CN111647629B - Method for reducing tandem connection of double-stranded DNA (deoxyribonucleic acid) fragments in CRISPR-Cas9 gene editing and application thereof - Google Patents

Abstract

The invention provides a method for reducing tandem connection of double-stranded DNA (deoxyribonucleic acid) fragments in CRISPR-Cas9 gene editing and application thereof. The method comprises the following steps: connecting a suicide gene at the 5 'end of the double-stranded DNA, connecting a suicide gene promoter at the 3' end, mixing the double-stranded DNA with a CRISPR-Cas9 reaction system, and transferring the double-stranded DNA into a cell to be edited to finish CRISPR-Cas9 gene editing. The suicide gene element and the promoter element thereof are respectively connected to two ends of dsDNA, when the DNA tandem connection occurs, the promoter and the suicide gene are connected in series to induce the suicide gene to express, thereby killing host cells, leading the host cells to die and eliminating the DNA tandem connection phenomenon.

Description

Method for reducing tandem connection of double-stranded DNA (deoxyribonucleic acid) fragments in CRISPR-Cas9 gene editing and application thereof

Technical Field

The invention relates to the field of genetic engineering, and relates to a method for reducing tandem connection of double-stranded DNA (deoxyribonucleic acid) fragments in CRISPR-Cas9 gene editing.

Background

Suicide gene (suicide gene) refers to a gene of some viruses or bacteria, which is introduced into a target cell, and the expressed product is a toxic substance or can catalyze a nontoxic precursor to be converted into a toxic substance, thereby causing a recipient cell carrying the gene to be killed. DTA and TK are two suicide genes commonly used in eukaryotic cells, wherein DTA can generate toxic substances without adding a substrate, and TK can play a suicide role without adding a substrate. At present, suicide genes are often used for treating tumors and infectious diseases, and are also often used as negative screens in genetic engineering.

With the intensive research and interpretation of Non-Homologous end joining (NHEJ) and Homologous Recombination (HR) repair methods, DNA repair mechanisms are gradually applied to gene editing techniques for the targeted modification of genes. Researchers use nuclease technology to purposefully break the double strand of DNA, and use this mechanism to regulate the expression of a target gene or introduce a selectable marker.

CRISPR-Cas9-mediated homology directed DNA repair is the first method of precise gene editing in a variety of model organisms including mice and humans. The Cas9 protein cuts a DNA Double strand to form DNA Double Strand Breaks (DSBs), and a NHEJ repair mechanism is utilized to randomly delete or insert a base to cause frameshift mutation, so that a target gene is knocked out; introducing a section of exogenous gene while shearing, and accessing the exogenous gene into DSBs sites by NHEJ to realize gene insertion; or the two ends are respectively provided with a shearing site, the middle segment is free, and the two ends are connected through an NHEJ mechanism to form large-segment gene knockout. Meanwhile, a foreign gene and a homologous sequence are added during shearing, and the gene can be accurately knocked in and replaced at a fixed point under the action of an HR mechanism. The method is widely used in the biomedical field at present, so that the editing is more efficient and the sequence is more specific.

Nevertheless, this technique still has drawbacks. Researches show that in the process of establishing six knockout mouse models under different conditions, the donor DNA template has multiple unnecessary head-tail tandem phenomena. In most cases, these multiple integration events are not recognized by conventional PCR analysis, which seriously affects the accuracy of the technique (see Skryabin BV, et al. Pervasive head-to-tail insertions of DNA templates determined CRISPR-Cas9-mediated genome editing events. Sci adv. 2020;6(7): eaax 2941.).

In the CRISPR-Cas9 gene targeting process, the recombinant DNA fragments have a head-to-tail tandem phenomenon, and the tandem phenomenon causes the gene targeting failure. In the field, Southern, qPCR, PCR and other methods are commonly used to detect whether there is a tandem, but no effective method for reducing the tandem has been found.

Therefore, the suicide gene is used for reducing the tandem rate of the recombinant DNA fragment in the CRISPR-Cas9 gene targeting, and the method has important significance for the development and the improvement of the CRISPR-Cas9 gene editing technology.

Disclosure of Invention

In view of the problems in the prior art, the invention provides a method for reducing tandem connection of double-stranded DNA fragments in CRISPR-Cas9 gene editing and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a method of reducing tandem of double stranded dna (dsdna) fragments in CRISPR-Cas9 gene editing, the method comprising the steps of: connecting a suicide gene at the 5 'end of the double-stranded DNA, connecting a suicide gene promoter at the 3' end, mixing the double-stranded DNA with a CRISPR-Cas9 reaction system, transferring the mixed double-stranded DNA into a cell to be edited, and finishing CRISPR-Cas9 gene editing.

In order to reduce the tandem phenomenon in the CRISPR-Cas9 gene editing process, the promoter and the suicide gene are respectively added on two sides of the dsDNA, namely, the suicide gene is connected to the 5 'end of the dsDNA, and the promoter of the suicide gene is connected to the 3' end of the dsDNA. If two dsDNAs are connected in series, the promoter at the 3 'end is connected with the suicide gene at the 5' end, so that the suicide gene is expressed, and cells cannot survive, thereby reducing the series connection rate in the CRISPR-Cas9 gene editing process.

As a preferred technical scheme of the invention, the suicide gene comprises DTA or TK.

Preferably, the promoter of the suicide gene comprises any one of CAG, CMV, EF1a or PGK.

Preferably, the suicide gene is DTA and the promoter of the suicide gene is CMV.

In the present invention, the suicide gene and the type of promoter of the suicide gene are not particularly limited. Any suicide gene and a promoter of the suicide gene that can produce an effect of killing recipient cells can be used. Preferably, the nucleotide sequence of the suicide gene (DTA gene) is shown as SEQ ID No.1, and the nucleotide sequence of the promoter of the suicide gene (CMV gene) is shown as SEQ ID No. 2.

Wherein SEQ ID NO.1 is:

ATGGATCCTGATGATGTTGTTATTCTTCTAATCTTTTGTATGGAAAACTTTTCTTCGTACCACGGGACTAAACCTGGTTATGTAGATTCCATTCAAAAAGGTATACAAAAGCCAAAATCTGGTACACAAGGAAATTATGACGATGATTGGAAAGGGTTTTATAGTACCGACAATAAATACGACGCTGCGGGATACTCTGTAGATAATGAAAACCCGCTCTCTGGAAAAGCTGGAGGCGTGGTCAAAGTGACGTATCCAGGACTGACGAAGGTTCTCGCACTAAAAGTGGATAATGCCGAAACTATTAAGAAAGAGTTAGGTTTAAGTCTCACTGAACCGTTGATGGAGCAAGTCGGAACGGAAGAGTTTATCAAAAGGTTCGGTGATGGTGCTTCGCGTGTAGTGCTCAGCCTTCCCTTCGCTGAGGGGAGTTCTAGCGTTGAATATATTAATAACTGGGAACAGGCGAAAGCGTTAAGCGTAGAACTTGAGATTAATTTTGAAACCCGTGGAAAACGTGGCCAAGATGCGATGTATGAGTATATGGCTCAAGCCTGTGCAGGAAATCGTGTCAGGCGATCTCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAA；

SEQ ID NO.2 is:

TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATC。

in the invention, when the DTA gene is used as a suicide gene and the CMV is used as a promoter, the tandem efficiency of the obtained gene editing method is low, and the receptor cells can be effectively started and killed.

As a preferable technical scheme of the invention, the concentration of the dsDNA mixed with the CRISPR-Cas9 reaction system is 2-10 ng/muL, for example, 2 ng/muL, 3 ng/muL, 4 ng/muL, 5 ng/muL, 6 ng/muL, 7 ng/muL, 8 ng/muL, 9 ng/muL or 10 ng/muL.

Preferably, the CRISPR-Cas9 reaction system includes sgRNA and Cas9 mRNA.

In a preferred embodiment of the present invention, the working concentration of the sgRNA is 2 to 8 ng/. mu.L, and may be, for example, 2 ng/. mu.L, 3 ng/. mu.L, 4 ng/. mu.L, 5 ng/. mu.L, 6 ng/. mu.L, 7 ng/. mu.L, or 8 ng/. mu.L.

Preferably, the working concentration of the Cas9 mRNA is 5-15 ng/. mu.L, such as 5 ng/. mu.L, 6 ng/. mu.L, 8 ng/. mu.L, 10 ng/. mu.L, 12 ng/. mu.L, 14 ng/. mu.L or 15 ng/. mu.L.

In the invention, the CRISPR-Cas9 reaction system is used for gene editing, including gene insertion, gene knockout and the like, and the working concentration and specific components of the reaction system can influence the efficiency of gene editing. Therefore, after the dsDNA with the suicide gene and the promoter is introduced into the cell to be edited by matching the working concentration, the gene targeting can be more accurately realized, the tandem rate is reduced, the off-target probability is reduced, and the success rate is improved.

In the invention, in order to further reduce the tandem rate, the restriction sites of restriction enzyme I and restriction enzyme II can be further connected on the basis of connecting the suicide gene and the promoter, namely the double-stranded DNA is obtained by cutting the vector by the restriction enzyme I and the restriction enzyme II, and the restriction enzyme I and the restriction enzyme II are homologous overhanging non-isocaudarner enzymes or non-homologous overhanging enzymes.

It should be noted that the term "homooverhanging non-isocaudarner" as used herein means that when restriction enzyme I cleaves the 5 'end of the double-stranded DNA and restriction enzyme II cleaves the 3' end of the double-stranded DNA, the cohesive ends obtained by restriction enzymes I and II are both 5 '-3' or both 3 '-5', and the sequences of the cohesive ends cannot be complementarily paired, for example, BamH1 and Xba1 are a pair of homooverhanging non-isocaudarner; the term "non-homooverhang enzyme" as used herein means that when the restriction enzyme I cleaves the 5 'end of the double-stranded DNA and the restriction enzyme II cleaves the 3' end of the double-stranded DNA, the cohesive ends of the restriction enzymes I and II are in different orientation, for example, BamH1 and Sac1 are a pair of non-homooverhang enzymes.

Preferably, the restriction enzyme I and the restriction enzyme II are non-homologous overhang enzymes, the cohesive end formed after the restriction enzyme I is cut by the restriction enzyme I is 5 '-3', and the cohesive end formed after the restriction enzyme II is cut by the restriction enzyme II is 3 '-5';

or the restriction enzyme I and the restriction enzyme II are non-homologous overhang enzymes, the cohesive end formed after the restriction enzyme I is cut by the enzyme I is 3 '-5', and the cohesive end formed after the restriction enzyme II is cut by the enzyme II is 5 '-3'.

As a preferred technical scheme, the cell to be edited comprises mouse fertilized eggs.

As a preferred technical scheme of the invention, the method comprises the following steps:

connecting a suicide gene at the 5 'end of the double-stranded DNA, connecting a suicide gene promoter at the 3' end, and mixing the double-stranded DNA with a CRISPR-Cas9 reaction system; the working concentration of sgRNA in the CRISPR-Cas9 reaction system is 2-8 ng/mu L, the working concentration of Cas9 mRNA is 5-15 ng/mu L, and the concentration of the double-stranded DNA mixed with the CRISPR-Cas9 reaction system is 2-10 ng/mu L; then, the cells are transferred into mouse fertilized eggs to obtain gene-edited fertilized egg cells.

Illustratively, the method provided by the invention comprises the following steps:

firstly, designing a nucleic acid sequence of double-stranded DNA, connecting a suicide gene at the 5 'end of the double-stranded DNA, connecting a suicide gene promoter at the 3' end of the double-stranded DNA, and connecting enzyme cutting sites at the two ends of the double-stranded DNA;

the double stranded DNA was then cloned into pUC57 or pBlueScript vectors, which were purified using a plasmid extraction kit, and the sequences containing the donor DNA template were cut using any restriction enzyme;

the donor dsDNA fragments were separated by 1% agarose gel electrophoresis, purified using gel recovery kit, and stored in ddH₂O is in;

mixing the dsDNA with a CRISPR-Cas9 reaction system and injecting the mixture into mouse fertilized egg cells, wherein in the invention, cell microscopic microinjection can be carried out on an inverted microscope by using a transfer syringe and a micromanipulator in an M2 culture medium;

the injected surviving fertilized cells were transferred into the oviduct of a pseudopregnant mouse and a full-term pregnancy was performed;

genomic DNA isolated from tail biopsies was analyzed by PCR to identify positively targeted F0 animals.

In a second aspect, the use of a method as described in the first aspect for constructing a CRISPR-Cas9 gene editing method.

The recitation of numerical ranges herein includes not only the above-recited values, but also any values between any of the above-recited numerical ranges not recited, and for brevity and clarity, is not intended to be exhaustive of the specific values encompassed within the range.

Compared with the prior art, the invention has at least the following beneficial effects:

in the invention, the suicide gene element and the promoter element thereof are respectively connected to two ends of dsDNA, when the DNA is connected in series, the promoter and the suicide gene are connected in series to induce the suicide gene to express, thereby killing host cells and leading the host cells to die so as to eliminate the phenomenon of DNA connection in series. When the method is applied to CRISPR-Cas9 gene editing, the tandem rate can be obviously reduced, meanwhile, when the method is used for editing mouse fertilized eggs, the success rate of editing is not influenced, the survival rate is not obviously reduced compared with the previous method, but the tandem rate is reduced to 6.3-15.4% from 35.5-50%, and the tandem phenomenon in the gene editing process is greatly reduced.

Drawings

FIG. 1 is a schematic diagram of the structure of dsDNA fragments constructed in example 1.

FIG. 2 is a micrograph of dsDNA injected into pronuclei as in example 1.

Detailed Description

The technical solutions of the present invention are further described in the following embodiments with reference to the drawings, but the following examples are only simple examples of the present invention and do not represent or limit the scope of the present invention, which is defined by the claims.

In the following examples, female (C57 BL/6JGpt, 4 weeks old), male (C57 BL/6JGpt, >8 weeks old) mice: all produced by Jiangsu Jiejiaokang Biotech limited;

in the following examples, reagents used included: hyaluronidase working solution, DPBS working solution, injection buffer solution, PMSG/HCG working solution, M16, M2, 75% alcohol and mineral oil; the apparatus used comprises: inverted microscope, micro-operation system, micro sample loader, needle drawing instrument, needle forging instrument, and CO₂Incubator, refrigerator, stereomicroscope; the consumables used include: GD-1 glass needle, microsyringe, 3.5cm dish, fixed tube, fallopian tube, 1mL syringe, surgical instrument, etc.; are all commercially available from conventional sources.

In the following examples, the remaining steps can be performed by means of techniques commonly used in the art, such as digestion, purification, etc., except for specific descriptions.

Example 1

In this embodiment, a method of reducing tandem of double-stranded DNA fragments in CRISPR-Cas9 gene editing is provided.

(1) Construction of dsDNA

The structure of dsDNA constructed in this example is schematically shown in FIG. 1;

putting DTA at the 5 'end of the dsDNA in the forward direction, putting CMV at the 3' end of the dsDNA in the forward direction, and simultaneously, containing enzyme cutting sites of EcoRV at the two ends of the dsDNA fragment;

constructing the designed sequence on a Plasmid (Plasmid) vector, and carrying out enzyme digestion and purification by adopting EcoRV to obtain dsDNA;

wherein the enzyme cutting system is EcoRV 3 mu L, plasmid 25 mu L (the concentration is 2 mu g/mu L), Buffer smart10 mu L, ddH₂O is complemented to 100 mu L;

the enzyme digestion process is as follows: the time is 8 h; the temperature is 37 ℃;

after the completion of the digestion, the dsDNA was recovered by purification and diluted to 5 ng/uL with TE buffer.

(2) Microinjection of mouse fertilized egg

Obtaining fertilized eggs, preparing a fixed tube and an injection tube, preparing an operating dish and a culture dish, and adding a microsyringe for an injection sample into the injection tube;

the injection process was as follows:

1. the injection tube and the fixed tube are arranged in the operation arm;

2. fertilized eggs cultured in M16 were transferred into prepared M2 drops and aligned in a long row;

3. placing the injection dish on an objective table of an inverted microscope;

4. the injection tube and the fixed tube are inserted into the M2 liquid drop and are placed in the center of the visual field;

5. opening the injector to create a constant pressure in the syringe tube and adjusting the microscope to clearly see the pronuclei;

6. sucking an ovum by using a fixed tube, and adjusting the position of the ovum by using an injection tube to ensure that a pronucleus is clearly visible;

7. the injection tube is inserted into the pronuclei and is driven into the DNA mixing system, as shown in FIG. 2;

8. pushing the ovum downwards or upwards by using an injection tube, sucking a new ovum for injection, and repeating the steps until all the ova are injected;

9. transferring the embryo to a culture medium containing M16 after injection to transplant the surviving fertilized egg into the oviduct of the pseudopregnant recipient;

(3) transplantation, breeding and identification

Transplanting the fertilized ovum into oviduct of surrogate mouse, and after about 20 days, F0 mouse is born; after one week of birth, the tail is clipped, the rat tail genome is extracted, PCR and sequencing identification are carried out, and the tandem rate is counted.

Example 2

In this example, DTA is placed forward at 5 'end of dsDNA, CMV is placed forward at 3' end of dsDNA, and simultaneously, both ends of dsDNA fragment contain enzyme cutting sites of BamH1 and Sac1, the designed sequence is constructed on plasmid vector, and BamH1 and Sac1 are used for enzyme cutting and purification to obtain dsDNA.

The enzyme cutting system is as follows: BamH 13. mu. L, Sac 13. mu.L, plasmid 25. mu.L (concentration 2. mu.g/. mu.L), Buffer smart 10. mu. L, ddH₂O is complemented to 100 mu L; and (3) enzyme digestion process: the time is 8 h; the temperature is 37 ℃;

microinjection of mouse fertilized eggs was performed in the same manner as in example 1.

Comparative example 1

The difference from example 1 is that the promoter CMV and suicide gene DTA are not contained at both ends of the gene, and the remaining operation steps are the same as example 1.

Comparative example 2

The difference from example 2 is that the two ends of the gene do not contain the CMV promoter and the DTA suicide gene, and the rest of the operation steps are the same as example 2.

Statistics of series ratio

400 mouse fertilized eggs were injected, cultured after transplantation, and F0 mice were born and connected in series by PCR assay to F0 mice according to the methods provided in the above examples and comparative examples.

The detection principle is as follows: designing outward PCR primers at two ends of the dsDNA, if the fragments are not connected in series, no product exists, if the fragments are connected in series, a product can be amplified, and the statistical tandem rate is a tandem mouse/positive mouse;

the PCR and tandem results are shown in table 1:

TABLE 1

The results in the table show that the method provided by the invention can obviously reduce the series rate, and the series rate is reduced from 50% to 6.3%. Although theoretically, the tandem suicide gene expression should not cause any tandem phenomenon in the invention, experiments show that intracellular enzymes digest CMV and DTA at both ends of dsDNA, so that when the two expression elements are incomplete, the suicide gene cannot be expressed, and thus a small amount of tandem phenomenon still occurs in the actual experimental process; in the same way, the homodromous non-homodromous or non-homodromous endonucleases can not be connected in series theoretically, but in practical experiments, intracellular enzymes are found to flatten the protruding ends and then realize the connection in series. In conclusion, the suicide gene and the promoter thereof are respectively designed at two ends of the double-stranded DNA, so that the tandem rate can be obviously reduced, and meanwhile, the tandem rate can be further reduced if different sticky end endonucleases are used for enzyme digestion.

The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Jiangsu Jiejiaokang Biotech limited

<120> method for reducing tandem connection of double-stranded DNA fragments in CRISPR-Cas9 gene editing and application thereof

<130>20200722

<160>2

<170>PatentIn version 3.3

<210>1

<211>654

<212>DNA

<213> Artificial Synthesis

<400>1

atggatcctg atgatgttgt tattcttcta atcttttgta tggaaaactt ttcttcgtac 60

cacgggacta aacctggtta tgtagattcc attcaaaaag gtatacaaaa gccaaaatct 120

ggtacacaag gaaattatga cgatgattgg aaagggtttt atagtaccga caataaatac 180

gacgctgcgg gatactctgt agataatgaa aacccgctct ctggaaaagc tggaggcgtg 240

gtcaaagtga cgtatccagg actgacgaag gttctcgcac taaaagtgga taatgccgaa 300

actattaaga aagagttagg tttaagtctc actgaaccgt tgatggagca agtcggaacg 360

gaagagttta tcaaaaggtt cggtgatggt gcttcgcgtg tagtgctcag ccttcccttc 420

gctgagggga gttctagcgt tgaatatatt aataactggg aacaggcgaa agcgttaagc 480

gtagaacttg agattaattt tgaaacccgt ggaaaacgtg gccaagatgc gatgtatgag 540

tatatggctc aagcctgtgc aggaaatcgt gtcaggcgat ctctttgtga aggaacctta 600

cttctgtggt gtgacataat tggacaaact acctacagag atttaaagct ctaa 654

<210>2

<211>589

<212>DNA

<213> Artificial Synthesis

<400>2

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatc 589

Claims (7)

1. A method of reducing tandem of double-stranded DNA fragments in CRISPR-Cas9 gene editing, comprising the steps of:

connecting a suicide gene at the 5 'end of the double-stranded DNA, connecting a promoter of the suicide gene at the 3' end, mixing the double-stranded DNA with a CRISPR-Cas9 reaction system, and transferring the double-stranded DNA into a cell to be edited to finish CRISPR-Cas9 gene editing;

wherein the suicide gene is DTA, the promoter of the suicide gene is CMV, the nucleotide sequence of the suicide gene is shown as SEQ ID NO.1, and the nucleotide sequence of the promoter of the suicide gene is shown as SEQ ID NO. 2;

and the suicide gene is placed at the 5 'end of the double-stranded DNA in the forward direction, and the promoter of the suicide gene is placed at the 3' end of the double-stranded DNA in the forward direction.

2. The method according to claim 1, wherein the concentration of the double-stranded DNA mixed with the CRISPR-Cas9 reaction system is 2-10 ng/μ L;

the CRISPR-Cas9 reaction system includes sgRNA and Cas9 mRNA;

the working concentration of the sgRNA is 2-8 ng/mu L;

the working concentration of the Cas9 mRNA is 5-15 ng/. mu.L.

3. The method according to claim 1, wherein the double-stranded DNA is obtained by digesting the vector with restriction enzyme I and restriction enzyme II, wherein the restriction enzyme I and the restriction enzyme II are homologous overhang non-homocerclase or non-homologous overhang enzyme.

4. The method according to claim 3, wherein the restriction enzyme I and the restriction enzyme II are non-homomeric overhang enzymes, the cohesive end formed after the restriction enzyme I is cut by the restriction enzyme I is 5 '-3', and the cohesive end formed after the restriction enzyme II is cut by the restriction enzyme II is 3 '-5';

or the restriction enzyme I and the restriction enzyme II are non-homologous overhang enzymes, the cohesive end formed after the restriction enzyme I is cut by the enzyme I is 3 '-5', and the cohesive end formed after the restriction enzyme II is cut by the enzyme II is 5 '-3'.

5. The method of claim 1, wherein the cell to be edited comprises a mouse zygote.

6. Method according to claim 1, characterized in that it comprises the following steps:

connecting a suicide gene at the 5 'end of the double-stranded DNA, connecting a suicide gene promoter at the 3' end, and mixing the double-stranded DNA with a CRISPR-Cas9 reaction system;

the working concentration of sgRNA in the CRISPR-Cas9 reaction system is 2-8 ng/mu L, the working concentration of Cas9 mRNA is 5-15 ng/mu L, and the concentration of the double-stranded DNA mixed with the CRISPR-Cas9 reaction system is 2-10 ng/mu L;

then, the cells are transferred into mouse fertilized eggs to obtain gene-edited fertilized egg cells.

7. Use of the method of any one of claims 1 to 6 in constructing a CRISPR-Cas9 gene editing method.

Images