CN104152482A - RecET recombination system expression plasmids for zymomonas mobilis, as well as construction method and applications thereof - Google Patents

Abstract

The invention discloses six RecET recombination system expression plasmids pSUZM1a-RecET (RecE588T), pSUZM2a-RecET (RecE588T) and pSUZM3a-RecET (RecE588T) for zymomonas mobilis, as well as a construction method and applications thereof. All the six expression plasmids contain kanamycin selection marker genes, constitutive promoter Ppdc and RecET (or RecE588T) genes. The difference is that the plasmid pSUZM1a-RecET (RecE588T) contains replication origin oriC on zymomonas mobilis chromosome, the plasmid pSUZM2a-RecET (RecE588T) contains a replication probe sequence on zymomonas mobilis endogenesis plasmid pZZM401, and the plasmid pSUZM3a-RecET (RecE588T) contains a replication probe sequence on zymomonas mobilis endogenesis plasmid pZZM402. The expression plasmids are converted into Z. mobilis, and the knocked-in genes can correctly replace target genes when a homologous arm of the knocked-in selection marker gene is 60bp. The plasmids have good application prospects.

Description

Zymomonas mobilis RecET recombination system expression plasmid and construction process and application

Technical field

The present invention relates to expression plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET and the pSUZM1a-RecE588T of zymomonas mobilis RecET recombination system, the structure of pSUZM2a-RecE588T, pSUZM3a-RecE588T and the application of RecET recombination system expression plasmid in zymomonas mobilis belong to gene engineering technology field.

Background technology

Zymomonas mobilis ( zymomonas mobilis) be a kind of amphimicrobian type gram negative bacterium of high-yield ethanol.With respect to other bacterial strain, ZM4(ATCC31821) the alcohol production efficiency of bacterial strain is higher, and it also possesses many outstanding advantages, and such as carbohydrate picked-up ability is strong, cellular biomass is less, and higher alcohol resistance does not need oxygenation to control when fermentation.But zymomonas mobilis can only utilize glucose, fructose, three kinds of carbon sources of sucrose, genetic transformation rate is low, has seriously limited its application in industrial production, therefore, adopt the method for molecular genetics to transform it, expand its substrate utilization scope significant.

Derive from the PCR product that the RecET system of Rac phage can effectively mediate with short homologous sequence and carry out homologous recombination, in prokaryotic organism, there is very high recombination efficiency.By setting up external RecET system, the target gene that can act on host chromosome for the linear DNA molecule of practicing shooting carries out genomic restructuring.In intestinal bacteria sbcAin defect bacterial strain, be incorporated into the RecE of Rac phage on karyomit(e) and the RecT expression that is activated, linear DNA molecule carries out homologous recombination with the homology arm at target gene two ends under the effect of enzyme.By the Cloning of Genes Related of recombination system, on carrier or karyomit(e), the albumen of its expression can directly be modified BAC carrier or escherichia coli chromosome, and this system is called as RecET recombination system.RecET recombination system does not rely on RecA, only relies on RecE, RecT; Required homology arm is short, and length is that 30 ~ 50bp just has very high recombination efficiency.RecET system is different from host's self recombination system, with another kind of λ-Red recombination system functional similarity.Rac phage recombination system is by two coded by said gene, recE, recTrespectively with λ exowith λ betfunctional similarity, RecE albumen has 5 '-3 ' double-stranded 5 prime excision enzyme activity, produces 3 ' overhang.RecT is a kind of strand annealing albumen.When there is homologous recombination, with the donor dna molecule of homology arm, first through the effect of RecE albumen, make its two ends form strand and overhang; RecT albumen forms oligomeric ring and C-shape structure and is attached to 3 ' protruding terminus, ssDNA is protected, and rely on combined homology arm to match restructuring, and target gene is carried out to molecular genetic modification.

Although z.mobilisadvantages, but himself there is powerful repair system, and heterogenous expression efficiency is low, is difficult to obtain the engineering bacteria of ethanol high yield.Therefore, adopt RecET homologous recombination method, the expression plasmid of the RecET recombination system of the motion Zymomonas mobilis of structure, right z.mobilisgenome carries out genetic modification, can knock out or insert gene of interest, makes its stable existence on genome, sets up a kind of high-level efficiency recombination system efficiently.

Summary of the invention

The construction process that the object of this invention is to provide zymomonas mobilis RecET recombination system expression plasmid pSUZM1a-RecET, pSUZM1a-RecE588T, pSUZM2a-RecET, pSUZM2a-RecE588T, pSUZM3a-RecET, pSUZM3a-RecE588T.

RecET recombination system expression plasmid difference called after pSUZM1a-RecET, pSUZM1a-RecE588T, pSUZM2a-RecET, pSUZM2a-RecE588T, pSUZM3a-RecET, pSUZM3a-RecE588T in zymomonas mobilis provided by the invention.

Wherein, pSUZM1a-RecET comprises and comes from replication orgin oriC on zymomonas mobilis karyomit(e), comes from the promotor Ppdc of replication orgin on plasmid pUC18, kantlex selection markers gene, zymomonas mobilis constitutive gene promotor-pyruvic carboxylase pdc gene, from recE and the recT gene of intestinal bacteria DH10B;

PSUZM2a-RecET comprises from the replication protein sequence of zymomonas mobilis endogenous plasmid pZZM401, come from replication orgin, kantlex selection markers gene on plasmid pUC18, come from the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis, from recE and the recT gene of intestinal bacteria DH10B;

PSUZM3a-RecET comprises from the replication protein sequence on motion fermentation endogenous plasmid pZZM402, from the replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis, from recE and the recT gene of intestinal bacteria DH10B;

PSUZM1a-RecE588T comprises from the replication protein sequence of zymomonas mobilis endogenous plasmid pZZM401, comes from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis, recE588 fragment (588 amino acid whose sequences of its albumen n end of recE genes encoding are deleted, are called recE588) and recT gene from intestinal bacteria DH10B;

PSUZM2a-RecE588T comprise come from zymomonas mobilis endogenous plasmid pZZM401 replication protein sequence, come from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis, from recE588 fragment and the recT gene of intestinal bacteria DH10B;

PSUZM3a-RecE588T comprises the replication protein sequence that comes from motion fermentation endogenous plasmid pZZM402, come from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis, from recE588 fragment and the recT gene of intestinal bacteria DH10B;

The construction process that the invention provides pSUZM1a-RecET, pSUZM1a-RecE588T, pSUZM2a-RecET, pSUZM2a-RecE588T, pSUZM3a-RecET, pSUZM3a-RecE588T plasmid, comprises the steps:

1) pSUZM1a-RecET, pSUZM2a-RecET, the construction process of pSUZM3a-RecET.

(1) with zymomonas mobilis expression plasmid pSUZM1a(, contain replication orgin oriC on zymomonas mobilis karyomit(e) respectively, replication orgin on plasmid pUC18, the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis), the replication orgin that pSUZM2a(contains zymomonas mobilis endogenous plasmid pZZM401 and DNA replication dna enzyme gene order, replication orgin on plasmid pUC18, the constitutive gene promotor Ppdc of zymomonas mobilis), the replication orgin that pSUZM3a(contains zymomonas mobilis endogenous plasmid pZZM402 and DNA replication dna enzyme gene order, replication orgin on plasmid pUC18, the promotor Ppdc of the pyruvic carboxylase pdc gene of zymomonas mobilis) be template, with following primer 5 '-TGTAATCGATAATTCAGAGGAATAAAGGTAGCTTGCAGTGGG-3 ' and 5 '-GGAAGAGTGGTTTTGTGCTCATTGCTTACTCCATATAT-3 ', carry out pcr amplification, obtain carrier framework Segment A (pSUZM1a), B (pSUZM2a) and C(pSUZM3a).

(2) take intestinal bacteria DH10B genomic dna is template, with following primer 5 '-ATATATGGAGTAAGCAATGAGCACAAAACCACTCTTCC-3 ' and 5 '-CCCACTGCAAGCTACCTTTATTCCTCTGAATTATCGATTACA-3 ', carry out pcr amplification, the tandem gene fragment recET(of the RecET system that obtains encoding comprises recE and recT gene);

(3) carrier framework Segment A, B and C mole are mixed after running gel reclaims etc. respectively with gene fragment recET respectively, mixing fragment processes with T4 archaeal dna polymerase, then carry out annealing reaction restructuring, transform intestinal bacteria, obtain recombinant plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET.

2) pSUZM1a-RecE588T, pSUZM2a-RecE588T, the construction process of pSUZM3a-RecE588T.

(1) take respectively zymomonas mobilis expression plasmid pSUZM1a, pSUZM2a, pSUZM3a is template, with following primer 5 '-TGTAATCGATAATTCAGAGGAATAAAGGTAGCTTGCAGTGGG-3 ' and 5 '-TTCTACGATTACGGGATCCATTGCTTACTCCATATAT-3 ', carry out pcr amplification, obtain carrier framework fragment D (pSUZM1a), E (pSUZM2a) and F (pSUZM3a).

(2) take intestinal bacteria DH10B genomic dna is template, with following primer 5 '-ATATATGGAGTAAGCAATGGATCCCGTAATCGTAGAA-3 ' and 5 '-TTCTACGATTACGGGATCCATTGCTTACTCCATATAT-3 ', carry out pcr amplification, the tandem gene fragment recE588T of the RecET system that obtains encoding;

(3) carrier framework fragment D, E and F mole are mixed after running gel reclaims etc. respectively with gene fragment recE588T respectively, mixing fragment processes with T4 archaeal dna polymerase, then carry out annealing reaction restructuring, transform intestinal bacteria, obtain recombinant plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T.

Accompanying drawing explanation

The construction strategy of Fig. 1 expression plasmid pSUZM1a-RecET.

The construction strategy of Fig. 2 expression plasmid pSUZM2a-RecET.

The construction strategy of Fig. 3 expression plasmid pSUZM3a-RecET.

The pSUZM2a-RecET of Fig. 4 RecET gene, RecE588T gene fragment and construction expression plasmid, pSUZM2a-RecE588T, pSUZM3a-RecET, the B of pSUZM3a-RecE588T, E, C, the PCR electrophorogram of F linear carrier skeleton.1:RecET gene fragment; 2:RecE588T gene fragment; 3:B (pSUZM2a); 4:E (pSUZM2a); 5:C (pSUZM3a); 6:F (pSUZM3a).

Fig. 5 construction expression plasmid pSUZM1a-RecET, the A of pSUZM1a-RecE588T, the PCR electrophorogram of D linear carrier skeleton.M：λEcoT14 DNA marker；1：A(pSUZM1a)；2：D(pSUZM1a)。

Fig. 6 expression plasmid pSUZM1a-RecET, pSUZM1a-RecE588T, pSUZM2a-RecET, pSUZM2a-RecE588T, pSUZM3a-RecET, the PCR of pSUZM3a-RecE588T identifies electrophorogram.1-6 is respectively pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET, pSUZM1a-RecE588T, pSUZM2a-RecE588T, the PCR result of pSUZM3a-RecE588T.

The double digestion of Fig. 7 expression plasmid pSUZM1a-RecET is identified.M: λ Eco T14 DNA marker; 1: ecor I and ncoi double digestion.

The double digestion of Fig. 8 expression plasmid pSUZM2a-RecET is identified.M: λ Eco T14 DNA marker; 1: ecor I and ncoi double digestion.

The single endonuclease digestion of Fig. 9 expression plasmid pSUZM3a-RecET is identified.M: λ Eco T14 DNA marker; 1: psti single endonuclease digestion.

The construction strategy of Figure 10 expression plasmid pSUZM1a-RecE588T expression plasmid.

The construction strategy of Figure 11 expression plasmid pSUZM2a-RecE588T expression plasmid.

The construction strategy of Figure 12 expression plasmid pSUZM3a-RecE588T expression plasmid.

The double digestion of Figure 13 expression plasmid pSUZM1a-RecE588T is identified.M: λ Eco T14 DNA marker; ecor I and ncoi double digestion.

The double digestion identification of M of Figure 14 expression plasmid pSUZM2a-RecE588T: λ Eco T14 DNA marker; 1: ecor I and ncoi double digestion.

The single endonuclease digestion of Figure 15 expression plasmid pSUZM3a-RecE588T is identified.M: λ Eco T14 DNA marker; 1: psti single endonuclease digestion.

Figure 16 pcr amplification ADH B gene knock in fragment.M: λ Eco T14 DNA marker; 1: through twice PCR amplified production " ADH B-tet-ADH B "

Figure 17 is for the identification of the schematic diagram of knocking in tetracycline gene tet primer location.

The PCR that Figure 18 zymomonas mobilis ZM4 strains A DH B gene knockout and tet gene are knocked in identifies.1: knock out restructuring daughter bacteria liquid with the product of primer tet-in upstream and the amplification of tet-in downstream; 2: recon is with primer Gen-ADH B upstream and tet-in downstream amplified fragments; 3: recon is with the product of primer tet-in upstream and the amplification of Gen-ADH B downstream; 4: recon is with the product of primer Gen-ADH B upstream and the amplification of Gen-ADH B downstream; M: λ-EcoT14 I digest DNA Marker; 6: wild-type ZM4 is with the product contrast of primer tet-in upstream and the amplification of tet-in downstream; 7: primer Gen-ADH B upstream and the amplification contrast of tet-in downstream; Swimming lane 8: primer tet-in upstream and the amplification contrast of Gen-ADH B downstream; 9: primer Gen-ADH B upstream and the amplification contrast of Gen-ADH B downstream.

The PCR product sequencing result of Figure 19 recombinant bacterial strain ZM4-Δ ADH B.Dash area is after homologous recombination by ADH B Gene Replacement, to be Tet Gene Partial, and non-shaded portion is ZM4 genome

Figure 20 pcr amplification ADH A gene knock in fragment.M: λ Eco T14 DNA marker; 1: through twice PCR amplified production " ADH A-tet-ADH A ".

Figure 21 identifies and knocks in tetracycline gene tetthe position view of primer.

The PCR that Figure 22 zymomonas mobilis ZM4 strains A DH A gene knockout and tet gene are knocked in identifies.1: knock out restructuring daughter bacteria liquid with the product of primer tet-in upstream and the amplification of Gen-ADH A downstream; 2: wild-type ZM4 is with the negative control of primer tet-in upstream and the amplification of Gen-ADH A downstream; 3: recon is with the product of primer Gen-ADH A upstream and the amplification of Gen-ADH A downstream; 4: wild-type ZM4 is with the negative control of primer Gen-ADH A upstream and the amplification of Gen-ADH A downstream; 5: recon is with primer Gen-ADH A upstream and tet-in downstream amplified fragments; 6: wild-type ZM4 is with the negative control of primer Gen-ADH A upstream and the amplification of tet-in downstream; 7: recon is with the product of primer tet-in upstream and the amplification of tet-in downstream; Swimming lane 8: raw type ZM4 is with the negative control of primer tet-in upstream and the amplification of tet-in downstream; M: λ-EcoT14 I digest DNA Marker.

Embodiment

The structure of embodiment 1 expression plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET and pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T.

The construction strategy of zymomonas mobilis RecET expression plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET is as Fig. 1, Fig. 2, and Fig. 3, concrete steps are as follows:

1) intestinal bacteria DH10B extracting genome DNA.Get 2mL bacterium liquid, the precipitation after the centrifugal 2min of 12000rpm is washed with TE, uses the resuspended thalline of 1mLTE after centrifugal again.Add 53 μ L 10%SDS, mix, add 11 μ L 10mg/mL Proteinase Ks, mix 37 ℃ of incubation 1 h.Add 211 μ L 5mol/L NaCl, then add 146 μ L CTAB/NaCl(50 g/ L CTAB, 0.5 mol/ L NaCl), mix 65 ℃ of incubation 10min.Add isopyknic chloroform/primary isoamyl alcohol (24:1), mix, the centrifugal 5min of 12000rpm, retains supernatant.In supernatant, add isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1), mix, the centrifugal 5min of 12000rpm, retains supernatant.The Virahol that adds 0.6 times, mixes, and the centrifugal 5min of 12000rpm collects DNA precipitation, with centrifugal after 70% washing with alcohol DNA precipitation, abandons supernatant.With 100 μ L TE or deionized water dissolving DNA, adding final concentration is 20 μ g/mLRNaseA, 4 ℃ of preservations.

2) design primer ETpdc upstream and ETpdc downstream, the base that ETpdc upstream primer underscore identifies is pdc promoter gene homology, the base that ETpdc downstream primer underscore identifies and the connection carrier Kan of institute resistant gene homology with institute's connection carrier.Design primer Ppdc upstream and Ppdc downstream, wherein, the sequence of Ppdc upstream primer and Ppdc downstream primer underscore part and RecET DNA homolog.Its concrete sequence is as follows:

ETpdc upstream: 5 '- aTATATGGAGTAAGCAaTGAGCACAAAACCACTCTTCC-3 '

ETpdc downstream: 5 '- cCCACTGCAAGCTACCTtTATTCCTCTGAATTATCGATTACA-3 ',

Ppdc upstream: 5 '- tGTAATCGATAATTCAGAGGAATAAaGGTAGCTTGCAGTGGG-3 '

PpdcET downstream: 5 '- gGAAGAGTGGTTTTGTGCTCATtGCTTACTCCATATAT-3 '

The intestinal bacteria DH10B genomic dna of take is template, primer ETpdc upstream and ETpdc downstream amplification RecET gene fragment; Take pSUZM1a, pSUZM2a, pSUZM3a plasmid is template, primer Ppdc upstream and Ppdc downstream amplification vector skeleton Segment A, B, C.

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.

Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.。

As shown in Figure 4, amplification RecET gene size is 3.4Kb to gene fragment PCR result, conforms to expected results.Carrier framework A (pSUZM1a) after amplification, B (pSUZM2a), C (pSUZM3a) electrophoresis result be as Fig. 4, Fig. 5.A, B, C size are respectively 3.3Kb, 4.8Kb, and 4.4Kb, conforms to expection.

3) the PCR product that amplification obtains is above reclaimed to test kit with DNA and reclaim, method is with reference to its specification sheets.

4) do not rely on gene order and ligation clone (SLIC), concrete steps are as follows:

In the EP pipe of 3 (being numbered 1,2,3) 0.5mL, add respectively 4 μ L 5 * T4 DNA polymerase buffers (Fermentas), 0.1 μ L T4 DNA polysaccharase (5 U/ μ L Fermentas); No. 1 pipe adds 1 μ L A fragment, 1 μ L RecET gene fragment; No. 2 pipe adds 1 μ L B fragment, 1 μ L RecET gene fragment; No. 3 pipe adds 1 μ L C fragment, 1 μ L RecET gene fragment.Then 3 pipes all add respectively ddH ₂o is to 20 μ L.

Hatch 6 min for 37 ℃, the water-bath that then EP pipe is placed in to 70 ℃ is hatched 10min, termination reaction.Get the DNA of the above-mentioned T4 DNA of 8 μ L polysaccharase processing to the EP pipe of the new 0.5mL of another one, add 2 μ L 10 * annealing buffers (100mmol/L Tris, pH 8.0,1mol/L NaCl, 10mmol/L EDTA), 10 μ L ddH ₂o.15min is reacted in the water-bath that mixture is placed in to 75 ℃, then naturally cools to room temperature.

5) SLIC product transforms intestinal bacteria

10 μ L SLIC reaction product and 200 μ L competent escherichia coli cells are mixed, be placed in standing 30 min on ice, after 42 ℃ of heat shock 30 s, ice bath 2 min, add 0.8 mL SOC nutrient solution, 37 ℃ of vibration renewal cultivation 1 h, directly get 0.1 mL transformation mixture or 4, the whole thalline suspensions of the centrifugal collection of 000 rpm, coat on the agar plate that contains kantlex (50ng/mL), are inverted overnight incubation for 37 ℃.

6) plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET extracts

Inoculation bacterium colony, in 2mL LB substratum, is got 1.5 mL bacterium liquid in EP pipe, and centrifugal 2 min of 10,000 rpm, abandon supernatant liquor.Add 0.1mL solution I, fully mix, standing 5 min, add 0.2 mL solution II, mix, and put 5 min on ice bath, add 0.15 mL solution III, mix 20 min on rearmounted ice bath.Centrifugal 5 min of 10,000 rpm, get supernatant liquor, add the dehydrated alcohol of 2 times of volumes, after mixing in-20 ℃ of standing 30 min.Centrifugal 5 min of 10,000rpm, abandon supernatant liquor, with 70% ethanol, clean once, and the centrifugal 2min of 10000rpm, abandons supernatant, after precipitation is dry, are dissolved in 50 μ L ddH ₂in O or TE, add 37 ℃ of digestion 10min of 0.5 μ L10 mg/mL RNaseA, obtain recombinant plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET.

7) expression plasmid pSUZM1a-RecET, pSUZM2a-RecET, the PCR of pSUZM3a-RecET identifies

With pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET plasmid is template, by primer ETpdc upstream and ETpdc downstream amplification RecET gene fragment.

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.

Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.。

PCR product is carried out to electrophoresis detection result as Fig. 6, and amplified fragments size is 3.4Kb, conforms to expection.

8) expression plasmid pSUZM1a-RecET, pSUZM2a-RecET, the enzyme of pSUZM3a-RecET is cut evaluation

Adopt restriction enzyme ecor I (Fermentas) and ncoi double digestion method verifies restructuring pSUZM1a-RecET, pSUZM2a-RecET plasmid, and system is: ecor I 1 μ L, ncoi 1 μ L, recombinant plasmid 3 μ L, 10 * Tango Buffer, 2 μ L, ddH ₂o 3 μ L, hatch 3h for 37 ℃.PSUZM1a-RecET, pSUZM2a-RecET double digestion electrophoresis detection result be as Fig. 7, Fig. 8, and its DNA stripe size is respectively 5038bp+2742bp and 6176bp+2742bp, consistent with expection.

Adopt psti carries out single endonuclease digestion checking to pSUZM3a-RecET recombinant plasmid, and system is psti 1 μ L, recombinant plasmid 3 μ L, 10 * Tango Buffer, 2 μ L, ddH ₂o 3 μ L, hatch 3h for 37 ℃.Electrophoresis detection result is as Fig. 9, and two bar segment that enzyme is cut acquisition are 8039bp+439bp, consistent with expection.

The structure of example 2 zymomonas mobilis RecET expression plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T

The construction strategy of expression plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T is as Figure 10, and 11,12, concrete steps are as follows:

1) design primer 588p upstream and ETpdc downstream, the base of underscore sign and the pdc promoter gene homology of institute's connection carrier in 588p upstream primer, the Kan resistant gene homology of the base that in ETpdc downstream primer, underscore represents and institute's connection carrier.Design primer Ppdc upstream and Ppdc588 downstream, its two ends add the sequence of underscore part and RecE588T DNA homolog.Concrete sequence is as follows:

588p upstream: 5 '- aTATATGGAGTAAGCAaTGGATCCCGTAATCGTAGAA-3 '

ETpdc downstream: 5 '- cCCACTGCAAGCTACCTtTATTCCTCTGAATTATCGATTACA-3 '

Ppdc upstream: 5 '- tGTAATCGATAATTCAGAGGAATAAaGGTAGCTTGCAGTGGG-3 '

Ppdc588 downstream: 5 '- tTCTACGATTACGGGATCCATtGCTTACTCCATATAT-3 ',

The intestinal bacteria DH10B genomic dna of take is template, primer 588p upstream and ETpdc downstream amplification RecE588T gene fragment; Take pSUZM1a, pSUZM2a, pSUZM3a plasmid is template, primer Ppdc upstream and Ppdc588 downstream amplification vector skeleton fragment D, E, F.

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.

Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.

As shown in Figure 4, amplification RecE588T gene size is 1639bp to gene fragment PCR result, conforms to expected results.To carrier framework D (pSUZM1a), E (pSUZM2a), F (pSUZM3a) linear carrier electrophoresis result after amplification as Fig. 5,6, amplifying product size is 3.3Kb, 4.8Kb, 4.4Kb, conforms to expection.

2) the PCR product that amplification obtains is above reclaimed to test kit with DNA and reclaim, method is with reference to its specification sheets.

4) do not rely on gene order and ligation clone (SLIC), concrete steps are as follows:

In the EP pipe of 3 (being numbered 4,5,6) 0.5mL, add respectively 4 μ L 5 * T4 DNA polymerase buffers (Fermentas), 0.1 μ L T4 DNA polysaccharase (5 U/ μ L Fermentas); No. 4 pipe adds 1 μ L D fragment, 1 μ L RecE588T gene fragment; No. 5 pipe adds 1 μ L E fragment, 1 μ L RecE588T gene fragment; No. 6 pipe adds 1 μ L F fragment, 1 μ L RecE588T gene fragment.Then 3 pipes all add respectively ddH ₂o is to 20 μ L.

Hatch 6 min for 37 ℃, the water-bath that then EP pipe is placed in to 70 ℃ is hatched 10min, termination reaction.Get the DNA of the above-mentioned T4 DNA of 8 μ L polysaccharase processing to the EP pipe of the new 0.5mL of another one, add 2 μ L 10 * annealing buffers (100mmol/L Tris, pH 8.0,1mol/L NaCl, 10mmol/L EDTA), 10 μ L ddH ₂o.15min is reacted in the water-bath that mixture is placed in to 75 ℃, then naturally cools to room temperature.

5) SLIC product transforms intestinal bacteria

Method for transformation is identical with example 1.

6) plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T extracts

Extracting method is identical with example 1.

7) expression plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, the PCR of pSUZM3a-RecE588T identifies

With pSUZM1a-RecE588T, pSUZM2a-RecE588T, the PCR plasmid of pSUZM3a-RecE588T is template, and 588p upstream and ETpdc downstream are for being primer, and RecE588T gene fragment increases.

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.

Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.

PCR product is carried out to electrophoresis detection result as Fig. 6, and amplified fragments size is 1.6Kb, conforms to expection.

8) expression plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, the enzyme of pSUZM3a-RecE588T is cut evaluation

Adopt ecor I (Fermentas) and ncoi double digestion method verifies restructuring pSUZM1a-RecE588T, pSUZM2a-RecE588T carrier, and system is: ecor I 1 μ L, ncoi 1 μ L, recombinant plasmid 3 μ L, 10 * Tango Buffer, 2 μ L ddH ₂o 3 μ L, hatch 3h for 37 ℃.PSUZM1a-RecE588T, pSUZM2a-RecE588T double digestion electrophoresis detection result be as Figure 13, and 14, it is consistent with expection with 4965bp+2189bp that the DNA band that double digestion obtains is respectively 3274bp+2189bp.

Adopt psti carries out single endonuclease digestion checking to pSUZM3a-RecE588T recombinant plasmid, and system is psti 1 μ L, recombinant plasmid 3 μ L, 10 * Tango Buffer, 2 μ L, ddH ₂o 3 μ L, hatch 3h for 37 ℃.Electrophoresis detection result is as Figure 15, and two bar segment that single endonuclease digestion obtains are that 6129bp+439bp is consistent with expection.

Example 3 application of RecET recombination system expression plasmid in zymomonas mobilis

1) zymomonas mobilis ethanol dehydrogenase II(ADH B) gene knocks out

(1) electricity of RecET/RecE588T system expression plasmid zymomonas mobilis transforms: the single bacterium colony ATCC31821 of picking zymomonas mobilis is incubated at that in 5 mL RM substratum, (RM substratum 1000 mL contain: yeast powder 5.0 g, glucose 20.0 g, (NH ₄) ₂sO ₄1.0 g, KH ₂pO ₄1.0 g, MgSO ₄7H ₂o 0.5 g), obtain bacterium liquid and be all inoculated in 100 mL RM substratum, be cultured to OD ₆₀₀for 0.3-0.4.In 4 ℃ of 6000 rpm 10 min, collect thalline, with 10 mL 10% glycerine, clean thalline, in 4 ℃ of 6000 rpm 10 min, collect thalline, repeated washing once, is suspended in the thalline of collecting in 2 mL 10% glycerine, is prepared into competence.

Adopt the ECM830 pulse introducing apparatus of U.S. BTX company.By 1 μ g RecET/RecE588T system expression plasmid and 200 μ L z. mobiliselectric shock competence shocks by electricity after mixing under 2500 V, 200 Ω, 50 μ F conditions, after electric shock, bacterium liquid is transferred to rapidly to static recovery 3 h in 3mL RM substratum, get 100 μ L bacterium liquid and coat the flat board containing kantlex (200 μ g/mL), after 3d, first occur transformant.Wild-type zymomonas mobilis itself is without kalamycin resistance, and therefore screening the recombinant monoclonal growing on flat board is the zymomonas mobilis that has successfully imported RecET or RecE588T system.

(2) knock in the preparation of gene

Zymomonas mobilis self has penbritin and chlorampenicol resistant, do not there is tetracyclin resistance, RecET expression plasmid has kalamycin resistance, therefore selects the tetracycline marker gene of plasmid pBR322 as knocking in gene, is easy to detect the restructuring of RecET system.

Amplification be take tetracycline gene as main body, and two ends are with the double chain DNA fragment with ADH B DNA homolog.Amplify tetracycline gene, and at primer two ends, introduce ADH B gene upstream and downstream homology arm.The method that adopts two-wheeled PCR, first round amplification be take carrier pBR322 as template, produces the PCR product of the target gene homology arm of 30bp left and right; Second takes turns amplification, and to take the PCR product of first round amplification be template, makes homology arm reach 60bp.

Design primer Ptetr-ADH B-1 upstream, Ptetr-ADH B-1 downstream; 30bp homology arm (underscore sign) is introduced in upstream, primer Ptetr-ADH B-1, and 32bp homology arm is introduced in primer Ptetr-ADH B-1 downstream; Design primer Ptetr-ADH B-2 upstream, Ptetr-ADH B-2 downstream; Primer Ptetr-ADH B-2 upstream 30bp introduces 30bp homology arm, and 28bp homology arm (underscore sign) is introduced in downstream, primer Ptetr-ADH B-2.Concrete sequence is as follows:

Ptetr-ADH B-1 upstream: 5 '- tGAGAAAACGTCTCGAAAACGGGATTAAAAgCCACCTGACGTCTAAGAAAC-3 '

Ptetr-ADH B-1 downstream: 5 '- tGACGGTAGGCTTAATAGCCTGTAAAAATTTGtGTTCTGCCAAGGGTTGG-3

Ptetr-ADH B-2 upstream: 5 '- gGTGATTTTACTCGTTTTCAGGAAAAACTTtGAGAAAACGTCTCGAAAACG-3 '

Ptetr-ADH B-2 downstream: 5 '- tAATAGGCTTTAAATGGCAAATTATTTAtGACGGTAGGCTTAATAGCCTG-3 '

First round pcr amplification is done template with plasmid PBR322, and with Ptetr-ADH B-1 upstream, Ptetr-ADH B-1 downstream is primer, the tetracycline gene fragment 1 that amplification comprises target gene homology arm.Second takes turns PCR with fragment 1 template, and with Ptetr-ADH B-2 upstream, Ptetr-ADH B-2 downstream is primer, amplified fragments 2.

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.

Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.

After twice PCR amplification, tsiklomitsin upstream and downstream each with the 60bp(upstream with ADH B DNA homolog: GGTGATTTTACTCGTTTTCAGGAAAAACTTTGAGAAAACGTCTCGAAAACGGGATT AAAA, downstream: CAAATTTTTACAGGCTATTAAGCCTACCGTCATAAATAATTTGCCATTTAAAGCCT ATTA) the PCR product type after secondary amplification like " ADH B homology arm- tet-ADH B homology arm ", PCR result is as Figure 16, and product size is 1586bp, conforms to expection.After the purified reagent purifying of amplified production, for RecET restructuring, knock out target gene.

(3) linear dsdna fragment target practice zymomonas mobilis ADH B gene carries out homologous recombination.

Electricity translational movement fermentation single cell bacterium: picking contains RecET expression plasmid pSUZM2a-RecET, the single bacterium colony of pSUZM2a-RecE588T zymomonas mobilis is incubated in 5 mL RM substratum, obtain bacterium liquid and be all inoculated in 100 mL RM substratum, be cultured to OD ₆₀₀for 0.3-0.4.In 4 ℃ of 6000 rpm 10 min, collect thalline, with 10 mL 10% glycerine, clean thalline, in 4 ℃ of 6000 rpm 10 min, collect thalline, repeated washing once, is suspended in the thalline of collecting in 2 mL 10% glycerine, preparation competence.

Adopt the ECM830 pulse introducing apparatus of U.S. BTX company, by 600ng " ADH B- tet-ADH B " double-stranded linear DNA fragment and 100 μ L z. mobiliselectric shock competence is injected specification after mixing be in 2mm reaction little Chi, under 2500 V, 200 Ω, 50 μ F conditions, shock by electricity, after electric shock, bacterium liquid is transferred to rapidly to 3mL RMG substratum (containing yeast powder 5.0 g/L, glucose 20.0 g/L, KH2PO4 1.0 g/L) static renewal cultivation 16h in, make double chain DNA fragment under RecET homologous recombination system with motion fermentation single-gene group on ADH B gene carry out homologous recombination, tetracycline gene tet has replaced ADH B gene.After 16h, collecting bacterium liquid and coat containing kantlex (800 μ g/mL),, first there is transformant in the RMG agar plate of tsiklomitsin (90 μ g/mL) after 5d.

(4) evaluation of zymomonas mobilis ADH B disappearance recon

For checking knocks out result, whether homology arm and target gene that detection tetracycline gene carries have realized homologous recombination.At tetracycline gene interior location place, design pair of primers: tet-in upstream and tet-in downstream; At 287bp place, ADH B DNA homolog arm upstream and 839bp place, homology arm downstream genome Position Design pair of primers, screen primer location as Figure 17: Gen-ADH B upstream and Gen-ADH B downstream.Its concrete sequence is as follows:

Tet-in upstream: CTATGGCGTGCTGCTAGCGC

Tet-in downstream: TGGACCGCTGATCGTCACG

Gen-ADH B upstream: 5 '-AGGCAAAATCGGTAACCACAT-3 '

Gen-ADH B downstream: 5 '-GCGGCTCAAATAAGACGATA-3

The single bacterium colony transforming of take is template, with tet-in upstream and tet-in downstream, tet-in upstream and Gen-ADH B downstream, Gen-ADH B upstream and Gen-ADH B downstream, Gen-ADH B upstream and tet-in downstream primer matching method, recon is carried out to PCR checking, to get rid of electricity, turn over the linear fragment interference generation false positive existing in journey.

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.

Result shows, PCR all can amplify specific band, and meets expection size and conform to, and result is as Figure 18.To reclaim order-checking with tet-in upstream and Gen-ADH B downstream primer pcr amplification product, result is as Figure 19.

Result shows, at zymomonas mobilis genome ADH B gene upstream and downstream homology arm place, from genome 5 ' end GGTGATTTTACTCGTTTTCAGGAAAAACTTTGAGAAAACGTCTCGAAAACGGGATT AAAA, there is homologous recombination, by ADH B Gene Replacement, it is tet gene, at CAAATTTTTACAGGCTATTAAGCCTACCGTCATAAATAATTTGCCATTTAAAGCCT ATTA3 ' end, revert to normal zymomonas mobilis genome sequence, thereby make this bacterial strain obtain tetracycline resistance ability, proof has been replaced ADH B gene by building RecET, realized the gene knockout of zymomonas mobilis, and obtain ZM4-Δ ADH B bacterial strain.

2) zymomonas mobilis ethanol dehydrogenase I(ADH A) (1) amplification that knocks out of gene be take tetracycline gene as main body, and two ends are with the double chain DNA fragment with ADH A DNA homolog.Amplify tetracycline gene, and at two ends, introduce ADH A gene upstream and downstream homology arm.The method that adopts two-wheeled PCR, first round amplification be take carrier pBR322 as template, produces the PCR product of the target gene homology arm of 30bp left and right; Second takes turns amplification, and to take the PCR product of first round amplification be template, makes homology arm reach 60bp.Design primer Ptetr-ADH A-1 upstream, Ptetr-ADH A-1 downstream, 31bp homology arm (underscore sign) is introduced in upstream, primer Ptetr-ADH A-1, and 30bp homology arm is introduced in primer Ptetr-ADH A-1 downstream; Ptetr-ADH A-2 upstream, Ptetr-ADH A-2 downstream, primer Ptetr-ADH A-2 upstream 30bp introduces 29bp homology arm, and 30bp homology arm (underscore sign) is introduced in downstream, primer Ptetr-ADH A-2.Concrete sequence is as follows:

Ptetr-ADH A-1 upstream:

5’-GAAAAAAGCTTGGATAGCGGCTTATAGCAACGCCACCTGACGTCTAAGAAAC-3’

Ptetr-ADH A-1 downstream:

5 '-CGTTTTCCCTATATTCGCAAGATGTATGTCTGTTCTGCCAAGGGTTGG-3 ' Ptetr-ADH A-2 upstream:

5’-TAGCGATCGCCGAATAGAAGGCATGAGAAGAAAAAAGCTTGGATAGCGG-3’

Ptetr-ADH A-2 downstream:

5’-TAACTTTCTGGATCGTAATCGGCTGGCAATCGTTTTCCCTATATTCGCAAG-3’

PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.After twice PCR amplification, tsiklomitsin upstream and downstream is respectively with the 60bp with ADH A DNA homolog, and the PCR product type after secondary amplification is like " ADH A-tet-ADH A ", and PCR result is as Figure 20, and product size conforms to expection for 1586bp.After the purified reagent purifying of amplified production, for RecET restructuring, knock out ADH A gene.

(2) linear dsdna fragment target practice zymomonas mobilis ADH A gene carries out homologous recombination.Electric shock translational movement fermentation single cell bacterium method is the same.(3) checking that is accredited as of zymomonas mobilis ADH A disappearance recon knocks out result, and whether homology arm and target gene that detection tetracycline gene carries have realized homologous recombination.First at tetracycline gene indoor design checking primer, at the upstream and downstream design primer of ADH A gene, design primer location, as Figure 21, will carry out PCR evaluation to mutant strain after each primer pairing simultaneously.

At tetracycline gene interior location place, design pair of primers: tet-in upstream and tet-in downstream; At 131bp place, ADH A DNA homolog arm upstream and 149bp place, homology arm downstream genome Position Design pair of primers: Gen-ADH A upstream and Gen-ADH A downstream.Its concrete sequence is as follows:

Tet-in upstream: 5 '-CTATGGCGTGCTGCTAGCGC-3 '

Tet-in downstream: 5 '-TGGACCGCTGATCGTCACG-3 '

Gen-ADH A upstream: 5 '-CGCTATGTTGAATATGGGCA-3 '

Gen-ADH A downstream: 5 '-CTCTCAATCCGCTGCCTT-3 '

The single bacterium colony transforming of take is template, with tet-in upstream and tet-in downstream, tet-in upstream and Gen-ADH A downstream, Gen-ADH A upstream and Gen-ADH A downstream, Gen-ADH A upstream and tet-in downstream primer matching method, recon is carried out to PCR checking, to get rid of electricity, turn in journey because the linear fragment existing disturbs generation false positive.PCR reaction system: PrimeSTAR MAX (5 U/ μ L) 12.5 μ L, upstream primer 1.5 μ L, downstream primer 1.5 μ L, template DNA 1 μ L, adds water to 25 μ L.Pcr amplification condition is: 94 ℃ of denaturation 3min, and 98 ℃ of 10 s, 58 ℃ of annealing 30 s, 72 ℃ are extended 1min 30s, 35 circulations of increasing.Last 72 ℃ are fully extended 10 min.Result demonstration, PCR all can amplify specific band, and meets the big or small fragment of expection, as Figure 22.Result shows, at zymomonas mobilis genome ADH A gene upstream and downstream homology arm place, there is homologous recombination, by ADH A Gene Replacement, it is tet gene, thereby make this bacterial strain obtain tetracycline resistance ability, proof has been replaced ADH A gene by building RecET, has realized the gene knockout of zymomonas mobilis, and has obtained ZM4-Δ ADH A bacterial strain.

Sequence table

SEQUENCE LISTING

<110> Sichuan University

<120> zymomonas mobilis RecET recombination system expression plasmid and construction process and application

<160> 22

<210> 1

<211> 38

<212> DNA

<213> Artificial sequence

<400> 1

atatatggag taagcaatga gcacaaaacc actcttcc 38

<210> 2

<211> 42

<212> DNA

<213> Artificial sequence

<400> 2

cccactgcaa gctaccttta ttcctctgaa ttatcgatta ca 42

<210> 3

<211> 42

<212> DNA

<213> Artificial sequence

<400> 3

tgtaatcgat aattcagagg aataaaggta gcttgcagtg gg 42

<210> 4

<211> 38

<212> DNA

<213> Artificial sequence

<400> 4

ggaagagtgg ttttgtgctc attgcttact ccatatat 38

<210> 5

<211> 37

<212> DNA

<213> Artificial sequence

<400> 5

atatatggag taagcaatgg atcccgtaat cgtagaa 37

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence

<400> 6

cccactgcaa gctaccttta ttcctctgaa ttatcgatta ca 42

<210> 7

<211> 42

<212> DNA

<213> Artificial sequence

<400> 7

tgtaatcgat aattcagagg aataaaggta gcttgcagtg gg 42

<210> 8

<211> 37

<212> DNA

<213> Artificial sequence

<400> 8

ttctacgatt acgggatcca ttgcttactc catatat 37

<210> 9

<211> 51

<212> DNA

<213> Artificial sequence

<400> 9

tgagaaaacg tctcgaaaac gggattaaaa gccacctgac gtctaagaaa c 51

<210> 10

<211> 50

<212> DNA

<213> Artificial sequence

<400> 10

tgacggtagg cttaatagcc tgtaaaaatt tgtgttctgc caagggttgg 50

<210> 11

<211> 51

<212> DNA

<213> Artificial sequence

<400> 11

ggtgatttta ctcgttttca ggaaaaactt tgagaaaacg tctcgaaaac g 51

<210> 12

<211> 50

<212> DNA

<213> Artificial sequence

<400> 12

taataggctt taaatggcaa attatttatg acggtaggct taatagcctg 50

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

ctatggcgtg ctgctagcgc 20

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence

<400> 14

tggaccgctg atcgtcacg 19

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

aggcaaaatc ggtaaccaca t 21

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

gcggctcaaa taagacgata 20

<210> 17

<211> 52

<212> DNA

<213> Artificial sequence

<400> 17

gaaaaaagct tggatagcgg cttatagcaa cgccacctga cgtctaagaa ac 52

<210> 18

<211> 48

<212> DNA

<213> Artificial sequence

<400> 18

cgttttccct atattcgcaa gatgtatgtc tgttctgcca agggttgg 48

<210> 19

<211> 49

<212> DNA

<213> Artificial sequence

<400> 19

tagcgatcgc cgaatagaag gcatgagaag aaaaaagctt ggatagcgg 49

<210> 20

<211> 51

<212> DNA

<213> Artificial sequence

<400> 20

taactttctg gatcgtaatc ggctggcaat cgttttccct atattcgcaa g 51

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

cgctatgttg aatatgggca 20

<210> 22

<211> 18

<212> DNA

<213> Artificial sequence

<400> 22

ctctcaatcc gctgcctt 18

Claims (3)

1. a class can be applied the expression plasmid of RecET recombination system in zymomonas mobilis: pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET, comprise zymomonas mobilis endogenous gene promotor, selection markers gene, recE and recT gene; And expression plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T, comprise zymomonas mobilis endogenous gene promotor, selection markers gene, recE588 (588 amino acid whose sequences of its albumen n end of recE genes encoding are deleted, referred to as recE588) fragment and recT gene.

2. according to the plasmid described in right 1, it is characterized in that:

1) pSUZM1a-RecET comprises from replication orgin oriC on zymomonas mobilis karyomit(e), from the replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of zymomonas mobilis pyruvic carboxylase pdc gene, from recE gene and the recT gene of intestinal bacteria DH10B;

2) pSUZM2a-RecET comprise replication protein sequence from zymomonas mobilis endogenous plasmid pZZM401, come from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of zymomonas mobilis pyruvic carboxylase pdc gene, from recE gene and the recT gene of intestinal bacteria DH10B;

3) pSUZM3a-RecET comprises from the replication protein sequence on motion fermentation endogenous plasmid pZZM402, from the replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of zymomonas mobilis pyruvic carboxylase pdc gene, from recE gene and the recT gene of intestinal bacteria DH10B;

4) pSUZM1a-RecE588T comprise replication protein sequence from zymomonas mobilis endogenous plasmid pZZM401, come from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of zymomonas mobilis pyruvic carboxylase pdc gene, from recE588 fragment and the recT gene of intestinal bacteria DH10B;

5) pSUZM2a-RecE588T comprise come from zymomonas mobilis endogenous plasmid pZZM401 replication protein sequence, come from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc from zymomonas mobilis pyruvic carboxylase pdc gene, from recE588 fragment () and the recT gene of intestinal bacteria DH10B;

6) pSUZM3a-RecE588T comprise the replication protein sequence that comes from motion fermentation endogenous plasmid pZZM402, come from replication orgin on plasmid pUC18, kantlex selection markers gene, from the promotor Ppdc of zymomonas mobilis pyruvic carboxylase pdc gene, from recE588 fragment and the recT gene of intestinal bacteria DH10B.

3. according to the plasmid described in right 1, its construction process is as follows:

1) pSUZM1a-RecET, pSUZM2a-RecET, the construction process of pSUZM3a-RecET

(1) with zymomonas mobilis expression plasmid pSUZM1a(, contain replication orgin oriC on zymomonas mobilis karyomit(e) respectively, replication orgin on plasmid pUC18, the constitutive gene promotor Ppdc of zymomonas mobilis), the replication orgin that pSUZM2a(contains zymomonas mobilis endogenous plasmid pZZM401 and DNA replication dna enzyme gene order, replication orgin on plasmid pUC18, the constitutive gene promotor Ppdc of zymomonas mobilis), the replication orgin that pSUZM3a(contains zymomonas mobilis endogenous plasmid pZZM402 and DNA replication dna enzyme gene order, replication orgin on plasmid pUC18, the constitutive gene promotor Ppdc of zymomonas mobilis) be template, with following primer 5 '-TGTAATCGATAATTCAGAGGAATAAAGGTAGCTTGCAGTGGG-3 ' and 5 '-GGAAGAGTGGTTTTGTGCTCATTGCTTACTCCATATAT-3 ', carry out pcr amplification, obtain carrier framework Segment A (pSUZM1a), B (pSUZM2a) and C(pSUZM3a),

(2) take intestinal bacteria DH10B genomic dna is template, with following primer 5 '-ATATATGGAGTAAGCAATGAGCACAAAACCACTCTTCC-3 ' and 5 '-CCCACTGCAAGCTACCTTTATTCCTCTGAATTATCGATTACA-3 ', carry out pcr amplification, the tandem gene fragment recET(of the RecET system that obtains encoding comprises recE and recT gene);

(3) carrier framework Segment A, B and C mole are mixed after running gel reclaims etc. respectively with gene fragment recET respectively, mixing fragment processes with T4 archaeal dna polymerase, then carry out annealing reaction restructuring, transform intestinal bacteria, obtain recombinant plasmid pSUZM1a-RecET, pSUZM2a-RecET, pSUZM3a-RecET;

2) pSUZM1a-RecE588T, pSUZM2a-RecE588T, the construction process of pSUZM3a-RecE588T

(1) take respectively zymomonas mobilis expression plasmid pSUZM1a, pSUZM2a, pSUZM3a is template, with following primer 5 '-TGTAATCGATAATTCAGAGGAATAAAGGTAGCTTGCAGTGGG-3 ' and 5 '-TTCTACGATTACGGGATCCATTGCTTACTCCATATAT-3 ', carry out pcr amplification, obtain carrier framework fragment D (pSUZM1a), E (pSUZM2a) and F (pSUZM3a);

(2) take intestinal bacteria DH10B genomic dna is template, with following primer 5 '-ATATATGGAGTAAGCAATGGATCCCGTAATCGTAGAA-3 ' and 5 '-TTCTACGATTACGGGATCCATTGCTTACTCCATATAT-3 ', carry out pcr amplification, the tandem gene fragment recE588T(of the RecET system that obtains encoding comprises recE588 and recT gene);

(3) carrier framework fragment D, E and F mole are mixed after running gel reclaims etc. respectively with gene fragment recE588T respectively, mixing fragment processes with T4 archaeal dna polymerase, then carry out annealing reaction restructuring, transform intestinal bacteria, obtain recombinant plasmid pSUZM1a-RecE588T, pSUZM2a-RecE588T, pSUZM3a-RecE588T.