CN114350615B

CN114350615B - STAT2 gene deletion cell strain and preparation method and application thereof

Info

Publication number: CN114350615B
Application number: CN202111585927.2A
Authority: CN
Inventors: 许傲天; 白晓; 张起起
Original assignee: Beijing Mgga Technology Co ltd
Current assignee: Beijing Mgga Technology Co ltd
Priority date: 2021-12-20
Filing date: 2021-12-20
Publication date: 2024-04-16
Anticipated expiration: 2041-12-20
Also published as: CN114350615A

Abstract

The invention relates to the technical fields of biology and genetics, and discloses a STAT2 gene deletion cell strain, a preparation method and application thereof. The HEK293 cells are selected to establish stable cell lines, so that the HEK293 cell line has the advantages of high yield and no tumorigenicity, saves the time for virus production and preparation, improves the virus recovery efficiency, and reduces the production cost. The invention uses CRISPR/Cas9 technology to perform specific targeted knockout on STAT2 genes of cells to obtain the cell strain with STAT2 gene deletion, the method is simple, the replicability is strong, the knockout efficiency is extremely high, and in a preferred embodiment, the target cells can be rapidly and intuitively screened by using a gene knockout system containing a report vector.

Description

STAT2 gene deletion cell strain and preparation method and application thereof

Technical Field

The invention relates to the technical fields of molecular biology and genetics, in particular to a STAT2 gene deletion cell strain, a preparation method and application thereof.

Background

CRISPR-Cas9 is an adaptive immune defense that bacteria and archaea form during long-term evolution can use against invasive viruses and foreign DNA. The CRISPR-Cas9 gene editing technology is a technology for carrying out specific DNA modification on a target gene, and is also a leading edge method in gene editing. The principle and the foremost key technology of the present invention is that one Cas9 nuclease can accomplish recognition and cleavage of target double-stranded DNA using guide RNAs (grnas). The technology is one of the gene therapy technologies with the most clinical and application prospects due to the advantages of high mutation efficiency, low cost, wide application range and the like.

The virus packaging is a process of co-transfecting plasmids containing genes required by virus replication into host cells by using transfection reagents such as liposome and the like, providing energy and raw material sites by using the host cells, and producing viruses with infectious capability, and is commonly used in the fields of construction of stable cell lines, gene therapy, cell therapy and the like. A common cell line currently used for viral packaging is 293T cells. The cell has the characteristics of good transfection efficiency, high virus yield and the like. However, the SV40 largeT antigen exists in the cell, and a certain tumorigenic risk exists, so when 293T cells are used as host cells for virus packaging, the SV40 largeT antigen needs to be removed in a subsequent purification step, and meanwhile, the protein is detected in a quality control link, so that the treatment flow is increased, and the virus packaging cost is increased.

HEK293 cells are also called human embryonic kidney cells 293, are cell lines derived from the human embryonic kidney cells, have the characteristics of high transfection efficiency, easy culture and the like, rarely express endogenous receptors required by extracellular ligands, and are cell lines very suitable for expression research of exogenous genes.

At present, cell lines disclosing the STAT2 gene deletion have not been studied nor have the toxigenic efficiency of any STAT2 gene deleted cell lines been disclosed.

Disclosure of Invention

The invention aims to solve the problems that the prior art has low virus production efficiency, low virus packaging efficiency, tumor risk of host cells and the like, and provides a STAT2 gene deletion cell strain, a construction method, application and a virus packaging method, wherein the cell strain is a STAT2 gene deletion cell strain, and can be used for stably and efficiently packaging viruses when being used in the packaging of the viruses, and the virus titer is high.

In order to achieve the above object, the present invention provides, in one aspect, a cell strain which is a STAT2 gene-deleted cell strain.

In a second aspect, the present invention provides a method for constructing a STAT2 gene-deleted cell line, the method comprising:

(1) Transfecting target cells by using a carrier system for STAT2 gene knockout to obtain transfected target cells;

(2) Carrying out monoclonal screening on the transfected target cells to obtain monoclonal, and carrying out PCR identification on the monoclonal to obtain positive clones;

(3) Performing amplification culture on the positive clone to obtain a STAT2 gene deletion cell strain;

wherein the vector system comprises an expression vector capable of expressing Cas9, sgRNA1, and sgRNA2.

In a third aspect the invention provides a cell line prepared by the method as described above.

In a fourth aspect, the invention provides the use of a cell line as described above in packaging or propagating a virus.

In a fifth aspect the invention provides a method of packaging a virus, the method comprising packaging the virus into a cell line as hereinbefore described.

In a sixth aspect, the invention provides the use of a method or agent for knocking out STAT2 gene to increase cellular production.

Through the technical scheme, the HEK293 cell strain with the STAT2 gene deletion is constructed by using the CRISPR/Cas9 technology for the first time, and various viruses such as slow viruses, adenoviruses and the like can be packaged or expanded, so that the HEK293 cell strain can be used as an ideal cell strain for packaging (expanding) viruses. Specifically, the beneficial technical effects obtained by the invention are as follows:

(1) The STAT2 gene-deleted cell strain can efficiently package slow viruses and efficiently propagate adenoviruses.

(2) The invention selects HEK293 cells to establish stable cell lines, the cells per se have higher toxin production than the common 293T cells, and the cells do not contain SV40 largeT antigen, thereby solving the problem of tumorigenicity. In addition, the cell strain does not contain tumorigenic genes, so that the steps of downstream purification and quality control detection can be reduced, the time for virus production and preparation is saved, the virus recovery efficiency is improved, and the production cost is reduced.

(3) The stable cell strain plasmid obtained by the invention has high transfection efficiency and high toxin-expelling titer, and can greatly reduce the production cost;

(4) In a preferred embodiment, the invention uses CRISPR/Cas9 technology to perform specific targeted knockout on STAT2 genes of cells to obtain a cell strain with STAT2 gene deletion, and has the advantages of simple method, strong replicability and extremely high knockout efficiency; the invention designs and uses two sgRNAs aiming at STAT2 genes, and can realize the deletion of large fragments of the STAT2 genes; the gene knockout system provided by the invention contains the report carrier, and the cells can express fluorescence only when Cas9, sgRNA1 and sgRNA2 can act (namely, when STAT2 gene fragments can be knocked out successfully), so that whether the knockout is successful can be judged quickly and intuitively by observing GFP fluorescence of the cells, and the screening efficiency is improved greatly.

Drawings

FIG. 1 is a PCR identification electrophoretogram of the STAT2 gene primer designed in the step (1) of example 1. M:2000DNA marker,1: STAT2 gene fragment, 2: a negative control;

FIG. 2 is an electrophoretogram of the sgRNA1 expression vector and the sgRNA2 expression vector constructed in the step (2) (c) of example 1. M:15000DNA marker,1: sgRNA1 expression vector, 2: an sgRNA2 expression vector;

FIG. 3 is a PCR electrophoresis chart of the backbone vector pIRES-EGFP (Clontech Co.) (T1) in step (3) of example 1. M:15000DNA marker,1: PCR product of backbone vector pIRES-EGFP, 2: a PCR negative control using sterile water as a template;

FIG. 4 is a PCR electrophoresis chart of T2 in the step (3) of example 1. M. 2000DNA marker,1: PCR negative control with sterile water as template, 2: PCR product of T2

FIG. 5 is a schematic diagram of CMV-sgRNA1 target sequence-PolyA-sgRNA 2 target sequence-IRES-GFP reporter vector in example 1;

FIG. 6 is a PCR identification electrophoretogram of HEK293 sorting monoclonal in example 1, step (5). M: DNA marker, WT: genome PCR products were extracted from the blank cells, 1-9: extracting PCR products of genome from 9 clones;

FIG. 7 is a sequence alignment analysis of the sequencing results of the HEK293 sorting monoclonal PCR products in step (5) of example 1.

FIG. 8 is a map of a commercially available lentiviral packaging plasmid used for lentiviral packaging in step (1) of example 2. PLVX-mCherry-C1; PLP1; c: PLP2; PLP-VSVGC;

FIG. 9 is a graph showing the transfection effect of lentiviral packaging plasmid transfection of example 2, step (1), on three different cell lines. A: mcherry fluorescence of experimental group 1, B: bright field, C: mcherry fluorescence D of experimental group 2: bright field, E, of experimental group 2: mcherry fluorescence, F, of experimental group 3: bright field of experimental group 3;

FIG. 10 is a graph showing the effect of adenovirus infection on three different cell lines in step (2) of example 2. A: GFP fluorescence of experimental group 1, B: bright field, C: GFP fluorescence D of experimental group 2: bright field, E, of experimental group 2: GFP fluorescence of experimental group 3, F: bright field of experimental group 3;

FIG. 11 is a graph of packaged lentiviral titres for lentiviral packaging plasmid transfection of step (3) of example 2 for three different cell lines;

FIG. 12 is a graph showing the viral titers of adenovirus infection of three different cell lines in step (4) of example 2.

Detailed Description

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.

The various expression elements or sequences described herein are shown and connected in 5 'to 3' order, unless specifically indicated.

In the present invention, the sgrnas 1 and 2 refer to sgrnas that recognize different target sequences on STAT2 gene, i.e., guide RNAs. The sgrnas contain recognition sequences and framework sequences.

In the invention, the sgRNA1 target sequence and the sgRNA2 target sequence refer to two different targets on the STAT2 gene, and can be respectively identified by the sgRNA1 and the sgRNA2.

In the invention, the sgRNA1 target sequence or the sgRNA2 target sequence can be various sequences aiming at STAT2 genes, and the STAT2 gene knockout can be realized through CRISPR/Cas 9.

The first aspect of the invention provides a cell strain, which is a STAT2 gene deletion cell strain.

In some embodiments of the invention, the cell line is a STAT2 gene deleted HEK293 cell line. STAT2 gene sequences of HEK293 cells such as NCBI ID: u18671.1.

In the present invention, the method and conditions for cell transfection may be selected conventionally in the art, and those skilled in the art may adjust the method and conditions for cell transfection according to actual situations, and will not be described herein.

In the present invention, the monoclonal screening is a conventional technical means in the art, and may be at least one of limiting dilution method and flow cytometry sorting technology, for example.

In the present invention, the expansion culture is a conventional technical means in the art, and a person skilled in the art can adjust the expansion culture according to the situation, which is not described herein.

In some embodiments of the invention, the target cell is a HEK293 cell.

In the present invention, the expression vector may be constructed by methods conventional in the art, for example, cas9, sgRNA1, and sgRNA2 may be expressed in the same expression vector or may be expressed in different expression vectors. Preferably, the Cas9, sgRNA1, sgRNA2 are expressed in three expression vectors, respectively.

When the Cas9, the sgRNA1, the sgRNA2 are expressed in three expression vectors, respectively, the vectors include a Cas9 expression vector, a sgRNA1 expression vector, a sgRNA2 expression vector.

In the present invention, the "vector" used in the expression vector may be various vectors known in the art, such as various plasmids commercially available, e.g., pIRES-EGFP (Clontech company) plasmid, pEGFP-C1 (Clontech company) plasmid, etc.

In some embodiments of the invention, the Cas9 expression vector is commercially available, preferably at least one of PX330 (ADDGENE Plasmid # 42230), PX165 (ADDGENE Plasmid # 48137), PX459 (ADDGENE Plasmid # 62988).

In some embodiments of the invention, the "vector" used in the sgRNA1 expression vector and the sgRNA2 expression vector is a plasmid containing the sgRNA backbone sequence, which may be obtained commercially or by self-synthesis. Preferably, the "vector" used in the sgRNA1 expression vector and the sgRNA2 expression vector is obtained by the following method: the DNA sequence of the synthesized U6-sgRNA backbone sequence (SEQ ID NO: 11) was cloned into a PUC-18T vector (Bomeid Co.) to give a PUC-sgRNA plasmid.

In the present invention, the expression vector may be constructed by means conventional in the art, for example, it may be obtained by performing cleavage with various endonucleases more capable of having cleavage sites at the multiple cloning site of the vector to obtain a linear plasmid, ligating a double-stranded DNA fragment having cohesive ends of the same endonuclease, or ligating a double-stranded DNA fragment having cohesive ends generated by direct annealing of a pair of primers (oligo).

In some embodiments of the present invention, taking the construction of the sgRNA1 expression vector as an example, the construction methods of the sgRNA1 expression vector and the sgRNA2 expression vector are as follows: a pair of primers, sgRNA1F and sgRNA1R, was designed based on the target sequence of sgRNA1, annealed to give an annealed product (double-stranded DNA fragment with cohesive ends), and the annealed product was ligated with the digested linear plasmid containing the backbone sequence of sgRNA.

In the present invention, the methods for obtaining the sgRNA1 target sequence and the sgRNA2 target sequence are methods commonly used in the art, and will not be described herein.

In the present invention, the person skilled in the art can select the recognition sequences of sgrnas 1, 2 and design the sgrnas 1F and R, sgRNA F and 2R by means of conventional techniques in the art.

In some embodiments of the invention, the sgRNA1 target sequence can be as set forth in SEQ ID NO:3, the sequence of sgRNA1F can be as shown in SEQ ID NO:5, the sequence of sgRNA1R can be as set forth in SEQ ID NO:6, the recognition sequence of the sgRNA1 can be shown as SEQ ID NO. 9; the sgRNA2 target sequence can be as set forth in SEQ ID NO:4, the sequence of sgRNA2F can be as shown in SEQ ID NO:7, the sequence of sgRNA2R can be as shown in SEQ ID NO:8, the recognition sequence of sgRNA2 can be shown as SEQ ID NO. 10.

In some embodiments of the invention, the gene knockout system may include a reporter vector in order to increase the efficiency of constructing STAT2 gene-deleted cell lines. In the present invention, the report carrier means: it may be indicated whether the CRISPR/Cas9 system has a reporter vector that cleaves DNA double strands.

When the vector system comprises a reporter vector, the monoclonal screen in step (2) is a positive monoclonal screen. Wherein, when the reporter vector contains fluorescent protein genes (such as GFP, RFP, etc.), the "positive clone" refers to cells expressing fluorescence; if the report vector does not contain fluorescent protein genes, the report vector is called positive clone, which has a cleavage band and is sequenced to have allele deletions when detected by methods such as PCR identification, sequencing identification and the like. The positive monoclonal screening can be conventional technical means in the field, for example, positive monoclonal screening can be performed by using a flow cytometer.

In the present invention, the reporting carrier may be a conventional choice in the art. Preferably, in order to further increase the efficiency of constructing STAT2 gene-deleted cell lines, the reporter vector contains a promoter, a fluorescent protein expression element and an sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element located between the promoter and the fluorescent protein expression element. When the report vector contains the elements, if any one of sgRNA1, sgRNA2 or Cas9 proteins cannot function (i.e. does not have knockout activity) when constructing a cell strain with STAT2 gene deletion, the transcription termination sequence in the report vector will terminate transcription, and the fluorescent protein expression element on the report vector cannot be transcribed, so that the cell cannot express the fluorescent protein. Only when Cas9 protein and sgRNA1, sgRNA2 can act simultaneously (i.e., have knockout activity), the transcription termination sequence in the sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element of the reporter vector is excised, and under the DNA repair mechanism of the non-homologous end connection of the cell itself, the promoter in the vector is directly connected with the following fluorescent expression element to start transcription of the fluorescent expression element, so that GFP fluorescent protein can be successfully expressed. Because the two sgRNA target sequences in the sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element are target sequences for knocking out the sgRNA1 and the sgRNA2 on the target gene respectively, whether the Cas9 protein, the sgRNA1 and the sgRNA2 can all act (namely whether have knocking-out activity) can be judged by observing GFP fluorescence, so that the probability of STAT2 gene knocking-out is improved, and the cell strain with the deleted STAT2 gene is obtained efficiently.

In some embodiments of the invention, the promoter is at least one of a CMV promoter, an EF1a promoter, and a CAG promoter.

In the present invention, the transcription termination sequence may be a sequence commonly used in the art that can terminate transcription, and may be, for example, a transcription termination signal sequence PolyA and/or WPRE. In some embodiments of the invention, the transcription termination sequence is PolyA.

In the present invention, the transcription termination sequences such as PolyA and WPRE are common sequences in the field, and will not be described herein.

In some embodiments of the invention, the fluorescent protein expression element contains an IRES sequence and a fluorescent protein encoding gene.

In some embodiments of the invention, the fluorescent protein encoding gene is at least one of a GFP gene, an RFP gene, a Mcherry gene, and a YFP gene.

In some embodiments of the invention, the fluorescent protein expression element is an IRES-GFP expression element.

As the "vector" used in the report vector of the present invention, various vectors known in the art, such as various plasmids commercially available, pIRES-EGFP (Clontech Co.), pEGFP-C1 (Clontech Co.), etc., can be used. Preferably, the "vector" used in the reporter vector of the present invention is a plasmid containing a promoter and an IRES-GFP expression element, wherein the promoter is preferably a CMV promoter, EF1a promoter or CAG promoter, and more preferably a CMV promoter or EF1a promoter. Further preferred, the reporter vector contains a CMV promoter, an IRES-GFP element and an sgRNA1 target sequence-PolyA-sgRNA 2 target sequence element located between the CMV promoter and the IRES-GFP element.

In the present invention, the construction of the reporter vector may be a method commonly used in the art, for example, the vector and the sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element may be ligated by an overlap PCR method.

In the present invention, in order to prevent the elements from being too close to each other and thus to affect repair after cleavage, the elements are separated by a number of base sequences, and the selection of the base sequences is not particularly limited as long as the elements can be separated, and they are well known to those skilled in the art and will not be described in detail herein. For example, in the sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element, the sgRNA1 target sequence, transcription termination sequence, and the sgRNA2 target sequence are separated by some base sequences.

In some preferred embodiments of the invention, the reporter vector is made by inserting an sgRNA1 target sequence-PolyA-sgRNA 2 target sequence element between the CMV promoter and IRES-GFP element of a pIRES-EGFP (Clontech) vector.

In some embodiments of the invention, the virus is a lentivirus and/or adenovirus.

In a fifth aspect the invention provides a method of packaging a virus, the method comprising mixing the virus with a cell line as hereinbefore described.

In some embodiments of the invention, the method comprises: the plasmid packaging the virus was mixed by transfection with cell lines as described previously. Among them, the "plasmid" used for the plasmid for packaging virus can be selected as usual in the art.

In some embodiments of the invention, the virus is a lentivirus.

In some embodiments of the invention, the method may further comprise the step of collecting the virus. The manner of collecting the virus may be filtration and centrifugation.

The invention also provides a method for propagating adenovirus, which comprises the step of mixing and culturing the adenovirus and the cell strain.

In a sixth aspect, the invention provides the use of a method or agent for knocking out STAT2 gene to increase cellular production. "cell yield" means the yield of virus when the cells are used for virus culture. "cell" refers to a cell in which the STAT2 gene has been knocked out.

The present invention will be described in detail by examples.

In the examples which follow, unless otherwise indicated, the products used are purchased from regular chemical or biological reagent suppliers, and are all methods commonly used in the art.

In the examples below, the viral titers of lentiviral packages and adenovirus propagation were measured by limiting dilution.

In the examples below, unless otherwise specified, the sequences used and synthesized were all assigned to Bomaide, and the sequences were all assigned to Bomaide.

In the following examples, the cell culture medium used was DMEM medium containing 10% fes unless otherwise specified.

The composition ratio of the resistant (amp+ ampicillin) LB medium is as follows: 10g/L peptone, 5g/L yeast extract, 10g/L, amp +100ug/ml sodium chloride. When the resistant (amp+) LB medium is solid, it also contains 15g/L agar.

The pUC-sgRNA plasmid was prepared by the following method: the DNA sequence of the U6-sgRNA backbone sequence (SEQ ID NO: 11) was synthesized and cloned by PCR cloning onto a PUC18-T vector (purchased from Bomeid Co.) to give a PUC-sgRNA plasmid.

DNA sequence of U6-sgRNA backbone sequence:

GTAATACGACTCACTATAGGGCGAATTGGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCTGTCTTCAACACAAGAAGACACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGGATCC(SEQ IDNO.:11)

the preparation method of the linear PUC-sgRNA plasmid comprises the following steps: the PUC-sgRNA plasmid was digested with BbsI.

Transformation and identification of the sgRNA1 expression vector and the sgRNA2 expression vector were performed according to the following methods:

(1) Bacterial transformation

Preparation (advance-30 min): competent cells Trans-T1 (purchased from full gold Co.) (100. Mu.L per tube) stored in EP tubes were removed from a-80℃refrigerator and after thawing on ice (about 15 min), half (50. Mu.L) of each tube was split into a new EP tube; opening two water baths at 42 ℃ and 37 ℃; the solid LB medium with resistance (Amp+) is put into a incubator at 37 ℃ for preheating.

Each tube of competent cells Trans-T1 (50. Mu.L) was subjected to the following procedure: adding 10 μl of plasmid (i.e. sgRNA1 expression vector or sgRNA2 expression vector or report vector), standing on ice for 10min, placing in a water bath at 42deg.C, heat-shocking for 40s, rapidly transferring to ice, standing for 2min, adding 500 μl of antibiotic-free LB medium, placing in a water bath at 37deg.C, centrifuging at 12,000rpm for 2min, discarding supernatant, re-suspending 500 μl of LB medium, plating on resistant (amp+) LB solid medium, and placing in a 37 deg.C incubator overnight.

(2) Sequencing identification

An appropriate amount of EP tubes were prepared, and 1mL of resistant (Amp+) LB liquid medium was added to each tube. Each bacterial culture plate picks 5 single colonies with normal size, and the single colonies are respectively placed into the EP tube, placed into a shaking incubator at 37 ℃ and 225rpm for 16 hours, and then the bacterial liquid is sent to sequencing and identification, and the correctly cloned colonies are selected for plasmid extraction.

(3) Lifting plasmid

Performing amplification culture on the monoclonal with correct sequencing in the step (2), extracting plasmids in the step by using a plasmid small-medium-quantity kit (purchased from Tiangen biochemical technology (Beijing) limited), detecting the concentration and purity of the plasmids by using an ultra-micro spectrophotometer (purchased from Denovix Co., model DS-11 FX), and storing plasmids A260/A280 and A260/A230 at the temperature of-80 ℃ for standby, wherein the plasmids are qualified in the range of 1.8-2.0.

Example 1

This example illustrates a cell line deleted of STAT2 gene and its construction

(1) STAT2 gene primer design

Primers in Table 1 were designed based on the STAT2 gene of HEK293 cells (STAT 2 genomic sequence NCBIID: U18671.1), and PCR confirmed that primers were available (683 bp) (shown in FIG. 1).

TABLE 1

An upstream primer: SEQ ID NO. 1 (5 '-3')	TTGGGAACCCTCATCCTTCT
		A downstream primer: SEQ ID NO. 2 (5 '-3')	CTTTGTCTTTTCACCATAGC

(2) Construction of the sgRNA1 expression vector and the sgRNA2 expression vector

(a) sgRNA primer annealing (sgRNA primers annealling)

Two sgRNA targets were designed based on STAT2 genomic sequences, namely, the sgRNA1 target sequence (SEQ ID NO:3, GGAGGCTGTGCGAGTAAAGCTGG) and the sgRNA2 target sequence ((SEQ ID NO:4, GATCAGCTGAACTATATATGTGGGG)) a pair of primers was synthesized based on the designed target sequences, respectively (as shown in Table 2).

TABLE 2

The reaction systems were prepared in PCR tubes according to Table 3, and put into a PCR instrument, denatured at 95℃for 2 minutes, and then slowly annealed (0.1℃decrease every 8 s) for 90 minutes, to obtain an annealing product of sgRNA1 and an annealing product of sgRNA2, respectively.

TABLE 3 Table 3

(b) Connection

The reaction systems (ligation systems) were prepared in PCR tubes as shown in Table 4, and left at room temperature for 1h, to obtain ligation products of the linear PUC-sgRNA plasmid and the annealing product of sgRNA1, and ligation products of the linear PUC-sgRNA plasmid and the annealing product of sgRNA2 (i.e., the expression vector of sgRNA1, the expression vector of sgRNA 2), respectively. Wherein, a sgRNA1 expression vector containing a sgRNA1 recognition sequence (SEQ ID NO:9, GGAGGCTGTGCGAGTAAAGC) and a sgRNA2 expression vector containing a sgRNA2 recognition sequence (SEQ ID NO:10, GATCAGCTGACTATGAGTG) were obtained.

TABLE 4 Table 4

(c) Transformation of sgRNA1 expression vector and sgRNA2 expression vector and plasmid extraction

And respectively carrying out bacterial transformation, monoclonal selection and sample feeding sequencing identification on the sgRNA1 expression vector and the sgRNA2 expression vector, selecting a clone with correct sequencing according to the sample feeding sequencing result for shaking, and extracting plasmids of the sgNRA1 expression vector and the sgRNA2 expression vector, wherein the plasmid size is consistent with the expected size as shown in figure 2.

(3) Construction of CMV-sgRNA1 target sequence-PolyA-sgRNA 2 target sequence-IRES-GFP vector (reporter vector)

Bacterial solutions of the reporter backbone vector pIRES-EGFP (purchased from Clontech Co.) (T1) and a vector (built by Bomeid Co., ltd., the "vector" used was PUC-18T) (T2) containing the sgRNA1 target sequence-PolyA-sgRNA 2 target sequence element (SEQ ID NO: 12) were subjected to agarose gel electrophoresis, and the electrophoresis results were shown in FIGS. 3 and 4, respectively, by PCR amplification (forward and reverse primers of T1 and T2).

sgRNA1 target sequence-PolyA-sgRNA 2 target sequence element:

CCAGCTTTACTCGCACAGCCTCCAAGTACTGTCGAATGTCCACAGGTAGTCTAGATCCCGGGTGGCAT CCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAA AATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAA GGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCT TGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGG CATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTC CAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCC TTCCCTGTCCTTCTGATTTTAGATCAGCTGAACTATGAGTGTGGACAATTTGCGGAAATTCTGCCGGTCGACTGAAGATCTTGATAACTCGAGCCTCTCCCTCCC(SEQ ID NO.:12)

the underlined sites are respectively the reverse complement of the sgRNA1 target sequence (the reverse complement of the target sequence is shown here in order to be consistent with the target sequence on the cell genome), the PolyA, the sgRNA2 target sequences, which are separated by some base sequences, preventing elements from being too close to affect repair after cleavage.

TABLE 5

As can be seen from FIG. 3 (M lane 15000DNA marker), T1 has a single band at 4908bp, consistent with the expected size; as can be seen from FIG. 4 (M lane 2000DNA marker), T2 has a single band at 630bp (sgRNA 1 target sequence-PolyA-sgRNA 2 target sequence element) consistent with the expected size. Purifying PCR products (adopting a desert PCR product purification kit with the trademark of TD 407-200), and then adopting an overlap PCR method to connect to obtain a report carrier, wherein the complete carrier map of the report carrier is shown in figure 5, and the carrier is provided with the following main element sequences which are sequentially connected in the 5'-3' direction, and the sequences of intervals are arranged among the element sequences:

KanR

TTAGAAAAACTCATCGAGCATCAAGTGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCACCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCCGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCTGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGCCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT(SEQ ID NO.:17)

CMV promoter:

CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT(SEQ ID NO.:18)

reverse complement of sgRNA1 target sequence

CCAGCTTTACTCGCACAGCCTCC(SEQ ID NO.:19)

The reverse complement of the PAM sequence is underlined.

PolyA：

GGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTT(SEQ ID NO.:20)

sgRNA2 target sequence:

GATCAGCTGAACTATGAGTGTGG(SEQ ID NO.:4)

the PAM sequence is underlined.

IRES：

ACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATA(SEQ ID NO.:21)

GFP：

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA(SEQ ID NO.:22)

After the report carrier is transformed and plated, monoclonal colonies are picked and sent for sequencing and identification. After amplifying and culturing the correctly sequenced monoclonal shake bacteria, plasmids of a report vector (namely CMV-sgRNA1 target sequence-PolyA-sgRNA 2 target sequence-IRES-GFP vector) are extracted.

(4) Cell transfection

(a) Preparing cells to be transfected: HEK293 cells (purchased from the national academy of sciences cell bank, GNHu 18) were seeded in 6-well plates the day before transfection, ensuring that the day-of-transfection density was around 80% and fresh cell culture medium was replaced before transfection.

b) A transfection system was prepared according to Table 6, the A tube solution was added into the B tube, mixed well, left at room temperature for 10min, then the cells to be transfected were added dropwise (about 0.04 mL/s), cultured in a 5% CO2 incubator at 37℃for 4-6 hours, and then the fresh cell culture medium was replaced for further culture, to obtain transfected cells (experimental group). Simultaneously, untransfected HEK293 was placed in a 5% CO2 incubator at 37℃as a blank.

TABLE 6

c) After 48 hours of incubation, GFP fluorescence was present and flow sorting of the monoclonal cells was performed.

(5) Sorting of monoclonal

Selecting the experimental group cells in the step (4), sorting the monoclonal cells by adopting a flow cytometry sorting technology, culturing for 10-14 days, selecting 9 growing monoclonal cells (9 monoclonal cells) to continue to enlarge and culture in a 24-well plate after growing the cells to 50-90% of the bottom area of the 96-well plate, selecting 9 monoclonal cell clones from the 24-well plate to extract cell genomes for PCR identification (taking blank group cells as a reference), wherein 7 monoclonal strips in the 9 monoclonal cells are obviously shortened, the occurrence of gene deletion is indicated, the sizes of the other 2 clone PCR identification strips are basically consistent with the reference, and the fact that large fragment knockout of STAT2 genes does not exist is indicated, which is probably caused by adhesion among cells in the sorting process of the flow cytometry, insufficient optimization of screening conditions, sorting or homologous recombination restoration of the monoclonal cells, and belongs to a normal error range. The PCR products of 9 clones were sequenced together with the blank PCR products, and the sequencing results were shown in FIG. 7, 7 clones (experimental group) were deleted from the STAT2 genome, and the blank STAT2 genome was complete, so that these 7 clones (positive clones) were determined as STAT2 gene deleted cells.

(6) Expansion culture

And (3) selecting positive clone cells with good growth state from 7 positive clones obtained in the step (5), expanding the positive clone cells to a 10cm dish for culture, extracting genome again for PCR identification, obtaining HEK293 stable cell strains with STAT2 gene deletion, and freezing the HEK293 stable cell strains.

Example 2

This example is used to demonstrate the use of a STAT2 gene deleted HEK293 cell line for virus packaging and efficacy validation.

(1) Lentivirus package

The STAT2 gene-deleted HEK293 cells of the present invention were inoculated into a 6-well plate for culture as experimental group 1, while 293T cells (purchased from the national academy of medical science cell library, GNHu 17) were inoculated into a 6-well plate for comparison as experimental group 2, and wild-type HEK293 cells were inoculated into a 6-well plate for culture as experimental group 3. 3 groups of cells were plated with the same cell density 24 hours prior to transfection (1 x10 ⁶ Cell/well), when the 3 groups of cells reached about 80% confluence, lentiviral plasmid packaging verification was performed. Commercial lentiviral packaging plasmid systems (main plasmid PLVX-mCherry-C1, auxiliary plasmids PLP1, PLP2 and PLP-VSVG, all purchased from bang organisms, with patterns shown in FIGS. 8A-D) were used to package the STAT2 gene deleted HEK293 cells (panel 1), 293T cells (panel 2) and wild HEK293 cells (panel 3), fluorescence was observed 48h after transfection, and it was found that the transfection efficiency was higher in panel 1 than in panels 2 and 3, and the transfection efficiency was up to about 80% in panel 1 (FIG. 9).

The method comprises the following specific steps:

the cells are planted one day before transfection, so that the density of the cells on the day before transfection is about 80%, and liquid exchange is needed before transfection;

the transfection system was formulated as in table 10.

Table 10

Adding the solution of tube A into tube B, mixing, standing for 10min, adding dropwise (about 0.04 mL/min) cells to be transfected, placing into 37deg.C, 5% CO ₂ Culturing in an incubator; ) After 48h of culture, collecting cell supernatant, centrifuging at 600g for 10min, collecting supernatant, filtering with 0.45um filter to obtain virus liquid of lentivirus of experimental group 1-3, and storing in refrigerator at-80deg.C for use.

(2) Adenovirus propagation

Commercially available ADV-GFP adenoviruses (purchased from magnesium gamma technology, su zhou) were simultaneously infected with the same density (80%) of STAT2 gene deleted HEK293 cells (experimental group 1), 293T cells (experimental group 2), wild-type HEK293 cells (experimental group 3) at moi=1, and GFP fluorescence was observed for 48h, finding that experimental group 1 had a higher infection rate than experimental group 2 and experimental group 3 (fig. 10). Freezing and preserving infected cells at-80deg.C, dissolving at 37deg.C, repeatedly freezing and thawing for three times, centrifuging 600g for 10min to obtain supernatant, filtering with 0.45um filter, and collecting virus particles to obtain adenovirus virus liquid of experimental group 1-3, and freezing and preserving at-80deg.C for use.

(3) Lentivirus titer assay

Respectively carrying out gradient dilution on the virus solutions of the lentiviruses of the experimental groups 1-3 obtained in the step (1) to obtain virus dilutions of the lentiviruses of different dilutions of the experimental groups 1-3: preparing 9 EP tubes with volume of 1.5ml, adding 900 mu l of cell culture solution into each tube, adding 100 mu l of virus solution of slow virus obtained in the step (1) into the first tube, mixing uniformly, sucking 100 mu l, adding the second tube, mixing uniformly, and the like, setting 9 gradients in total, wherein each gradient is graded in a 10-time relation, and marking in sequence according to the concentration: 10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 、10 ^-7 、10 ^-8 、10 ^-9 。

Wild HEK293 cells were seeded in 96-well plates one day in advance, 5000 cells/well, the culture broth was discarded the next day (24 h after seeding), and virus dilutions of lentiviruses of different dilutions, 100 ul/well, of experimental groups 1-3, respectively, were added. After 24h, medium was added, fluorescent photographing was performed after 72h, and titer calculation was performed to count the number of fluorescent cell clones with fluorescence in the last 2 rows, and if X and Y were assumed, respectively, the virus titer (TU/mL) = (x+y×10) ×1000/2/X well of virus solution (μl), and the titer measurement was repeated three times. The average titer of the virus stock solutions of the experimental group 1, the experimental group 2 and the experimental group 3 packaged by the lentivirus are respectively as follows: 1.1X10 times ⁷ TU/mL，6×10 ⁶ TU/mL，3×10 ⁶ TU/mL (FIG. 11).

(4) Adenovirus titer assay

Respectively carrying out gradient dilution on the adenovirus liquid of the experiment groups 1-3 obtained in the step (2) to obtain adenovirus diluent of the experiment groups 1-3 with different dilutions: preparing 12 EP tubes with volume of 1.5ml, adding 900 mu l of cell culture solution into each tube, adding 100 mu l of adenovirus virus solution obtained in the step (1) into the first tube, mixing uniformly, sucking 100 mu l, adding the second tube, mixing uniformly, and the like, setting 12 gradients in total, wherein each gradient is graded in a 10-time relation, and marking in sequence according to the concentration: 10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 、10 ^-7 、10 ^-8 、10 ^-9 、10 ^-10 、10 ^-11 、10 ^-12 。

Wild HEK293 cells were inoculated in 96-well plates one day in advance, the culture broth was discarded the next day (24 h after inoculation), and virus dilutions of adenovirus of different dilutions of experimental groups 1-3 were added, respectively. After 24h, medium was added, fluorescent photographing was performed after 72h inoculation and titer calculation was performed to calculate the number of wells (X) with GFP fluorescence in the row where the highest dilution of GFP fluorescence occurred. Virus titer (TU/mL) =x×1000/content of highest dilution virus solution that fluoresces (μl). The titer determination was repeated three times, and the average titers of adenovirus-infected experimental group 1, group 2, group 3 virus stocks were respectively: 8.3×10 ¹⁰ TU/mL、2.7×10 ¹⁰ TU/mL、1.2×10 ¹⁰ TU/mL (FIG. 12).

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, a number of simple variants of the technical solution of the invention are possible, including combinations of the individual technical features in any other suitable way, which simple variants and combinations should likewise be regarded as being disclosed by the invention, all falling within the scope of protection of the invention.

SEQUENCE LISTING

<110> Beijing magnesium Gamma science and technology Co., ltd

<120> STAT2 gene-deleted cell strain, and preparation method and application thereof

<130> I72550BMG

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 1

ttgggaaccc tcatccttct 20

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 2

ctttgtcttt tcaccatagc 20

<210> 3

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 3

ggaggctgtg cgagtaaagc tgg 23

<210> 4

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 4

gatcagctga actatgagtg tgg 23

<210> 5

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 5

accgggaggc tgtgcgagta aagc 24

<210> 6

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 6

aaacgcttta ctcgcacagc ctcc 24

<210> 7

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 7

accggatcag ctgaactatg agtg 24

<210> 8

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 8

aaaccactca tagttcagct gatc 24

<210> 9

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 9

ggaggctgtg cgagtaaagc 20

<210> 10

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 10

gatcagctga actatgagtg 20

<210> 11

<211> 411

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 11

gtaatacgac tcactatagg gcgaattggg taccaaggtc gggcaggaag agggcctatt 60

tcccatgatt ccttcatatt tgcatatacg atacaaggct gttagagaga taattagaat 120

taatttgact gtaaacacaa agatattagt acaaaatacg tgacgtagaa agtaataatt 180

tcttgggtag tttgcagttt taaaattatg ttttaaaatg gactatcata tgcttaccgt 240

aacttgaaag tatttcgatt tcttggcttt atatatcttg tggaaaggac gaaacaccgc 300

tgtcttcaac acaagaagac acgttttaga gctagaaata gcaagttaaa ataaggctag 360

tccgttatca acttgaaaaa gtggcaccga gtcggtgctt tttttggatc c 411

<210> 12

<211> 629

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 12

ccagctttac tcgcacagcc tccaagtact gtcgaatgtc cacaggtagt ctagatcccg 60

ggtggcatcc ctgtgacccc tccccagtgc ctctcctggc cctggaagtt gccactccag 120

tgcccaccag ccttgtccta ataaaattaa gttgcatcat tttgtctgac taggtgtcct 180

tctataatat tatggggtgg aggggggtgg tatggagcaa ggggcaagtt gggaagacaa 240

cctgtagggc ctgcggggtc tattgggaac caagctggag tgcagtggca caatcttggc 300

tcactgcaat ctccgcctcc tgggttcaag cgattctcct gcctcagcct cccgagttgt 360

tgggattcca ggcatgcatg accaggctca gctaattttt gtttttttgg tagagacggg 420

gtttcaccat attggccagg ctggtctcca actcctaatc tcaggtgatc tacccacctt 480

ggcctcccaa attgctggga ttacaggcgt gaaccactgc tcccttccct gtccttctga 540

ttttagatca gctgaactat gagtgtggac aatttgcgga aattctgccg gtcgactgaa 600

gatcttgata actcgagcct ctccctccc 629

<210> 13

<211> 57

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 13

actatgagtg tggacaattt gcggaaattc tgccggtcga ctgaagatct tgataac 57

<210> 14

<211> 58

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 14

cattcgacag tacttggagg ctgtgcgagt aaagctggct gcagaattcg aagcttga 58

<210> 15

<211> 58

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 15

ctcgcacagc ctccaagtac tgtcgaatgt ccacaggtag tctagatccc gggtggca 58

<210> 16

<211> 53

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 16

ccgcaaattg tccacactca tagttcagct gatctaaaat cagaaggaca ggg 53

<210> 17

<211> 816

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 17

ttagaaaaac tcatcgagca tcaagtgaaa ctgcaattta ttcatatcag gattatcaat 60

accatatttt tgaaaaagcc gtttctgtaa tgaaggagaa aactcaccga ggcagttcca 120

taggatggca agatcctggt atcggtctgc gattccgact cgtccaacat caatacaacc 180

tattaatttc ccctcgtcaa aaataaggtt atcaagtgag aaatcaccat gagtgacgac 240

tgaatccggt gagaatggca aaagcttatg catttctttc cagacttgtt caacaggcca 300

gccattacgc tcgtcatcaa aatcactcgc accaaccaaa ccgttattca ttcgtgattg 360

cgcctgagcg agacgaaata cgcgatcgcc gttaaaagga caattacaaa caggaatcga 420

atgcaaccgg cgcaggaaca ctgccagcgc atcaacaata ttttcacctg aatcaggata 480

ttcttctaat acctggaatg ctgttttccc tgggatcgca gtggtgagta accatgcatc 540

atcaggagta cggataaaat gcttgatggt cggaagaggc ataaattccg tcagccagtt 600

tagcctgacc atctcatctg taacatcatt ggcaacgcta cctttgccat gtttcagaaa 660

caactctggc gcatcgggct tcccatacaa tcgatagatt gtcgcacctg attgcccgac 720

attatcgcga gcccatttat acccatataa atcagcatcc atgttggaat ttaatcgcgg 780

cctcgagcaa gacgtttccc gttgaatatg gctcat 816

<210> 18

<211> 508

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 18

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 300

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 360

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 420

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 480

acggtgggag gtctatataa gcagagct 508

<210> 19

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 19

ccagctttac tcgcacagcc tcc 23

<210> 20

<211> 477

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 20

gggtggcatc cctgtgaccc ctccccagtg cctctcctgg ccctggaagt tgccactcca 60

gtgcccacca gccttgtcct aataaaatta agttgcatca ttttgtctga ctaggtgtcc 120

ttctataata ttatggggtg gaggggggtg gtatggagca aggggcaagt tgggaagaca 180

acctgtaggg cctgcggggt ctattgggaa ccaagctgga gtgcagtggc acaatcttgg 240

ctcactgcaa tctccgcctc ctgggttcaa gcgattctcc tgcctcagcc tcccgagttg 300

ttgggattcc aggcatgcat gaccaggctc agctaatttt tgtttttttg gtagagacgg 360

ggtttcacca tattggccag gctggtctcc aactcctaat ctcaggtgat ctacccacct 420

tggcctccca aattgctggg attacaggcg tgaaccactg ctcccttccc tgtcctt 477

<210> 21

<211> 553

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 21

acgttactgg ccgaagccgc ttggaataag gccggtgtgc gtttgtctat atgttatttt 60

ccaccatatt gccgtctttt ggcaatgtga gggcccggaa acctggccct gtcttcttga 120

cgagcattcc taggggtctt tcccctctcg ccaaaggaat gcaaggtctg ttgaatgtcg 180

tgaaggaagc agttcctctg gaagcttctt gaagacaaac aacgtctgta gcgacccttt 240

gcaggcagcg gaacccccca cctggcgaca ggtgcctctg cggccaaaag ccacgtgtat 300

aagatacacc tgcaaaggcg gcacaacccc agtgccacgt tgtgagttgg atagttgtgg 360

aaagagtcaa atggctctcc tcaagcgtat tcaacaaggg gctgaaggat gcccagaagg 420

taccccattg tatgggatct gatctggggc ctcggtacac atgctttaca tgtgtttagt 480

cgaggttaaa aaaacgtcta ggccccccga accacgggga cgtggttttc ctttgaaaaa 540

cacgatgata ata 553

<210> 22

<211> 720

<212> DNA

<213> artificial sequence

<220>

<223> The sequence is synthesized.

<400> 22

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

Claims

1. A method of constructing a STAT2 gene-deleted cell line, the method comprising:

wherein the vector system comprises an expression vector capable of expressing Cas9, sgRNA1, and sgRNA2;

the vector system also comprises a report vector, wherein the monoclonal screening in the step (2) is positive monoclonal screening;

the report carrier contains a promoter, a fluorescent protein expression element and an sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element positioned between the promoter and the fluorescent protein expression element;

the sequence of the sgRNA1 target sequence-transcription termination sequence-sgRNA 2 target sequence element is shown in SEQ ID NO. 12;

the target cell is HEK293 cell.

2. The method of claim 1, wherein in step (2), the monoclonal screening is limiting dilution and/or flow cytometry sorting techniques.

3. The method of claim 1 or 2, wherein the positive monoclonal screening comprises: positive monoclonal screening was performed using a flow cytometer.

4. The method of claim 2, wherein in the reporter vector, the promoter is one of a CMV promoter, an EF1a promoter, and a CAG promoter;

and/or, the fluorescent protein expression element contains an IRES sequence and a fluorescent protein coding gene;

and/or the fluorescent protein coding gene is at least one of GFP gene, RFP gene, mcherry gene and YFP gene.

5. Use of a method of knocking out STAT2 gene in increasing the amount of cytotoxicity, wherein the method of knocking out STAT2 gene is a method of constructing a STAT2 gene-deleted cell line according to any one of claims 1 to 4;

the cell yield is the virus yield when the cells are subjected to virus culture.