACCCAACGATGTGGGGACGGCGTTGCAACTTCGAGGACCT-3’；
PrimerD:5’-ACTCCAATGGGATAGCGGTCAAGATGTTAGCGTAGTCCAT-3’；
PrimerE:5’-GGAAGCTATCTTGAAGAAGTTGGCTGACATCCCATTGTA-3’；
PrimerF:5’-TGATAGCGGTTGGCTTGTCTTGGTCTTGTTCCTTACCCAT-3’；
PrimerG:5’-GTAAGCCATTGAAGTCTAACGGAACCGGTATCGACTCTCA-3’；
PrimerH:5’-TGTAGATCAAGTGGATTTGGTAGTAAGCCAAAGCGGTCAT-3’；
PrimerI:5’-TACTCTTTGCCATTGGTTGCTTACGCTGAAGACTTGGCTA-3’；
PrimerJ:5’-GGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACAT-3’；
PrimerK:5’-CTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCT-3’；
PrimerL:5’-CCCCGACAGTGCGATTTAGCGAGCCTCTAACTCTTTCG-3’；
PrimerM:5’-GCGTGCCTGCTCTCTCGTATTTCTCCTGGAGATC-3’；
PrimerN:5’-CTGTTACTGATATGTCTGAGGAAAGTTGATCAAGACCC-3’。
3, beta carotene is produced and qualification
Correct for the checking yeast strain integrated is inoculated in YPD substratum, cultivate and collect after 2-3 days, freeze-drying, with the acetone of 90%, the carotenoid in yeast cell is extracted after broken wall, with β-carotene (Sigma-Aldrich product, catalog number is C4582-5mG) be standard substance, carry out HPLC and detect analysis, obtain the fractional yield of object transformant β-carotene according to peak area.
Detected result is as shown in Figure 1: sample is consistent with the retention time of beta carotene standard substance.Illustrate that the present invention successfully produces and obtain beta carotene.
Embodiment 3, yeast chromosomal are producing the application in violacein
1, the synthesis of object fragment
DNA fragmentation shown in sequence 18 in artificial synthesized sequence table, this fragment is made up of URR1, TEF2 promotor, vioA gene, ADH1 terminator, TEF2 promotor, vioB gene, ADH1 terminator, TEF2 promotor, vioC gene, ADH1 terminator, TEF2 promotor, vioD gene, ADH1 terminator, TEF2 promotor, vioE gene, ADH1 terminator, LEU2 (riddled basins) and URR2 successively.All promotors, gene, terminator are seamless link.
2, transform
What in the sequence table of step 1 being synthesized, the DNA fragmentation shown in sequence 18 was transformed into prepared by embodiment 1 recombinates in the yeast strain of box containing repeating, and utilizes yeast homologous recombinate, obtains the yeast strain of correct integration.And PCR qualification is carried out to it.Wherein the step of PCR qualification is as follows:
With the genomic dna of transformant for template, with Primera and Primerb for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 568bp be containing URR1; With Primerc and Primerd for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 682bp be containing URR1, TEF2 promotor, vioA gene; With Primere and Primerf for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 956bp be containing vioA gene, ADH1 terminator, TEF2 promotor, vioB gene; With Primerg and Primerh for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 1052bp be containing vioB gene, ADH1 terminator, TEF2 promotor, vioC gene; With Primeri and Primerj for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 1158bp be containing vioC gene, ADH1 terminator, TEF2 promotor, vioD gene; With Primerk and Primerl for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 1256bp be containing vioD gene, ADH1 terminator, TEF2 promotor, vioE gene; With Primerm and Primern for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 1134bp be containing vioE gene, ADH1 terminator, LEU2; With Primero and Primerp for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 977bp be containing LEU2, URR2; With Primerq and Primerr for primer carries out pcr amplification, the pcr amplification product transformant that to be the transformant of the object fragment of 555bp be containing URR2, the transformant containing all object fragments is the object transformant finally obtained.
Primera:5’-GGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACG-3’；
Primerb:5’-CCAGAATCCGGGGCCTCTAAAGTAGAGCTAGGTTCGGAC-3’；
Primerc:5’-ACCCAACGATGTGGGGACGGCGTTGCAACTTCGAGGACCT-3’；
Primerd:5’-TCTACCACCAGCTTCTTGTTGCATGTCGAAGATTCTCAA-3’；
Primere:5’-GTAGATTGTTGTTGCAAAGAATCGCTGCTTTGAGAAGA-3’；
Primerf:5’-GAAGTGGATACGCGGGAAATCCAGAATGCTCATC-3’；
Primerg:5’-GAGCGTCTGCTGGAGCAGGCGAGCATG-3’；
Primerh:5’-CCAGCCAAACCACCACCAACGATGATAGCTCTTTTCATC-3’；
Primeri:5’-GAGAAAGGTTCAAGCTGACGCTATGCAAGACATGGCTA-3’；
Primerj:5’-CCAGCTGGACCAGCACCGATAACCAAGATTTTCATC-3’；
Primerk:5’-GGTAAGTTGGTTTTGTTGGGTGACGCTTTGCAATCT-3’；
Primerl:5’-CTAGCTGGCAACAATGGTGGTTCTCTGTTTTCCATC-3’；
Primerm:5’-GCTGAAATCCCAGACGCTGTTTTCGCTGCTAAGAGA-3’；
Primern:5’-GGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACAT-3’；
Primero:5’-CTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCT-3’；
Primerp:5’-CCCCGACAGTGCGATTTAGCGAGCCTCTAACTCTTTCG-3’；
Primerq:5’-GCGTGCCTGCTCTCTCGTATTTCTCCTGGAGATC-3’；
Primerr:5’-CTGTTACTGATATGTCTGAGGAAAGTTGATCAAGACCC-3’。
3, the production of violacein and qualification
By correct for checking in step 2 yeast strain integrated, be inoculated in YPD substratum, cultivate and collect after 2-3 days, freeze-drying, with methyl alcohol, the violacein in yeast cell is extracted after broken wall, and detected by HPLC.The yeast strain containing the box that repeats to recombinate obtained with i.e. embodiment 1 is for contrast.
Detected result is as shown in Figure 2: compare with control strain, and the sample extracted from the correct yeast strain integrated has single peak, is violacein.Illustrate that the present invention successfully produces and obtain violacein.
Claims (12)
1. a yeast saccharomyces cerevisiae artificial chromosome, it comprises n and repeats restructuring box, 2 telomere repeat sequences, 2 separaant sequences, kinetochore-autonomously replicating sequence and pol30 genes;
Each described restructuring box that repeats is made up of upstream target recombinant sequence, reporter gene, riddled basins and downstream target recombinant sequence; Described reporter gene and described riddled basins are all between described upstream target recombinant sequence and described downstream target recombinant sequence; Described n be more than or equal to 1 natural number.
2. yeast saccharomyces cerevisiae artificial chromosome according to claim 1, is characterized in that:
Described n is 1 or 2;
Described yeast saccharomyces cerevisiae artificial chromosome comprise successively from upstream to downstream a telomere repeat sequence, separaant sequence, first repeat restructuring box, kinetochore-autonomously replicating sequence, pol30 gene, second repeat recombinate box, another separaant sequence and another telomere repeat sequence;
Or described yeast saccharomyces cerevisiae artificial chromosome comprise successively from upstream to downstream a telomere repeat sequence, separaant sequence, first repeat recombinate box, kinetochore-autonomously replicating sequence, pol30 gene, another separaant sequence and another telomere repeat sequence.
3. yeast saccharomyces cerevisiae artificial chromosome according to claim 1 and 2, is characterized in that:
Described telomere repeat sequence is sequence 1 in sequence table;
Described separaant sequence is sequence 2 in sequence table;
Described kinetochore-autonomously replicating sequence is sequence 4 in sequence table;
Described pol30 gene order is sequence 6 in sequence table;
Described reporter gene is RFP gene;
Described riddled basins is TRP1 gene;
Described first upstream target recombinant sequence repeating restructuring box is sequence 9 in sequence table;
Described first downstream target recombinant sequence repeating restructuring box is sequence 10 in sequence table;
Described second upstream target recombinant sequence repeating restructuring box is sequence 11 in sequence table;
Described second downstream target recombinant sequence repeating restructuring box is sequence 12 in sequence table;
Described first sequence repeating restructuring box is sequence 15 in sequence table;
Described second sequence repeating restructuring box is sequence 16 in sequence table.
4. a preparation method for yeast saccharomyces cerevisiae artificial chromosome, being incorporated in pNEOC14 carrier for n being repeated restructuring box, obtaining yeast saccharomyces cerevisiae artificial chromosome.
5. method according to claim 4, is characterized in that:
Each described restructuring box that repeats is made up of upstream target recombinant sequence, reporter gene, riddled basins and downstream target recombinant sequence; Described reporter gene and described riddled basins are all between described upstream target recombinant sequence and described downstream target recombinant sequence; Described n be more than or equal to 1 natural number.
6. the method according to claim 4 or 5, it is characterized in that: described method comprises the steps: that n being repeated restructuring box proceeds in the yeast saccharomyces cerevisiae containing linearizing pNEOC14 carrier, obtain recombinant bacterium, extract the plasmid of described recombinant bacterium, namely obtain yeast saccharomyces cerevisiae artificial chromosome;
The described yeast saccharomyces cerevisiae containing linearizing pNEOC14 carrier is linearizing pNEOC14 carrier is proceeded to the middle bacterium that host's yeast saccharomyces cerevisiae obtains;
Described linearizing pNEOC14 carrier is the linear DNA molecule obtained after cutting pNEOC14 carrier with restriction enzyme PmeI enzyme;
The nucleotides sequence of described pNEOC14 carrier is classified as the ring-shaped DNA molecule shown in sequence 7 in sequence table.
7., according to described method arbitrary in claim 4-6, it is characterized in that:
Described n is 1 or 2;
Described telomere repeat sequence is sequence 1 in sequence table;
Described separaant sequence is sequence 2 in sequence table;
Described kinetochore-autonomously replicating sequence is sequence 4 in sequence table;
Described pol30 gene order is sequence 6 in sequence table;
Described reporter gene is RFP gene;
Described riddled basins is TRP1 gene;
Described first upstream target recombinant sequence repeating restructuring box is sequence 9 in sequence table;
Described first downstream target recombinant sequence repeating restructuring box is sequence 10 in sequence table;
Described second upstream target recombinant sequence repeating restructuring box is sequence 11 in sequence table;
Described second downstream target recombinant sequence repeating restructuring box is sequence 12 in sequence table;
Described first sequence repeating restructuring box is for shown in sequence in sequence table 15;
Described second sequence repeating restructuring box is for shown in sequence in sequence table 16.
8. a DNA fragmentation, for described in claim 1 repeat recombinate box.
9. the yeast containing yeast saccharomyces cerevisiae artificial chromosome, for importing described yeast saccharomyces cerevisiae artificial chromosome arbitrary in claim 1-3 the yeast obtained in yeast saccharomyces cerevisiae.
10. arbitrary described yeast saccharomyces cerevisiae artificial chromosome or DNA fragmentation according to claim 8 or the application of yeast in expression alien gene containing yeast saccharomyces cerevisiae artificial chromosome according to claim 9 in claim 1-3;
Or arbitrary described yeast saccharomyces cerevisiae artificial chromosome or DNA fragmentation according to claim 8 or the application of yeast in the product preparing expression alien gene containing yeast saccharomyces cerevisiae artificial chromosome according to claim 9 in claim 1-3.
The method of 11. 1 kinds of expression alien genes, comprise the steps: according to claim 9 for the DNA fragmentation importing containing foreign gene containing in the yeast of yeast saccharomyces cerevisiae artificial chromosome, obtain recombinant bacterium A, cultivate described recombinant bacterium A, realize the expression of foreign gene;
The DNA fragmentation of described foreign gene comprises upstream homology arm, exogenous gene expression box, riddled basins and downstream homology arm;
Described upstream homology arm is the upstream target recombinant sequence repeating restructuring box of described yeast saccharomyces cerevisiae artificial chromosome;
Described downstream homology arm is the downstream target recombinant sequence repeating restructuring box of described yeast saccharomyces cerevisiae artificial chromosome.
12. methods according to claim 11, is characterized in that:
Described foreign gene is the gene of synthesis beta carotene or the gene of synthesis violacein;
The nucleotides sequence of the described DNA fragmentation containing synthesis beta carotene gene is classified as sequence 17;
The nucleotides sequence of the described DNA fragmentation containing synthesis chromobacterium plain gene is classified as sequence 18.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510564754.4A CN105087632B (en) | 2015-09-07 | 2015-09-07 | saccharomyces cerevisiae chromosome and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510564754.4A CN105087632B (en) | 2015-09-07 | 2015-09-07 | saccharomyces cerevisiae chromosome and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087632A true CN105087632A (en) | 2015-11-25 |
| CN105087632B CN105087632B (en) | 2019-12-10 |
Family
ID=54568964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510564754.4A Active CN105087632B (en) | 2015-09-07 | 2015-09-07 | saccharomyces cerevisiae chromosome and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087632B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107384968A (en) * | 2017-08-23 | 2017-11-24 | 中国科学院上海生命科学研究院 | The Yeast engineering bacterium strain of Chromosomal fusion transformation |
| CN107988202A (en) * | 2017-11-27 | 2018-05-04 | 天津大学 | A kind of method for knocking out S. cerevisiae chromosomal |
| CN108913613A (en) * | 2018-07-12 | 2018-11-30 | 天津大学 | A kind of bacterial strain and its application in the yield for improving microbial secondary metabolite |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102239261A (en) * | 2008-11-28 | 2011-11-09 | 奥地利经济服务有限责任公司 | Artificial chromosome vector |
| CN102292442A (en) * | 2009-01-27 | 2011-12-21 | 旭硝子株式会社 | Method for transforming schizosaccharomyces pombe, transformant of schizosaccharomyces pombe, and method for producing heterologous protein |
-
2015
- 2015-09-07 CN CN201510564754.4A patent/CN105087632B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102239261A (en) * | 2008-11-28 | 2011-11-09 | 奥地利经济服务有限责任公司 | Artificial chromosome vector |
| CN102292442A (en) * | 2009-01-27 | 2011-12-21 | 旭硝子株式会社 | Method for transforming schizosaccharomyces pombe, transformant of schizosaccharomyces pombe, and method for producing heterologous protein |
Non-Patent Citations (4)
| Title |
|---|
| ANDREW MILLER等: "Proliferating Cell Nuclear Antigen (PCNA) Is Required for Cell Cycle-regulated Silent Chromatin on Replicated and Nonreplicated Genes", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| CLARK CHEN等: "Saccharomyces cerevisiae pol30 (Proliferating Cell Nuclear Antigen) Mutations Impair Replication Fidelity and Mismatch Repair", 《MOLECULAR AND CELLULAR BIOLOGY》 * |
| JESSICA DYMOND等: "The Saccharomyces cerevisiae SCRaMbLE system and genome minimization", 《BIOENGINEERED BUGS》 * |
| NARAYANA ANNALURU等: "Total Synthesis of a Functional Designer Eukaryotic Chromosome", 《SCIENCE》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107384968A (en) * | 2017-08-23 | 2017-11-24 | 中国科学院上海生命科学研究院 | The Yeast engineering bacterium strain of Chromosomal fusion transformation |
| CN107384968B (en) * | 2017-08-23 | 2021-06-08 | 中国科学院分子植物科学卓越创新中心 | Yeast engineering strain for chromosome fusion modification |
| CN107988202A (en) * | 2017-11-27 | 2018-05-04 | 天津大学 | A kind of method for knocking out S. cerevisiae chromosomal |
| CN107988202B (en) * | 2017-11-27 | 2020-09-04 | 天津大学 | Method for knocking out saccharomyces cerevisiae chromosome |
| CN108913613A (en) * | 2018-07-12 | 2018-11-30 | 天津大学 | A kind of bacterial strain and its application in the yield for improving microbial secondary metabolite |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087632B (en) | 2019-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lian et al. | Construction of plasmids with tunable copy numbers in Saccharomyces cerevisiae and their applications in pathway optimization and multiplex genome integration | |
| Cai et al. | CRISPR-mediated genome editing in non-conventional yeasts for biotechnological applications | |
| EP3132036B1 (en) | Targeted mutations | |
| Baker | Aspergillus niger genomics: past, present and into the future | |
| Aguiar et al. | Ashbya gossypii beyond industrial riboflavin production: a historical perspective and emerging biotechnological applications | |
| WO2015138855A1 (en) | Vectors and methods for fungal genome engineering by crispr-cas9 | |
| EP3132035A1 (en) | Deletion mutations | |
| CN1938426A (en) | Generation of recombinant genes in saccharomyces cerevisiae | |
| CN105087632A (en) | Saccharomyces cerevisiae chromosome as well as construction method and application thereof | |
| Liu et al. | Constructing yeast chimeric pathways to boost lipophilic terpene synthesis | |
| CN105483034B (en) | A method of conversion yeast mating type | |
| Bélanger et al. | Phylogenetic analyses of seven protein families refine the evolution of small RNA pathways in green plants | |
| CN111057654A (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| Heo et al. | Simultaneous integration of multiple genes into the Kluyveromyces marxianus chromosome | |
| Azi et al. | Developing Ganoderma lucidum as a next-generation cell factory for food and nutraceuticals | |
| AU2015266065B2 (en) | Causative genes conferring acetic acid tolerance in yeast | |
| CN102016022B (en) | Genome-wide construction of schizosaccharomyces pombe heterozygous deletion mutants containing gene-specific barcodes by methods of 4-round serial or block PCR, or total gene synthesis thereof | |
| Guo et al. | Transcriptional regulation contributes more to Monascus pigments diversity in different strains than to DNA sequence variation | |
| CN104561080A (en) | Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof | |
| EP2267126A1 (en) | Process for the stable gene interruption in clostridia | |
| Kotaka et al. | Efficient generation of recessive traits in diploid sake yeast by targeted gene disruption and loss of heterozygosity | |
| CN102911962B (en) | Method for modifying microbes and for acquiring improved phenotype | |
| CN109628448A (en) | Industrial saccharomyces cerevisiae resistance transformation based on the library saccharomyces cerevisiae CRISPR | |
| US20100330678A1 (en) | Process for the stable gene interruption in clostridia | |
| US20150147774A1 (en) | Expression construct for yeast and a method of using the construct |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |