CN103131709B - Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control - Google Patents
Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control Download PDFInfo
- Publication number
- CN103131709B CN103131709B CN201310053235.2A CN201310053235A CN103131709B CN 103131709 B CN103131709 B CN 103131709B CN 201310053235 A CN201310053235 A CN 201310053235A CN 103131709 B CN103131709 B CN 103131709B
- Authority
- CN
- China
- Prior art keywords
- gene
- zfx
- mouse
- rna
- interference fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a ribonucleic acid (RNA) interference fragment of a zinc finger-x (zfx) gene, a carrier formed by the RNA interference fragment and application of the RNA interference fragment in mouse filial generation sex control. The RNA interference fragment has the advantages of hindering, harming or destroying normal development and functions of X-sperms by silencing the zfx gene in an X-sperm of a generative cell of a male mouse. Multiple fertilization chances are provided for a Y-sperm when the male mouse is mated with a female mouse, the sex of a mouse is effectively controlled before fertilization, accordingly the male mouse rate of F1 generation mice is greatly improved, required spermatid is not hurt, and spermatid vitality is not reduced, and the cost is low.
Description
Technical field
The present invention relates to molecular genetics field, being specifically related to can be reticent
zfxrNA interference fragment and the application thereof of gene.
Background technology
Under field conditions (factors), nearly all mammiferous sex ratio all approaches 1:1, stably produces offspring thereby realized without interruption, is issued to the eubiosis in natural condition.For reality is produced in herding, desirable sex ratio tool is of great significance.The manufacturing enterprise that utilizes lactation, egg-laying deseription to produce wishes to obtain more female individuals, and produce meat, produce hair proterties on male, show to such an extent that dominance is more obvious.All the time, the mankind just have great interest to the sex of controlling animal offspring.Sex control is mainly carried out from prefecundation and latter two aspect of fertilization at present, and the former applies after sperm separates and is fertilized, makes just to have determined at the time of fertilization offspring's sex; The latter adopts early embryo sex qualification, and the method for carrying out embryo's sex screening is controlled offspring's sex.
Mammal sex determination theory thinks, the zygote that sex chromosome is " XX " just can develop into female individuals, and will developing into that sex chromosome is " XY " is male.So fundamentally, controlling the optimal method of Livestock Sex is first to separate X, y sperm, and then is fertilized, and just can control artificially offspring's sex, and this is approach simple, the most most economical in sex control in theory.After the 1950's, the research report separating about sperm is a lot, the physical property (volume, density, electric charge, mobility) of utilizing X sperm different with y sperm is all attempted in these researchs), adopt the diverse ways such as centrifuging, electrophoretic method, ion exchange method, cell-surface antigens method to realize the separation of sperm, but have a common problem---repeatable poor.And and these differences change along with the difference of envrionment conditions, therefore, many results of study are usually inconsistent, even occur contrary conclusion, cause some Difference of two class sperms to have dispute.Up to the present,, except X, y sperm DNA content have difference can affirm, otherwise difference performance is very little, is even difficult to determine.But along with the development of Protocols in Molecular Biology, and the continuation of research work deeply, and new achievement in research will continue to bring out.
The principle there are differences according to Mammals X, y sperm DNA content at present, utilize wandering cells retrieval instrument to separate X, y sperm, separating effect is best, purity is more than 90%, but due to apparatus expensive, the reasons such as velocity of separation is slow, few for the sperm quantity of being fertilized, vigor is poor, can not meet far away and produce the upper heavy demand to sexing semen.By contrast, if can find in two kinds of sperm developments or fertilization process, even critical X, the special mRNA of Y chromosome when fetal development, utilize RNA to disturb (RNA Interference in conjunction with contemporary emerging Protocols in Molecular Biology, RNAi) method is expected to lower cost, easy, realize the sex control to animal rapidly.
RNAi is gene silencing (the Post-transcriptional Gene Silencing after a kind of transcribing, PTGS) phenomenon, by the double-stranded RNA (Dubble-stranded RNA.dsRNA) that produces in external synthetic or body cell internal specific the mRNA of its homology of degrading, corresponding gene is disturbed, realize the expression that stops target gene.RNAi method can be lowered the genetic expression in cell quick, easy, effectively, specifically, and it does not still study a kind of powerful of gene function, and treats new technique means is provided for specific gene, and its application prospect is very wide.
Research at genome, mRNA and protein level all proves, X, y sperm genetic expression there are differences really.Genetic expression detects research and shows, the reduction division pachytene stage forming at sperm, and for preventing that some enzymes and sex chromosome from having an effect, two the concentrated formation of sex chromosome height gonosome bodies.Sex chromosome has been protected in the formation of gonosome, and on sex chromosome, the expression of special gene is closed.Therefore, there is no transcribing of mRNA in Mammals mature sperm, but but contain mRNA in Mammals mature sperm, this species diversity is from transcribing in during spermatogenesis, and its translation far lags behind and transcribes.These mRNA instruct more synthetic necessary albumen after spermioteleosis, or after fertilization is to the supplementing of ovocyte mRNA storehouse, or play a part crucial as RNAi to fertility and embryo growth and development.
Hendriksen etc. find the research of mouse, in reduction division process, remove
xistoutside genetic expression, nearly all sex chromosome gene is not all expressed, but meiosis anaphase, some sex chromosome specific genes start to express.Postmeiotic, detects on Y chromosome
ubelywith
srygene has higher mRNA level; Ubelx gene mRNA high level expression in X sperm, also detected, find X chromosome specific gene simultaneously
mhr6Aexpression product.Somebody finds the expression of X, other specific genes of Y chromosome in addition, as X chromosome specific gene
akap82(skelemin of sperm tail) and Nap-X (a kind of core associated protein of encoding), Y chromosome specific gene
zfy-1, Zfy-2and
y353/B.
Wherein
zfx/Zfygene is the pair of alleles of encoding zinc finger protein on karyomit(e), expresses since meiophase, and the content in round spermatid is the highest.
zfxgene is
zFYa member in (zinc finger-Y) gene family,
zFYfamily comprises
zfx, Zfywith
zfagene, they are closely similar on molecular structure.General Mammals has
zfxwith
zfygene, Zfx gene is positioned on X sex chromosome, is gene female, that boar X chromosome must contain,
zfygene is positioned on Y sex chromosome, and two genes are positioned at heterosomal end, but is not positioned at homology region.
zfxgene comprises that one acid is transcribed exciting region, and a nuclear localization sequence and a DNA joining region, have 13 C2H2[Cys (2) His (2)] type zinc fingers.In mammalian cell, C2H2 zinc fingers is one of modal protein structure.At present find that kind more than 800 has the protein of this zinc fingers, has important physiological function.
zfx/Zfythe albumen of coding, as transcription factor, has some functions relevant with the generation of sperm in sperm forming process.
Summary of the invention
Object of the present invention is exactly for above-mentioned defect of the prior art, provide based on RNA perturbation technique for
zfxthe RNA interference fragment of gene.
To achieve these goals, technical scheme provided by the invention is: the RNA interference fragment of zfx gene, has following arbitrary sequence:
siRNA 1：GAACTGAATGTCGCTGAGATT，
siRNA 7：GGACTATCCTCATAAGTGTGA，
siRNA 9：GGTGCAGTGAGAATACATTAT。
Second object of the present invention has been to provide
zfxthe expression vector of gene RNA interference fragment, this expression vector clone has arbitrary RNA interference fragment as claimed in claim 1.
Further, above-mentioned expression vector, has the sequence shown in SEQ ID NO:1,2 or 3.
The 3rd object of the present invention has been to provide
zfxthe RNA interference fragment of gene is in the application of controlling in mouse sex of children.
Further, above-mentioned application, described control method is with the RNA interference fragment of zfx gene, the zfx gene in mouse sperm cell to be carried out to silence, the spermatid of generation particular type.
Beneficial effect of the present invention is: RNAi interference fragment provided by the invention, and by the sexual cell X sperm to male mice
zfxgene carries out silence, hinders, damages or destroy normal development and the function of X sperm.When with female mice mating, give and the y sperm chance of being more fertilized, greatly raise thereby effectively controlled in prefecundation the male mouse rate that the sex of mouse produces F1 generation mouse.Present method can not cause damage or reduce its vigor required spermatid, and with low cost.
Detailed process of the present invention is:
One, material and concrete grammar:
1, build the RNAi interference carrier of zfx gene:
The zfx gene order using comes from NCBI gene pool, filters out 10 siRNA fragments according to RNAi principle of design and the compare of analysis result on NCBI, as shown in table 1, for for siRNA's
zfxcDNA template.Add Ecor I and Bam I restriction enzyme site in 5 ' and 3 ' of each siRNA fragment respectively, as shown in table 2, then send biotech firm to synthesize siRNA fragment.Positive and negative adopted chain is combined into two strands by annealing and is connected to RNAi-Ready pSIREN-RetroQ-ZsGreen Vector(Clontech, the U.S.) on carrier, as shown in Figure 4, then be transformed into (Tiangen in E. coli DH5 α competent cell, China) increase, extract plasmid-20 DEG C preservation.
Table 1
。
2,
zfxthe external interference test of gene:
Choose 4 of the healthy male mouse of kunming of 28 ages in days, adopt cervical vertebra dislocation method to be put to death, its belly is drenched to sterilization with 75% alcohol.Under aseptic condition, take out the bilateral testes of every mouse, adopt two step enzyme digestions to isolate sustentacular cell of testis and androgone.These isolated cells are put into the HamF12/DMEM nutrient solution containing 10% foetal calf serum, interior interpolation HEPES (15mol/L), 100 kU/L penicillin and 0.1 g/L Streptomycin sulphate, 1ug/ml Urogastron, 100ul ITS (Regular Insulin, Transferrins,iron complexes, sodium selenate) { Regular Insulin (10 μ g/ml), Transferrins,iron complexes (10 μ g/ml) }, 3.3 × 10
-7mol/L vitamin A acid, vitamin A (3.3 × 10
-7mo/L), 10 μ g/ml vitamin-Es, 10
-4mol/L vitamins C, 10
-3mol/L pyruvic acid, 10
-7mol/L testosterone, 25U/L rFSH.Approximately by 1 × 10
6cELL/cm
2density be inoculated in six orifice plates that are placed with cover glass, at 32 DEG C, 5% CO
2, cultivate 24 hours under the humidity condition that is 95%, as transfection reagent, the carrier building is transfected in androgone with calcium ion, every group in triplicate.Total RNA of androgone was as a child extracted in transfection 48, detected the mrna expression level of zfx gene with RT-PCR.Pick out good four of interference effect and carry out next step experiment, as shown in table 2, hereinafter to be referred as pzq1 (Zfx1286), pzq2 (zfx3945), pzq3 (Zfx2325) and pzq4 (Zfx6487), table 2 is with BamHI and EcoRI restriction enzyme site
zfxrNAi sequence.
Table 2
。
3, the animal body internal interference of zfx gene test:
Choose the healthy male mouse of kunming in 80 6 week ages, be divided at random 5 groups, wherein three groups of good three interference carriers of testis injection interference effect, the interference carrier 40ug of every injection same volume; The empty carrier 40ug of other two groups one group injection same volume, the physiological saline of one group of injection same volume.Interval 7 days injection one-time continuous injection 4 times, the female kunming mice abdominal injection PMSG 5U in last injection 40 6 week ages of random choose after 5 days, after 42-48h, inject 5U HCG, then mate (now apart from last injection plasmid 7d) with 8 of every group of male mouse by 1:1.In morning next day, check whether female mouse becomes pregnant, and sees that having the female mouse of cloudy bolt and male mouse to separate carries out single cage raising, the sex ratio of observing output offspring.Mate simultaneously every group of remaining 8 male mouse are put to death, get bilateral testes and extract total RNA, detect the mrna expression level of each group of ZFX gene with RT-PCR, as shown in table 3 is goal gene primer sequence and PCR condition.
Table 3
。
Two, experimental result:
1, RT-PCR detects in androgone
zfxthe expression level of gene mRNA:
As shown in Figure 1, result shows in experimental group pzq1, pzq2, pzq3, pzq4
zfxthe expression level of gene mRNA is all lower than control group (physiological saline group).Wherein significantly (P < 0.05) of pzq1, pzq3 and control group comparing difference; Pzq4 difference is (P < 0.01) extremely significantly.Allly tentatively choose pzq1, pzq2, pzq3, pzq4 are right
zfxthe good shRNA fragment of gene interference effect, as shown in table 2.
2, RT-PCR detects the expression level of zfx gene mRNA in testis tissue:
As shown in Figure 2, result shows that the expression level of zfx gene mRNA in experimental group pzq1, pzq2, pzq3, pzq4 is all lower than control group (physiological saline group), and difference is (P < 0.01) extremely significantly.Wherein experimental group pzq4 is minimum.
3, the sex ratio of F1 generation mouse:
As shown in table 4 and Fig. 3, result shows that male mouse rate and the control group of experimental group pzq1, pzq2 F1 generation mouse do not have difference (P > 0.05), and the male mouse rate of the F1 generation mouse of experimental group pzq3 and pzq4 is high compared with control group, significant difference (P < 0.05), wherein the male mouse rate of the F1 generation of experimental group pzq4 is up to 79.49%, and difference is (P < 0.01) extremely significantly.Table 4 is each group of offspring (F1 generation) male and female mouse quantity.
Table 4
。
Note: having the identical person of arbitrary letter between two groups is that difference is not remarkable, and capitalization represents that difference is extremely remarkable, and lowercase alphabet shows significant difference.
Three, innovative point of the present invention:
As shown in table 5, table 5 is oligonucleotide sequence.
Table 5
。
As shown in table 5, what three siRNA interference fragments provided by the invention can be to mouse
zfxgene has good reticent effect, and wherein pqz3 disturbs the X sperm of male mouse, can make male mouse rate in F1 generation mouse reach 75.94%: and pqz4 disturbs the X sperm of male mouse, and in F1 generation mouse, male mouse rate is up to 79.66%.Although and pqz1 disturbs F1 mouse rate afterwards there is no significant difference to zfx gene, the interference effect of zfx gene has also been reached to conspicuous level (P < 0.05) in spermatogenesis cell.
Brief description of the drawings
Fig. 1 is the expression level of zfx mRNA in cell.
Fig. 2 is the expression level of zfx mRNA in tissue.
Fig. 3 is that RNA disturbs the male mouse rate of zfx F1 generation.
In figure: having the identical person of arbitrary letter between two groups is that difference is not remarkable, and capitalization represents that difference is extremely remarkable, and lowercase alphabet shows significant difference.
Fig. 4 is vector construction schematic diagram of the present invention.
Embodiment
The technology using in following examples, comprise gene sequencing, pcr amplification and detection, vector construction equimolecular biology techniques, unless stated otherwise, be routine techniques well known by persons skilled in the art, plant and instrument, reagent, plasmid and the carrier etc. that use, only dated especially, be that general those skilled in the art can obtain by public approach.
embodiment 1:
1, build the RNAi interference carrier of zfx gene:
The zfx gene order using comes from NCBI gene pool, filters out 10 siRNA fragments according to RNAi principle of design and the compare of analysis result on NCBI, as shown in table 1, for for siRNA's
zfxcDNA template.Add Ecor I and Bam I restriction enzyme site in 5 ' and 3 ' of each siRNA fragment respectively, as shown in table 2, then send biotech firm to synthesize siRNA fragment.Positive and negative adopted chain is combined into two strands by annealing and is connected to RNAi-Ready pSIREN-RetroQ-ZsGreen Vector(Clontech, the U.S.) on carrier, then be transformed into (Tiangen in E. coli DH5 α competent cell, China) increase, extract plasmid-20 DEG C preservation.
2, the external interference test of zfx gene:
Choose 4 of the healthy male mouse of kunming of 28 ages in days, adopt cervical vertebra dislocation method to be put to death, its belly is drenched to sterilization with 75% alcohol.Under aseptic condition, take out the bilateral testes of every mouse, adopt two step enzyme digestions to isolate sustentacular cell of testis and androgone.These isolated cells are put into the HamF12/DMEM nutrient solution containing 10% foetal calf serum, interior interpolation HEPES (15mol/L), 100 kU/L penicillin and 0.1 g/L Streptomycin sulphate, 1ug/ml Urogastron, 100ul ITS (Regular Insulin, Transferrins,iron complexes, sodium selenate) { Regular Insulin (10 μ g/ml), Transferrins,iron complexes (10 μ g/ml) }, 3.3 × 10
-7mol/L vitamin A acid, vitamin A (3.3 × 10
-7mo/L), 10 μ g/ml vitamin-Es, 10
-4mol/L vitamins C, 10
-3mol/L pyruvic acid, 10
-7mol/L testosterone, 25U/L rFSH.Approximately by 1 × 10
6cELL/cm
2density be inoculated in six orifice plates that are placed with cover glass, at 32 DEG C, 5% CO
2, cultivate 24 hours under the humidity condition that is 95%, as transfection reagent, the carrier building is transfected in androgone with calcium ion, every group in triplicate.Total RNA of androgone was as a child extracted in transfection 48, detected the mrna expression level of ZFX gene with RT-PCR.Pick out good four of interference effect and carry out next step experiment, as shown in table 2, hereinafter to be referred as pqz1 (Zfx1286), pqz2 (zfx3945), pqz3 (Zfx2325) and pqz4 (Zfx6487), table 2 is with BamHI and EcoRI restriction enzyme site
zfxrNAi sequence.
3, the animal body internal interference of zfx gene test:
Choose the healthy male mouse of kunming in 80 6 week ages, be divided at random 5 groups, wherein three groups of good three interference carriers of testis injection interference effect, the interference carrier 40ug of every injection same volume; The empty carrier 40ug of other two groups one group injection same volume, the physiological saline of one group of injection same volume.Interval 7 days injection one-time continuous injection 4 times, the female kunming mice abdominal injection PMSG 5U in last injection 40 6 week ages of random choose after 5 days, after 42-48h, inject 5U HCG, then mate (now apart from last injection plasmid 7d) with 8 of every group of male mouse by 1:1.In morning next day, check whether female mouse becomes pregnant, and sees that having the female mouse of cloudy bolt and male mouse to separate carries out single cage raising, the sex ratio of observing output offspring.Mate simultaneously every group of remaining 8 male mouse are put to death, get bilateral testes and extract total RNA, detect the mrna expression level of each group of ZFX gene with RT-PCR, the condition of the primer and the PCR that are goal gene as shown in table 3.
Finally it should be noted that: the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although the present invention is had been described in detail with reference to previous embodiment, for a person skilled in the art, its technical scheme that still can record aforementioned each embodiment is modified, or part technical characterictic is wherein equal to replacement.Within the spirit and principles in the present invention all, any amendment of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
Sequence table
<110> Shihezi Univ
<120>
zfxthe application of the RNA interference fragment of gene and control mouse sex thereof
<160> pqz-1
<210> 1
<211> 1261
<212> RNA
<400> 1
aaagtaagat ttttccgatt tcttggcttt atatatcttg tggaaggacg aggatccgaa 60
ctgaatgtcg ctgagattca agagatctca gcgacattca gttctttttt acgcgtgaat 120
tctagttatt aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc 180
cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 240
ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 300
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 360
ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 420
tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 480
accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt tgactcacgg 540
ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 600
cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg cggtaggcgt 660
gtacggtggg aggtctatat aagcagagct ggtttagtga accgtcagat ccgctagcgc 720
taccggtcgc caccatggcc cagtccaagc acggcctgac caaggagatg accatgaagt 780
accgcatgga gggctgcgtg gacggccaca agttcgtgat caccggcgag ggcatcggct 840
accccttcaa gggcaagcag gccatcaacc tgtgcgtggt ggagggcggc cccttgccct 900
tcgccgagga catcttgtcc gccgccttca tgtacggcaa ccgcgtgttc accgagtacc 960
cccaggacat cgtcgactac ttcaagaact cctgccccgc cggctacacc tggaccgctc 1020
cttcctgttc gaggacggcg ccgtgtgcat ctgcacgtcg acatcaccgt ggagcgtgga 1080
ggagactgca tgtacacgag tcagttctac gcgtgactcc cgcgacgtcc gtgatgagaa 1140
gatgacgaca ctgggagtct ctgcagaaga tcatccgtgt agcagcatct gaggcgactg 1200
acagtacgtc tgctgaggac ggtgcgatgg gcctgccaga ttctgacacc ccgggtgata 1260
c 1261
<160> pqz-3
<210> 1
<211> 1058
<212> RNA
<400> 2
ctttcgattt cttggcttta tatatcttgt ggaaggacga ggatccggac tatcctcata 60
agtgtttcaa gagaacactt atgaggatag tcctttttta cgcgtgaatt ctagttatta 120
atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 180
acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 240
aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 300
gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 360
ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 420
atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 480
gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 540
tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 600
aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 660
ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagcgct accggtcgcc 720
accatggccc agtccaagca cggcctgacc aaggagatga ccatgaagta ccgcatggag 780
ggctgcgtgg acggccacaa gttcgtgatc accggcgagg gcatcggcta ccccttcaag 840
ggcaagcagg ccatcaacct gtgcgtggtg gagggcggcc ccttgccctt cgccgaggac 900
atcttgtccg ccgccttcat gtacggcaac cgcgtgttca ccgagtaccc ccaggacatc 960
gtcgactact tcaagaactc ctgccccgcc ggctacacct gggaccgctc cttcctgttc 1020
gaggacggcg ccgtggtgca tctgcaacgc cgaccatc 1058
<160> pqz-4
<210> 1
<211> 1194
<212> RNA
<400> 3
agaccagaga tttcgatttc ttggctttat atatcttgtg gaaggacgag gatccggtgc 60
agtgagaata cattttcaag agaaatgtat tctcactgca ccttttttac gcgtgaattc 120
tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 180
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 240
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 300
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 360
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 420
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 480
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 540
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 600
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 660
acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 720
ccggtcgcca ccatggccca gtccaagcac ggcctgacca aggagatgac catgaagtac 780
cgcatggagg gctgcgtgga cggccacaag ttcgtgatca ccggcgaggg catcggctac 840
cccttcaagg gcaagcaggc catcaacctg tgcgtggtgg agggcggccc cttgcccttc 900
gccgaggaca tcttgtccgc cgccttcatg tacggcaacc gcgtgttcac cgagtacccc 960
caggacatcg tcgactactt caagaactcc tgccccgccg gctacacctg gacgctcttc 1020
tgtcgaggac ggcgcgtgtg catctgcacg cgacatcacg tgagcgtgag agactgcatg 1080
taccacgagt cagttctacg cgtgaactcc cgcgacgccg tgaatgaaga agatgacgac 1140
actggagcct ctgcaaagaa tcatcccgtg gccaagcaag gcatctttga aggg 1194
Sequence table
<110> Shihezi Univ
<120>
zfxthe application of the RNA interference fragment of gene and control mouse sex thereof
<160> pqz-1
<210> 1
<211> 1261
<212> RNA
<400> 1
aaagtaagat ttttccgatt tcttggcttt atatatcttg tggaaggacg aggatccgaa 60
ctgaatgtcg ctgagattca agagatctca gcgacattca gttctttttt acgcgtgaat 120
tctagttatt aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc 180
cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 240
ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 300
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 360
ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 420
tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 480
accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt tgactcacgg 540
ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 600
cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg cggtaggcgt 660
gtacggtggg aggtctatat aagcagagct ggtttagtga accgtcagat ccgctagcgc 720
taccggtcgc caccatggcc cagtccaagc acggcctgac caaggagatg accatgaagt 780
accgcatgga gggctgcgtg gacggccaca agttcgtgat caccggcgag ggcatcggct 840
accccttcaa gggcaagcag gccatcaacc tgtgcgtggt ggagggcggc cccttgccct 900
tcgccgagga catcttgtcc gccgccttca tgtacggcaa ccgcgtgttc accgagtacc 960
cccaggacat cgtcgactac ttcaagaact cctgccccgc cggctacacc tggaccgctc 1020
cttcctgttc gaggacggcg ccgtgtgcat ctgcacgtcg acatcaccgt ggagcgtgga 1080
ggagactgca tgtacacgag tcagttctac gcgtgactcc cgcgacgtcc gtgatgagaa 1140
gatgacgaca ctgggagtct ctgcagaaga tcatccgtgt agcagcatct gaggcgactg 1200
acagtacgtc tgctgaggac ggtgcgatgg gcctgccaga ttctgacacc ccgggtgata 1260
c 1261
<160> pqz-3
<210> 1
<211> 1058
<212> RNA
<400> 2
ctttcgattt cttggcttta tatatcttgt ggaaggacga ggatccggac tatcctcata 60
agtgtttcaa gagaacactt atgaggatag tcctttttta cgcgtgaatt ctagttatta 120
atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 180
acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 240
aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 300
gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 360
ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 420
atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 480
gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 540
tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 600
aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 660
ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagcgct accggtcgcc 720
accatggccc agtccaagca cggcctgacc aaggagatga ccatgaagta ccgcatggag 780
ggctgcgtgg acggccacaa gttcgtgatc accggcgagg gcatcggcta ccccttcaag 840
ggcaagcagg ccatcaacct gtgcgtggtg gagggcggcc ccttgccctt cgccgaggac 900
atcttgtccg ccgccttcat gtacggcaac cgcgtgttca ccgagtaccc ccaggacatc 960
gtcgactact tcaagaactc ctgccccgcc ggctacacct gggaccgctc cttcctgttc 1020
gaggacggcg ccgtggtgca tctgcaacgc cgaccatc 1058
<160> pqz-4
<210> 1
<211> 1194
<212> RNA
<400> 3
agaccagaga tttcgatttc ttggctttat atatcttgtg gaaggacgag gatccggtgc 60
agtgagaata cattttcaag agaaatgtat tctcactgca ccttttttac gcgtgaattc 120
tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 180
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 240
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 300
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 360
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 420
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 480
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 540
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 600
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 660
acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 720
ccggtcgcca ccatggccca gtccaagcac ggcctgacca aggagatgac catgaagtac 780
cgcatggagg gctgcgtgga cggccacaag ttcgtgatca ccggcgaggg catcggctac 840
cccttcaagg gcaagcaggc catcaacctg tgcgtggtgg agggcggccc cttgcccttc 900
gccgaggaca tcttgtccgc cgccttcatg tacggcaacc gcgtgttcac cgagtacccc 960
caggacatcg tcgactactt caagaactcc tgccccgccg gctacacctg gacgctcttc 1020
tgtcgaggac ggcgcgtgtg catctgcacg cgacatcacg tgagcgtgag agactgcatg 1080
taccacgagt cagttctacg cgtgaactcc cgcgacgccg tgaatgaaga agatgacgac 1140
actggagcct ctgcaaagaa tcatcccgtg gccaagcaag gcatctttga aggg 1194
Claims (5)
- The RNA interference fragment of 1.zfx gene, is characterized in that, is following arbitrary sequence:siRNA 1：GAACTGAATGTCGCTGAGATT，siRNA 9：GGTGCAGTGAGAATACATTAT。
- 2. zfxthe expression vector of gene RNA interference fragment, is characterized in that, this expression vector clone has arbitrary RNA interference fragment as claimed in claim 1.
- 3. expression vector according to claim 2, is characterized in that, this expression vector has the sequence shown in SEQ ID NO:1 or 3.
- 4. the RNA interference fragment of zfx gene as claimed in claim 1 is in the application of controlling in mouse sex of children.
- 5. application according to claim 4, is characterized in that, described control method is with the RNA interference fragment of zfx gene, the zfx gene in mouse sperm cell to be carried out to silence, the spermatid of generation particular type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310053235.2A CN103131709B (en) | 2013-02-18 | 2013-02-18 | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310053235.2A CN103131709B (en) | 2013-02-18 | 2013-02-18 | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103131709A CN103131709A (en) | 2013-06-05 |
| CN103131709B true CN103131709B (en) | 2014-12-17 |
Family
ID=48492161
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310053235.2A Expired - Fee Related CN103131709B (en) | 2013-02-18 | 2013-02-18 | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103131709B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232643B (en) * | 2014-08-25 | 2017-06-16 | 石河子大学 | RNAi interference fragments, interference carrier, preparation method and applications |
| CN107267511B (en) * | 2017-06-27 | 2020-06-16 | 石河子大学 | RNAi interference fragment, interference vector, preparation method and application thereof |
| CN109735542A (en) * | 2019-01-24 | 2019-05-10 | 石河子大学 | RNAi interference fragment, interference carrier and its preparation method and application |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033120A2 (en) * | 2000-10-17 | 2002-04-25 | The Chinese University Of Hong Kong | Non-invasive prenatal monitoring |
| KR20080082562A (en) * | 2008-07-04 | 2008-09-11 | (주)지노첵 | Diagnostic methods for male infertility and diagnostic kits for male infertility for detecting y chromosomal microdeletion |
| WO2009020932A2 (en) * | 2007-08-03 | 2009-02-12 | Biocept, Inc. | In-situ hybridization to detect rna and dna markers |
| CN102206676A (en) * | 2011-03-24 | 2011-10-05 | 石河子大学 | Vector for controlling gender of animals and application thereof |
| CN102277434A (en) * | 2011-07-28 | 2011-12-14 | 曹跃琼 | Application and relevant drug of human ZFX (zinc finger-X) gene |
| CN102703578A (en) * | 2011-07-06 | 2012-10-03 | 郭奇伟 | Multiple real-time fluorescent PCR detection kit for Y chromosome microdeletion |
| CN102912028A (en) * | 2012-11-06 | 2013-02-06 | 北京阅微基因技术有限公司 | Amplification composite for detecting microdeletion of Y-chromosome and detection kit |
-
2013
- 2013-02-18 CN CN201310053235.2A patent/CN103131709B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033120A2 (en) * | 2000-10-17 | 2002-04-25 | The Chinese University Of Hong Kong | Non-invasive prenatal monitoring |
| WO2009020932A2 (en) * | 2007-08-03 | 2009-02-12 | Biocept, Inc. | In-situ hybridization to detect rna and dna markers |
| KR20080082562A (en) * | 2008-07-04 | 2008-09-11 | (주)지노첵 | Diagnostic methods for male infertility and diagnostic kits for male infertility for detecting y chromosomal microdeletion |
| CN102206676A (en) * | 2011-03-24 | 2011-10-05 | 石河子大学 | Vector for controlling gender of animals and application thereof |
| CN102703578A (en) * | 2011-07-06 | 2012-10-03 | 郭奇伟 | Multiple real-time fluorescent PCR detection kit for Y chromosome microdeletion |
| CN102277434A (en) * | 2011-07-28 | 2011-12-14 | 曹跃琼 | Application and relevant drug of human ZFX (zinc finger-X) gene |
| CN102912028A (en) * | 2012-11-06 | 2013-02-06 | 北京阅微基因技术有限公司 | Amplification composite for detecting microdeletion of Y-chromosome and detection kit |
Non-Patent Citations (3)
| Title |
|---|
| Sequence 148030 from Patent WO2005116265;Mounts,W.M.;《GENBANK》;20090605;序列 * |
| siRNA介导小鼠Zfy基因干扰的定量分析;彭强等;《石河子大学学报》;20110831;摘要 * |
| Zfx在人脑胶质瘤中的功能研究;苏作鹏;《中国硕士论文全文数据库》;20120331;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103131709A (en) | 2013-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108441519A (en) | The method that homologous remediation efficiency is improved in CRISPR/CAS9 gene editings | |
| CN110295149B (en) | Mutant strain 3 type duck hepatitis A virus CH-P60-117C strain and construction method thereof | |
| CN109321571A (en) | A method of utilizing CRISPR/Cas9 preparation and reorganization porcine pseudorabies virus | |
| CN103131709B (en) | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control | |
| CN114350615B (en) | STAT2 gene deletion cell strain and preparation method and application thereof | |
| CN110218732B (en) | African swine fever virus tandem gene, co-expression vector, construction method and application | |
| CN114369619A (en) | Reporter vector for gene knockout, vector system and application | |
| CN101121939B (en) | Universal green fluorescence protein fusion target gene expression vector for siRNA screening system | |
| CN109456991B (en) | Protocatechuic acid regulated switch system, regulating method and application thereof | |
| CN110295180B (en) | Type 3 duck hepatitis A virus mutant gene ISA-A117C-C4334A and construction method thereof | |
| CN110684781B (en) | Type 3 duck hepatitis A virus mutant gene ISA-A117C-T1142A and construction method thereof | |
| CN111088282B (en) | Application of AAVS1 and H11 safe harbor sites in recombinant expression protein | |
| CN109055375A (en) | A kind of CRISPR assists the method and its application of trans- enhancer activated gene expression | |
| CN110747232A (en) | Long-acting stably expressed baculovirus vector and construction method thereof | |
| CN109456992B (en) | Protocatechuic acid regulated multifunctional gene expression platform and application thereof | |
| CN101186925B (en) | General-purpose highly effective eukaryon expression carrier p3I-GFPN and mastitis-resisting transgene carrier constructed by the same | |
| CN101705246A (en) | Lentiviral gene transfer vector, preparation method and application thereof | |
| CN109371167A (en) | Genetic elements and the application of frameshift mutation are generated for detecting CRISPR/Cas9 gene editing system cutting gene | |
| CN110283835B (en) | Type-3 duck hepatitis A virus mutant gene ISA-T1142A-C4334A and construction method thereof | |
| CN104195153A (en) | Bicistronic co-expression gene transfer bodyand preparation method | |
| CN110295148A (en) | A kind of method of 3 type duck hepatitis A virus reverse genetic strain of rapid build | |
| CN100386437C (en) | Method for constructing idiosyncratic carrier of galactophore of transgenic animal in high expression level | |
| CN111647629B (en) | Method for reducing tandem connection of double-stranded DNA (deoxyribonucleic acid) fragments in CRISPR-Cas9 gene editing and application thereof | |
| CN110484546A (en) | 3 type duck hepatitis A virus mutated gene ISA-C4334A of one kind and construction method | |
| CN113652406B (en) | Recombinant virus strain for infectious laryngotracheitis of chickens and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141217 Termination date: 20190218 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |